doi:10.1016/j.jmb.2006.06.071
J. Mol. Biol. (2006) 361, 644–658
The Role of the Lid Element in Transcription by
E. coli RNA Polymerase
Innokenti Toulokhonov⁎ and Robert Landick⁎
Department of Bacteriology,
University of
Wisconsin-Madison,
Madison, WI 53706, USA
The recently described crystal structures of multi-subunit RNA polymerases (RNAPs) reveal a conserved loop-like feature called the lid. The lid
projects from the clamp domain and contacts the flap, thereby enclosing
the RNA transcript in RNAP's RNA-exit channel and forming the junction
between the exit channel and the main channel, which holds the RNA:
DNA hybrid. In the initiating form of bacterial RNAP (holoenzyme
containing σ), the lid interacts with σ region 3 and encloses an extended
linker between σ region 3 and σ region 4 in place of the RNA in the exit
channel. During initiation, the lid may be important for holding open the
transcription bubble and may help displace the RNA from the template
DNA strand. To test these ideas, we constructed and characterized a
mutant RNAP from which the lid element was deleted. Δlid RNAP
exhibited dramatically reduced activity during initiation from −35dependent and −35-independent promoters, verifying that the lid is
important for stabilizing the open promoter complex during initiation.
However, transcript elongation, RNA displacement, and, surprisingly,
transcriptional termination all occurred normally in Δlid RNAP. Importantly, Δlid RNAP behaved differently from wild-type RNAP when
transcribing single-stranded DNA templates where it synthesized long,
persistent RNA:DNA hybrids, in contrast to efficient transcriptional arrest
by wild-type RNAP.
© 2006 Elsevier Ltd. All rights reserved.
*Corresponding authors
Keywords: RNA polymerase; transcription; the lid element; extended RNA:
DNA hybrid
Introduction
DNA-dependent RNA polymerase (RNAP) is the
central enzyme of gene expression in all living
organisms. Over the past few years, high-resolution
structures of multi-subunit RNAPs have revealed
the tremendous structural similarity of bacterial and
eukaryotic RNAPs and provided a basis for understanding the different steps in the transcription
cycle.1,2 These structures allow the identification of
protein elements and amino acid residues crucial for
the function of RNAP.
The lid is one of several interesting structural
elements in RNAP that protrude from the clamp
domain to seal the main channel (the rudder) and
Abbreviations used: RNAP, RNA polymerase; TEC,
transcription elongation complex.
E-mail addresses of the corresponding authors:
[email protected]; [email protected]
RNA exit channel (the lid, zipper, and zinc-binding
domain) (Figure 1(a)). The lid consists of a 14 amino
acid residue loop that protrudes from the clamp at
the junction of the main channel and RNA exit
channel, and is hypothesized to play important roles
during transcription initiation and elongation (Figure 1(b)).1,3,4 In the Thermus aquaticus and Thermus
thermophilus holoenzyme structures, the lid interacts
with transcription initiation factor σ (Figure 1(c)).2,4
These structures reveal that the σ region 3.2 (the σ
R3-4 linker) threads through a tunnel created by
interaction of the β′ lid with the inner surface of the
β flap.2,4 Thus, both binding and release of σ factor
must require movement of the lid to allow the σ R34 linker to enter and escape the RNA exit channel.
Although the amino acid sequence and even the
length of the lid are not well conserved among
multi-subunit RNAPs, the structure of the β′ lid in
the holoenzyme is similar to that of the RNAP II
Rpb1 lid in the transcription elongation complex
(TEC).3,5 In the structure of TEC, the lid is located at
the upstream end of the RNA-DNA hybrid and
0022-2836/$ - see front matter © 2006 Elsevier Ltd. All rights reserved.
Role of Lid Element in Transcription by RNAP
forms a wedge between RNA and DNA strands
(Figure 1(d)).5 Based on its location in the transcription complex, it has been proposed that the lid plays
key roles in separation of RNA from RNA:DNA
hybrid, in RNA exit, and in maintenance of the
upstream end of the transcription bubble. However,
neither the functional importance of lid−sigma
interaction to transcription initiation nor the role of
the lid element during transcription elongation has
been evaluated.
To analyze the functional role of the lid element,
we constructed an Escherichia coli RNA polymerase
deletion mutant lacking the lid element and examined the effects of removal of the lid element on
transcription initiation, elongation, and termination.
Results
Construction of the lid deletion RNAP
To delete the lid element from RNAP, we removed
the segment of amino acid sequence of the lid that is
weakly conserved among multi-subunit RNAPs
(Figure 1(b)). The lid sequence is flanked by regions
645
of conserved structure. The N-terminal side of the
lid is the part of the evolutionarily conserved
segment B of the largest RNAP subunit. At the Cterminal side of the lid, two antiparallel α-helices
form the major σ-binding site in the bacterial
holoenzyme.2,4,6 We removed the 14 amino acid
residues corresponding to β′ 251−264 between these
two conserved regions. In the crystal structure of
bacterial RNAP from T. thermophilus, the distance
between the homologous amino acid residues
corresponding to E. coli β′ 250 and 265 is ∼ 8 Å.2
To bridge the gap between the points of the
deletion, we introduced a three amino acid linker
(GlyGlyGly) in place of the deleted residues. The
mutant enzyme was over-expressed and purified
from E.coli cells.7 Δlid core RNAP bound σ70 more
weakly than wild-type core RNAP at equimolar
ratios of core RNAP and σ70 as determined by a gel
mobility shift assay (data not shown). Thus, we
used a saturating excess of σ70 over Δlid core RNAP
to form the holoenzyme in promoter-dependent
initiation assays (data not shown). Properties of
Δlid core and holoenzymes were compared with
wild-type E. coli RNAP in a set of in vitro transcription assays.
Figure 1. The lid and its interactions with sigma and nucleic acids. (a) Location of the lid in bacterial RNAP (structural
model based on T. thermophilus2 and T. aquaticus45 RNAP structures as previously described).26 RNAP depicted as
molecular surface and color coded as follows: αI, αII, ω, gray; β, blue, β′, pink, σ, bright orange. The β′ lid (green), β flap
(blue) and σ are shown as α-carbon backbone worms. (b) The sequence of the E. coli β′ subunit in vicinity of the lid
element. β′ domains and conserved regions (A−H) are depicted above the sequence. At the bottom, the top E. coli (E.c.)
sequence is aligned with the corresponding regions from T. thermophilus (T.th.), and yeast RNA polymerase II (YPII). The
deleted sequence corresponding to the lid is shown in the box (green). (c) Location of lid relative to sigma in a holoenzyme
structure.2 RNAP colored as in (a) with sigma depicted as an orange worm. (d) Location of lid relative to RNA in a TEC
structural model.26 RNAP colored as in (a) with RNA (red) and template DNA strand (black).
646
The lid deletion RNAP inhibits σ70-dependent
initiation
We first tested the effect of the lid deletion on
initiation from T7A1 and galP1con promoters. These
two strong promoters are recognized by E. coli σ70
holoenzyme. T7A1 is −35-dependent promoter,
whereas galP1con promoter belongs to a class of
−35-independent promoters with extended −10
element.8,9 Extended −10 promoters lack a recognizable –35 element and have the additional TG motif
one base-pair upstream of the –10 sequence.
Promoter complex formation on extended –10
promoters is independent of interaction of the σ
factor with the −35 element.10 The transcribed
sequence following these two promoters on our
templates is identical, and initiation in the presence
of dinucleotide ApU and three of four NTPs (ATP,
GTP, CTP) results in formation of halted A29
elongation complexes.9 As expected, the wild-type
RNAP formed full-length (A29) and abortive products on both T7A1 and galP1con promoter-contain-
Role of Lid Element in Transcription by RNAP
ing DNA fragments (Figure 2(a)). In contrast, the
Δlid RNAP enzyme was essentially inactive in
transcription from T7 A1 and galP1con promoter
DNAs (Figure 2(a)). Even high concentrations of
substrates (1 mM) did not yield significant RNA
synthesis by the lid deletion RNAP, regardless of
whether ApU or ATP were used as initiators (data
not shown). Thus, the lid appears to be required for
proper transcription initiation at both –35-dependent and –35-independent promoters.
The inability of the mutant RNAP to transcribe
from these two strong promoters led us to consider
whether deletion of the lid element had an effect on
catalytic activity of the enzyme. We tested the catalytic proficiency of the mutant RNAP by assaying its
ability to extend RNA in elongation complexes
assembled by reconstitution using synthetic DNA
and RNA oligonucleotides.11–14 This method eliminates requirements for σ70 and for de novo initiation
at promoters. We found that Δlid RNAP was as
active as the wild-type RNAP in extension of RNA
from 9 nt to 17 nt on the scaffold templates (Figure
Figure 2. Deletion of the lid
impairs initiation at −35-dependent
and −35-independent promoters.
(a) Results of transcription initiation
reactions performed on the −35
class T7 A1 promoter and the extended −10 class galP1con promoter
using wild-type and Δlid RNAPs.
Reaction products were relsolved
by denaturing PAGE and revealed
by autoradiography. (b) RNAP
lacking the lid is catalytically competent. Artificial elongation complexes were assembled using the
indicated RNAP core enzymes,
9mer RNA and two complementary
DNA oligonucleotides (NS4, template DNA strand and TS4, the nontemplate DNA strand). The nucleic
acid scaffold templates are shown
at the top of the Figure. Sequence of
9mer RNA primer is underlined.
The 9mer RNA was elongated with
5 μM ATP, GTP and 0.1 μM [α-32P]
GTP to form 17mer RNA. The
reaction proceeded for 10 min at
37 °C, and reaction products were
resolved by denaturing PAGE and
revealed by autoradiography (bottom panel).
Role of Lid Element in Transcription by RNAP
2(b)). This result indicates that Δlid RNAP is
catalytically active even though it is compromised
for transcription initiation.
Potential contacts of the lid with template DNA
strand, in addition to its contacts with σ, suggest
that Δlid RNAP could be defective in formation of
stable RNAP−promoter complexes. If so, the activity
of the mutant enzyme may be increased at promoters that favor formation of stable open complexes.15
UP element activates transcription by the lid
deletion RNAP
To test whether promoters with long-lived open
complexes stimulate transcription by Δlid RNAP,
647
we studied transcription initiation on the full
consensus (fullcon) promoter and its derivative
with UP element (UP-fullcon) (Figure 3(a)).16,17 The
fullcon promoter has the consensus –35 and
extended –10 promoter elements; the UP-fullcon
construct has, in addition, an A-rich promoter
element (UP-element) located upstream of the –35
promoter element.18–20 Open promoter complexes
formed on these promoters are exceptionally
stable.16,18 Wild-type RNAP produced a high level
of abortive products on both DNA fragments
(Figure 3(b)). Such high level of short RNA products
can be explained by the fact that strong interaction
of RNAP with promoter sequences inhibits promoter escape. In contrast, little transcription was
Figure 3. UP element activates transcription by the lid-less RNAP. (a) Sequence of the full consensus promoter with
UP element (the non-template strand sequence is shown). −35 and extended −10 promoter elements are underlined; UP
element sequence is shown red. (b) In vitro transcription of consensus promoter containing or lacking UP element.
Promoter fragments were incubated with corresponding RNAPs and transcription was initiated upon addition of all four
NTPs (see Materials and Methods). Abortive and full-length (run-off) transcripts are indicated. (c) Autoradiograph of a
native gel showing the binding of mutant and wild-type RNAP to a linear UP-full consensus promoter probe. Wild-type
and Δlid RNAPs were present at 40 nM (lanes 2, 4, 6, 8) and 80 nM (lanes 3, 5, 7, 9); DNA was present at 10 nM in each
reaction. Promoter complexes were formed for 15 min at 37 °C, and heparin, a DNA competitor, was added to reactions in
lanes 4, 5, 8, 9 prior to loading on 4% native gel. The competitor-resistant shifted bands are likely to be open complexes
(RPo). (d) Open complex stability in vitro. (top) Scheme of experiment. (left) Electrophoretic separation of [α-32P]UTPlabeled RNAs formed on the the full consensus promoter with UP element as a function of the time between the heparin
addition and NTP addition. (right) Plots of open complexes remaining as a function of time after the addition of heparin.
648
observed with Δlid RNAP on the fullcon promoter
lacking an UP element. The mutant RNAP supported primarily the synthesis of single abortive
product (pppGpU) (Figure 3(b)). However, the Δlid
RNAP showed high activity on the UP-fullcon
promoter DNA. Interestingly, the presence of the
UP element significantly increased synthesis of fulllength (productive) RNA by Δlid RNAP. In addition, the distribution of abortive products differed
between wild-type and the Δlid RNAPs on the UPfullcon promoter. It has been proposed that the clash
between the nascent RNA and σ 70 region 3.2
positioned in the RNA exit channel contributes to
abortive initiation; the extent of abortive initiation
can also be influenced by the strength of RNA
polymerase−promoter DNA interactions. 4 , 21 , 22
Either of these factors could account for the
increased production of the full-length RNA and a
selective loss of prominent abortive products at the
full consensus promoter with UP element (UPfullcon). The loss of the σ70 region 3.2/lid interaction
could result in a reduction in abortive RNA
products because σ70 region 3.2 may be more easily
displaced from the RNA exit channel. Alternatively
or in addition, the loss of interactions between σ70
region 3.2 and the template strand DNA in the
transcription bubble could affect promoter escape.
Δlid RNAP forms unstable open complexes
The above experiments demonstrated that the
presence of the UP element activates transcription
by Δlid RNAP. It is known that the UP element
stimulates formation of the initial (closed) complex
and also accelerates a process after DNA binding by
RNAP, presumably, an isomerization to open
complex.18,19 We compared the ability of wild-type
and Δlid RNAPs to form stable promoter complexes
on the UP-full con promoter using the electrophoretic mobility shift assay. A fixed amount of
32
P-labeled linear promoter probe (10 nM) was
incubated with increasing concentrations either of
wild-type or Δlid RNAPs and the reaction products
were separated by native PAGE. As evident from
Figure 3(c), less DNA is bound by Δlid RNAP, even
before heparin challenge of the binding reactions.
Thus, it appears that the lid deletion leads to the
reduced promoter binding by the mutant RNAP.
Moreover, Δlid RNAP promoter complexes exhibited
increased sensitivity to heparin challenge, compared
to wild-type RNAP (Figure 3(c)). Such increased
sensitivity to heparin is consistent with low stability
of Δlid RNAP open promoter complexes.
The ability of the Δlid RNAP to transcribe from
the UP-fullcon promoter allowed us to evaluate the
kinetic stability of its open complexes. To measure
open complex lifetimes, RNAP−promoter complexes were pre-formed on UP-fullcon linear template and challenged with heparin (Figure 3(d)).
After addition of the competitor heparin, the
fraction of complexes remaining at various times
after heparin challenge was quantified by transcription (reaction aliquots at different times following
Role of Lid Element in Transcription by RNAP
heparin addition were supplemented with NTPs to
allow formation of RNA products). Wild-type
RNAP forms exceptionally stable promoter complexes on UP-fullcon DNA with a half-life of ∼ 30 min
(Figure 3(d)). However, Δlid RNAP exhibited a
dramatically decreased half-life, as reflected by
rapid disappearance of the ability to make RNA
transcripts after addition of heparin. We concluded
that removal of the lid element dramatically reduces
open complex longevity even at the full consensus
promoter with UP element.
Effect of the lid deletion on transcription
elongation and termination
In the Saccharomyces cerevisiae RNAPII TEC, the lid
is located at the upstream end of the RNA-DNA
hybrid; after separation from the hybrid the singlestranded RNA exits beneath the lid.3,5,23 Thus the
lid could contribute both to elongation complex
stability and to the separation of RNA from RNA:
DNA hybrid. In addition, the lid could maintain the
upstream boundary of the transcription bubble by
keeping the DNA non-template and template
strands apart.1,5
To assess the effect of the lid on transcript
elongation, we prepared halted TECs containing
wild-type or Δlid RNAPs from synthetic oligonucleotides (Figure 4(a)).14 The initial TEC was
assembled with a 14mer RNA and the two complementary DNA oligonucleotides that encoded the
his pause signal downstream from the site of TEC
assembly (Figure 4(a), TS1-template DNA strand,
NS1-non-template DNA strand, respectively);24 the
reconstituted 14mer transcript was extended in the
absence of UTP and with incorporation of radioactive CMP to position C24 (TEC24, Figure 4(a)).
Both wild-type and Δlid TEC24 quantitatively
elongated upon addition of all four NTPs with the
characteristic delay at the his pause site (Figure 4(b)).
Importantly, Δlid RNAP elongated similarly to
wild-type RNAP. We also found that the pausing
at the his pause site was only modestly affected by
the lid deletion (Figure 4(b)).
Structural data suggest that the lid could contribute to the stability of elongation complexes. To
determine whether the lid deletion could affect the
stability of elongation complexes, we compared the
ability of wild-type and Δlid TEC15 formed on the
template TS1/NS1 (Figure 4(a)) to resume elongation in the presence of ATP, GTP and CTP in either
low-salt (20 mM NaCl) or high-salt (0.5 M NaCl)
buffer (Figure 5(a)). TEC15 formed by Δlid RNAP
were more sensitive to salt compared with the wildtype (Figure 5(a)). When Δlid TECs were immobilized on streptavidin-agarose beads through biotintag on DNA template, we found that unchased RNA
was released from the complex into solution (data
not shown). This indicates that Δlid TECs are
unstable at high salt, whereas the wild-type TEC
are resistant. At the same time, the lid deletion had
no significant effect on TEC stability at low salt
(Figures 4(b) and 5(b)).
Role of Lid Element in Transcription by RNAP
649
Figure 4. The lid is not required
for processive transcript elongation. (a) The sequences of RNA/
DNA oligonucleotides used for TEC
reconstitutions. Complementary
DNA oligonucleotides: TS1/NS1
(template DNA strand oligo TS1,
non-template DNA strand oligo
NS1, respectively); TS2/NS2; TS3/
NS3. RNA sequences are italicized.
Sequences of RNA primers are
shown in capital letters. Sequences
encoding the stems of the pause and
terminator hairpins are indicated
with arrows. (b) Δlid TEC elongates
normally. Electrophoretic separation
of RNAs formed by wild-type or
Δlid RNAPs on the synthetic template encoding the his pause signal.
TECs were assembled using complementary DNA oligos TS1/NS1
and RNA14. After incubation at 37
°C with 2.5 μM each ATP and GTP
and 1 μM [α-32P]CTP for 10 min to
form TEC24, NTPs were adjusted to
10 μM GTP, 150 μM each ATP, UTP,
and CTP. Samples were removed at
15, 30, 45, 60, 120, 240, 360 and 600 s
after addition of all four NTPs,
denatured at 95 °C for 2 min after
addition of urea to 4 M, and
separated in a 8% polyacrylyamide
gel containing 8 M urea. Pause halflives were calculated as described.26
Positions of paused (P) and run-off
(RO) transcripts are indicated.
Such instability of TECs formed by mutant RNAP
can be explained by the loss of RNA−lid interactions
that contribute to overall TEC stability. Alternatively
or in addition, the lid removal could result in an
increased propensity of the non-template strand to
re-anneal with template DNA strand at the
upstream edge of the transcription bubble, and as
result, to destabilize TEC. To evaluate the contribution of RNA−lid interactions to elongation complex
stability we compared the stability of wild-type and
Δlid TECs formed in the absence of the nontemplate strand (Figure 5(a)). Indeed, we found
that in the absence of the non-template DNA strand,
Δlid TECs were less stable than TECs formed by
wild-type RNAP (Figure 5(a)). This supports the
idea that the lid−RNA interactions contribute to the
elongation complex stability.
Low stability of Δlid TECs suggests that the lid
removal could have a significant effect during
transcription termination. To analyze this, we
assembled elongation complexes with 14mer RNA
and DNA oligos TS2/NS2 that encoded the well-
characterized λtR2 terminator (Figure 4(a)). TEC22x
(Figure 4(a)) was generated by extension of the
14mer RNA to position C22 in presence of ATP, GTP,
and radioactive [α-32P]CTP. Subsequent elongation
of wild-type TEC22x through the tR2 terminator
(Figure 5(b), lane 2) gave the same termination
efficiency as observed in the promoter-initiated
TECs. 25, 26 Δlid RNAP elongated similarly to wildtype RNAP, and gave a nearly identical termination
efficiency (Figure 5(b), lane 6). We also tested
conditions that increase termination efficiency:
0.5 M NaCl or reduced (10 μM) NTP concentrations.26 Remarkably, termination efficiencies for
wild-type and the lid deletion RNAPs were similar
at all conditions tested (Figure 5(b), lanes 3, 4, 7, 8).
In agreement with the above results (Figure 5(a)),
we observed that the smaller fraction of Δlid
TEC22x was able to extend relative to wild-type
RNAP during transcription at high salt conditions
(Figure 5(b)). Additionally, Δlid RNAP produced
shorter run-off transcripts at high-salt (Figure 5(b),
lane 7). These shorter run-off transcripts could
650
Role of Lid Element in Transcription by RNAP
Figure 5. Deletion of the lid
does not affect intrinsic termination and RNA separation from
DNA but affects elongation complex stability. (a) TECs formed by
the lid-less RNAP are unstable at
high salt conditions. TEC stability
was assayed by determining the
fraction of the transcriptionally
active EC resistant to incubation
with 0.5 M NaCl. TEC15 was generated by extension of RNA14 on
scaffold template TS1/NS1 (Figure
4(a)) in the presence of 5 μM GTP
and 0.1 μM [α-32 P]GTP. Halted
TECs were challenged at high salt
(0.5 M NaCl) for increasing times
and then incubated with 200 μM of
ATP, GTP and CTP to determine the
fraction of active TECs remaining.
Ratios of extended and initial G15
RNAs were quantified to determine
the fraction of remaining active
TECs. Extension of TEC15 at low
salt (20 mM NaCl, time 0) was
assigned as 100%, and extension of
TEC15 at high salt was normalized
to extension of TEC15 at low salt.
(left) Amount of active TECs remaining as a function of time.
(right) The bars demonstrate relative
TEC stabilities for wild-type and
Δlid RNAPs in the presence or
absence of the non-template DNA
strand (+NT and −NT, respectively). TEC stability for wild-type RNAP on scaffold with the non-template DNA strand
(+NT) was assigned as 1. (b) Electrophoretic separation of RNAs formed on the λtR2 terminator template. Halted TEC22x
elongation complexes were formed by wild-type and mutant RNAPs during extension of 14mer RNA on scaffold template
TS2/NS2 (Figure 4(a)) in the presence of 5 μM ATP, GTP, CTP and 0.1 μM [α-32P]CTP in transcription buffer (20 mM TrisHCl (pH 8.0), 20 mM NaCl, 10 mM MgCl2, 10 mM β-mercaptoethanol). TEC22x were chased at different conditions (A:
200 μM of four NTPs, 20 mM NaCl; B: 200 μM of four NTPs, 500 mM NaCl; C: 5 μM of four NTPs, 20 mM NaCl) to test
readthrough of the λtR2 terminator. Positions of terminated (T) and run-off (RO and RO′) transcripts are indicated. (c) Δlid
RNAP does not form extended RNA:DNA hybrid when the non-template DNA strand is present. Transcripts in Δlid TECs
are resistant to RNase H. Ribonucleases T1 and H probing of TEC22y formed on double-stranded DNA template TS3/NS3.
TEC22y was generated by extension of 8mer RNA in the presence of 5 μM ATP, GTP, CTP.
reflect premature TEC dissociation resulting from
the combined destabilization of Δlid TEC that
would occur as RNAP approaches the end of the
DNA template and loses downstream DNA contacts known to be required for TEC-resistance to
high salt.27,28
Although transcription elongation by Δlid RNAP
was more salt-sensitive, however, our data
strongly suggested that the lid is not required for
processive transcript elongation, pausing, and
intrinsic termination.
Effect of the lid deletion on RNA displacement
The position of the lid at the upstream end of
RNA:DNA hybrid suggests that the lid could play
an essential role in separation of RNA from DNA.
Thus, removal of the lid could result in formation of
an extended RNA-DNA hybrid. This would also
explain why the mutant TECs are less stable, since it
has been shown that overextension of the RNADNA hybrid destabilizes the TEC.29–31
To test whether the lid deletion affects formation
of extended RNA:DNA hybrids, we probed halted
TECs with RNase H and RNase T1. Properly
displaced RNAs should be sensitive to RNase T1,
which cleaves single-strand RNA after guanine
residues, and resistant to RNase H, which cleaves
RNA:DNA hybrids. However, if RNA forms an
extended hybrid, it should be sensitive to RNase H.
The 14mer RNA used as primer in the reconstitution experiments described above was not suitable
for these experiments because the first 3 nt at the 5′end of this RNA were non-complementary to DNA
template strand. These non-complementary RNA nt
could force separation of RNA from DNA in TECs
and mask effects of the lid deletion. Therefore, we
used 8 nt RNA as primer and DNA oligonucleotides TS3/NS3 (Figure 4(a)) to assemble TEC.
Extension of the 8mer RNA in the presence of a
Role of Lid Element in Transcription by RNAP
651
limited set of NTPs (ATP, GTP, and CTP) on TS3/
NS3 template allowed the formation of TEC22y
(Figure 4(a)). RNA in the TEC22y contained
guanine residues at positions 12 and 14 nt upstream
of the RNA 3′end (Figure 4(a)) that were useful for
RNase T1 probing experiments. We found that
RNAs from the halted TECs formed by either wildtype or the lid deletion enzymes were completely
resistant to RNase H, but sensitive to RNase T1, as
evidenced by the appearance of RNase T1 degradation products (Figure 5(c)). Based on these results
we concluded that deletion of the lid does not
prevent normal RNA displacement during transcript elongation by reconstituted TECs formed on
a double-stranded template.
Removal of the lid element stimulates
transcription on single-stranded DNA templates
Studies of the phage T7 RNAP have demonstrated that absence of the non-template (NT)
strand allows formation of extended RNA-DNA
hybrids that inhibit transcription.29,31 Thus, we
next tested transcription by wild-type and Δlid
RNAPs in the absence of the NT strand. TECs were
assembled with 8mer RNA and TS1 oligo (TEC18w;
Figure 4(a)). The transcript was labeled at the 5′-end
of 8mer RNA. We found that both wild-type and
the mutant RNAPs were able to extend RNA8
to C18 position on single-stranded template TS1
(Figure 6(a)). However, a significantly smaller fraction
of transcript was extended beyond C18 position by
wild-type RNAP. As can be seen from Figure 6(a),
most RNAs produced by wild type RNAP were in the
range 22−30 nucleotides, while the Δlid RNAP
formed longer products and transcribed more efficiently to the end of template TS1 (Figure 6(a)).
In principle, the inability to extend RNA by wildtype RNAP could be explained by extensive backtracking on single-stranded template.30 However,
TECs formed by both wild-type RNAP and Δlid
RNAPs were resistant to GreB treatment, which
should stimulate hydrolytic cleavage of backtracked
RNAs (data not shown). To investigate further, we
formed TEC22y on template TS3 with 8mer primer
RNA, and without a non-template DNA strand
(Figure 4(a)) (TEC18w was suboptimal for RNase
probing experiments because it contains only one
guanine residue near its 5′-end in the transcript
region susceptible for RNase T1 cleavage). The
transcripts were labeled by incorporation of a
radioactive NMP during synthesis of the 22mer
transcript. Both TECs formed by wild-type and
mutant RNAPs were treated with RNase T1 and
RNase H to probe the structure of the 5′-terminal
part of 3′-labeled transcripts (Figure 6(b)). TEC22y
formed by both enzymes were fully resistant to
RNase T1, but sensitive to RNase H (Figure 6(b)).
The susceptibility of the 5′-segment of the transcript to RNase H indicates that an extended RNA:
DNA hybrid formed during transcription on
single-stranded template. This extended RNA:
DNA hybrid is still present in the TEC because
Figure 6. Sensitivity of wild-type and Δlid TECs to
RNase T1 and RNase H on single- and double-stranded
templates. (a) Δlid RNAP elongates efficiently on singlestranded template. TECs were assembled on TS3
(Figure 4(a)) with 5′-end labeled 8mer RNA and chased
in the presence of NTPs. Gel panel shows electrophoretic
separation of RNAs formed during extension of RNA8 by
wild-type and Δlid RNAP on single-stranded template. (b)
Formation of an extended RNA-DNA hybrid during
transcription on single-stranded template. Ribonucleases
T1 and H probing of TEC22y formed on single-stranded
DNA template TS3. TEC22y was formed by extension of
8mer RNA in the presence of 5 μM ATP, GTP, CTP. (c)
KMnO4 probing of TEC22y formed on single and doublestranded templates. Sequence of TS3 DNA template strand
is shown at the bottom. In the –RNAP lane, RNA8 was
annealed with TS3 DNA oligo and treated with KMnO4 in
the absence of RNAP.
RNA transcripts were chased upon addition of NTPs
(Figure 6(b)).
An important question is whether the extended
hybrid is actually an uninterrupted, persistent
hybrid. It is possible that RNA is properly displaced
652
at the upstream edge of the RNA-DNA hybrid
through the RNA exit tunnel23 but subsequently reanneals to DNA after emerging from the tunnel. To
determine the extent of the RNA-DNA hybridization, we formed the TEC22y on template TS3
without the non-template DNA strand and performed KMnO4 footprinting of the thymidine
residues in the template DNA strand, which has
several thymidine residues in the critical region
(Figure 6(c)). We found that thymidine residues
were protected from KMnO4 modification, establishing that the RNA formed a continuous extended
hybrid with template DNA. In contrast, three
thymidine residues at positions −9, −10, and −11
from the RNA 3′end were sensitive to modification
by KMnO4 in complexes formed by wild-type and
Δlid RNAPs when the DNA non-template strand
was present (compare lanes + or – NT, Figure 6(c)).
The sensitivity of residues −9, −10, −11 to modification confirms that RNA is properly displaced by
Δlid RNAP during transcription on double-stranded templates. Together these results strongly suggest that formation of the persistent hybrid inhibits
transcription on single-stranded template by wildtype RNAP due to a clash with lid element.
Discussion
Based on our results, we can draw several
conclusions about the role of RNAPs lid element in
transcription. First, the lid is important for RNAP
function during transcription initiation. Deletion of
the lid element impairs initiation both at –35
dependent and –35-independent promoters. Second,
although the lid contributes to TEC stability,
transcription elongation and termination can occur
normally in the absence of the lid element. Third, the
lid element is not required for displacement of RNA
from the DNA template strand during transcription
on double-stranded DNA templates. However, in
the absence of the non-template strand, the lid
element inhibits transcription, whereas RNAP lacking the lid element efficiently transcribes singlestranded DNA templates and produces persistent
RNA:DNA hybrids.
The lid element is important for transcription
initiation
Our results demonstrate that the lid plays an
important role during transcription initiation. We
found that deletion of the lid impairs initiation from
–35-dependent and –35-independent promoters.
Analysis of different promoters suggests that the
removal of the lid element affects the formation and
lifetime of the open complex, although its effect on
transcription is dependent on promoter context.
How could the lid affect open complex formation?
In the TEC structure, the lid appears to contact the
template DNA base at position –10 or –11. 5
Although we lack a high-resolution structure of
RNAP−promoter open complex, it seems likely that
Role of Lid Element in Transcription by RNAP
the lid element could similarly interact with nucleotides of the template strand DNA in open promoter
complex during initiation. These contacts may be
especially important for stabilizing the template
strand in open promoter complex. Moreover, in
RNAP holoenzyme, the lid contacts both σ region 3
and σ region 3.2 (the σ R3-4 linker).2,4,22 According
to the structural models of the open complex,32,33 σ
region 3 forms part of a channel that guides the path
of the template strand in the transcription bubble.
Thus, either directly through DNA contacts or
indirectly by changing the position of σ region 3 or
region 3.2, the lid deletion could interfere with
proper positioning of the template DNA strand in
the active-site channel, which is required for formation of stable open complex. In addition, the loss of
lid−sigma region 3 interactions could affect formation of the intermediates preceding open complex.
Although it is possible that the lid deletion could
affect the position of σ region 3.2 and therefore affect
binding of the first NTP, as proposed by Murakami et
al.,4 we think it is unlikely that inability of the lid
deletion RNAP to transcribe from T7A1 and galP1con promoters can be explained only by a high Km for
initiating NTP. Even high concentrations of NTPs
(1 mM) did not increase RNA synthesis by Δlid
RNAP from T7 A1 promoter DNA (data not shown).
In addition, recent studies demonstrated that RNAP
reconstituted from σ70 mutant lacking the region 3.2
transcribes well from T7 A1 promoter.34
Although the lid is important for transcription
initiation, our results also reveal that it is not
essential. The effect of the deletion can be partially
overcome by a consensus promoter including an UP
element. This suggests that strong interaction of αC-terminal domain (CTD) of RNAP with UP
element provides significant stabilization to allow
open complex formation and transcription initiation
in the absence of the lid element. It is well known
that UP elements can increase promoter activity
dramatically.18,20 Results from kinetic studies indicate that both initial closed-complex formation and
subsequent isomerization step can be affected by UP
element.19,35,36 Although the molecular basis for this
effect of the UP element is not yet understood, it is
likely that the isomerization step involves conformational changes that occur far downstream of the
DNA regions directly contacted by α-CTD. Recent
real-time footprinting studies of promoter binding
by E. coli RNAP revealed that in initial intermediates, RNAP interacts primarily with the upstream
region of promoter (base-pairs −60 to −30 relative
to the start site of transcription).37 In subsequent
intermediates, contacts of RNAP with promoter
extend to the region near the transcription start
site. It has been proposed that upstream DNA
wraps around E. coli RNAP during initiation and
induces a bend in the promoter. Thus, these wrapping interactions between upstream DNA and
RNAP likely contribute to melting and stabilization
of an unwound region in the promoter,19,35 and
may overcome the loss of lid function in Δlid
RNAP.
Role of Lid Element in Transcription by RNAP
653
Role of the lid element in transcription
elongation and termination
zipper, rudder and ZBD in addition to the lid. Whether these protein elements play a topological role, or
if their strong interaction with nucleic acids strands
assists RNA-DNA separation, is unclear. In addition,
other factors like the strength of DNA:DNA interaction at the upstream edge of the transcription bubble
may also influence separation of RNA from DNA.
We found that continuous extended RNA:DNA
hybrids form during transcription on singlestranded templates by Δlid RNAP. Significantly,
our results suggest a regulatory role of the lid during
transcription on single-stranded template. Although
wild-type RNAP was unable to transcribe efficiently
beyond of 22−28 nt RNA, RNAP lacking the lid
element efficiently transcribed single-stranded DNA
templates. Production of short transcripts and low
processivity by wild-type RNAP on single-stranded
template is consistent with previous studies.41,42
Other studies have shown that E. coli RNAP terminates prematurely at conditions that allow persistent RNA:DNA hybrid formation.43,44
Formation of a persistent, extended RNA:DNA
hybrid is in apparent conflict with the path of exiting
RNA through the pore under the flap domain that
only allows passage of a single strand.23,45 Importantly, analysis of the structural models of the TEC
indicates that production of RNA:DNA hybrid
longer than 8−9 bp will create steric clash with the
lid5,38 (Figure 7(a)). This suggests that formation of
an extended RNA:DNA hybrid may require significant rearrangements in the TEC structure to
accommodate long hybrid in the main channel.
Modeling of a continuous A-form helix into a TEC
suggests that the continuous RNA-DNA hybrid
could be accommodated if the clamp domain were
to rotate away from the flap domain. Alternate,
“open” positions of the clamp have been observed
both in bacterial core RNAPs45,46 and in yeast
RNAPII lacking subunits 4 and 7.1 We found that
repositioning the clamp domain in a conformation
that matched the yeast RNAPII structure removed all
clash with the extended hybrid except by the lid element (Figure 7(b) and (c); see Materials and Methods). Thus, it appears that a documented conformation of the clamp domain may allow persistent
RNA:DNA hybrid formation in Δlid RNAP. Although this requires a slight repositioning of the
RNA:DNA hybrid in the main channel of RNAP
(Figure 7(d)), this change does not generate significant steric clash because the helical conformation of
the A-form helix differs from the conformation
observed in TECs3 and directs the hybrid away
from clash with the flap (wall) domain. Such a slight
repositioning of the hybrid in the main channel is
plausible given the recent observation of an ∼4 Å
shift in the hybrid position in yeast RNAPII TECs
bound by TFIIS.38
The repositioned hybrid and opening of the clamp
domain could affect TEC stability and nucleotide
addition. Indeed, it is known that extended RNA:
DNA hybrid destabilizes TECs.29–31 We hypothesize
that accommodation of the longer RNA:DNA
hybrid in TEC may increase the clash of the hybrid
We found that transcription elongation can occur
normally in the absence of the lid element, but that
the lid contributes to the TEC stability at high salt.
The stabilizing effect of the lid is consistent with
structural and biochemical studies. In the TEC
structure of yeast RNAPII, the single-stranded
RNA exits beneath the lid, and the lid interacts
with residues –8, –9, and –10 of the RNA.3,5,38 In the
models of E.coli RNAP elongation complexes based
on crosslinking data, the lid is near the −10 and –11
RNA nucleotides.23,24 Additionally, biochemical
results imply that protein–RNA interactions within
the −8 to −10 region of RNA contribute to a salt
sensitivity of TECs.39 Thus, our results are consistent
with a role of the lid holding RNA in RNAPs RNAexit channel.3 However, under physiological conditions, the lid is not essential for TEC stability. If the
lid−RNA contacts were critical to TEC stability, then
their loss should increase termination efficiency,
whereas we found that removal of the lid element
does not affect intrinsic termination. Two mechanisms of intrinsic termination have been proposed:
hairpin invasion and RNA pullout.26,40 If termination occurs by the “hairpin invasion” mechanism in
which the hairpin stem propagates into the main
channel, altering its conformation and causing RNA
release, the stabilizing contacts disrupted by the
hairpin stem must involve parts of RNAP other than
the lid, since deletion of the lid had no effect on
termination. It is possible that these functions are
provided by the rudder, zipper, or zinc-binding
domain (ZBD) elements, which may maintain the
closed conformation of the RNA exit channel even
when the lid element is deleted. Alternatively, in the
pullout model terminator hairpin action, termination must not require interaction of the terminator
hairpin with the lid to extract the RNA from RNAP.
This is consistent with our observation that the lid
also is not required for a pause hairpin to enhance
transcriptional pausing (Figure 4(b)), even though
the pause hairpin is positioned adjacent to the lid.24
Thus, our data suggest that the lid is not essential for
transcriptional termination.
RNA displacement and role of the lid element in
transcription on single-stranded templates
One of the fundamental questions in transcription
is how RNAP maintains the correct length of RNA:
DNA hybrid and separates RNA from DNA.
Structural studies suggest that the lid could play a
main role in RNA-DNA strand separation.3,5,38 However, our results reveal that the lid is not required for
RNA displacement when the non-template DNA
strand is present. Although our data underscore the
importance of the non-template strand in separation
of RNA from DNA, the actual mechanism of RNA
displacement may be complex and probably includes
a concerted action of the non-template strand and
structural elements of RNAP, which could include the
654
Role of Lid Element in Transcription by RNAP
Figure 7. Model of persistent RNA:DNA hybrid formation on single-stranded template DNA. (a) A canonical A-form
RNA:DNA hybrid (red and black) positioned in the RNAP model is based on the location of the clamp domain observed
in an S. cerevisiae RNAPII TEC.3 Hybrid clashes with the lid and the clamp domain. Arrows depict movement of the clamp
domain observed in T. aquaticus core RNAP45 and S. cerevisiae RNAPII.1 (b) Position of the clamp domain observed in S.
cerevisiae RNAPII1 does not clash with the extended RNA:DNA hybrid except for the lid element. (c) View of extended
RNA:DNA hybrid looking into the RNA exit channel reveals no clash with the flap domain. (d) Comparison of the
extended RNA:DNA hybrid (red and black) with the location of the RNA:DNA hybrid observed in a TEC with a
conventional 9 bp RNA:DNA hybrid (pink and gray).
with the lid element. Several alternative ways to
relieve such a clash that are consistent with an
inhibitory role of extended RNA:DNA hybrids on
transcription can be proposed. RNAP may slide
either forward or backward along the template: such
sliding will result in disengagement of the RNA 3′
end from the active site. Interestingly, relocation of
the hybrid into the downstream DNA channel has
been proposed recently to occur during RNAPcatalyzed synthesis of primers for M13 phage
replication.47 Alternatively, even a slight shift of
the 3′-proximal part of the RNA:DNA hybrid away
from the catalytic residues in the active site could
block the nucleotide addition. Different factors, like
the RNA:DNA hybrid strength at its upstream or 3′proximal part, or sequences of the downstream
DNA, could determine the eventual pathway.
Materials and Methods
Construction and purification of the lid deletion RNAP
To construct β′Δ(251-264)ΩGly3, site-directed PCR
mutagenesis was performed on the plasmid pIT137
using oligonucleotides 5025 and 5026 that flanked the
deleted fragment (Table 1). The shortened fragment
located between the unique SbfI and BsmI sites was
sequenced, excised, and recloned into SbfI, BsmI-cut
pIA4237 to obtain overexpression plasmid encoding
β′Δ(251-264)ΩGly3. Wild-type and mutant RNAPs were
purified by chitin-affinity chromatography and inteinmediated removal of the chitin-binding domain tag after
overexpression from a T7 RNAP based expression
plasmid, as described.7 RNAP holoenzymes (core β′βα2
plus σ70) were prepared by incubating a tenfold molar
excess of σ70 with core enzyme for 30 min at 37 °C in
binding buffer (20 mM Tris-HCl (pH 8.0), 100 mM NaCl,
10 mM MgCl2, 5 mM β-mercaptoethanol).
DNA templates
Linear templates for in vitro transcription were generated by PCR amplification from plasmid DNA (plasmids,
PCR primers, and templates are listed in Table 1) and
purified using QIAspin PCR purification reagents (Qiagen, Valencia, CA).
Electrophoretic mobility shift assay
RNAP (40 or 80 nM) and 32P-labeled linear DNA
template (UP-fullcon; 10 nM) were incubated ∼15 min at
37 °C in transcription buffer (20 mM Tris-HCl (pH 8.0),
20 mM NaCl, 10 mM MgCl2, 10 mM β-mercaptoethanol).
To assay for formation of stable complexes, the reactions
were challenged with 100 μg/ml of heparin and incubated
for an additional 10 min. For loading, 2 μl of dye solution
(20% (v/v) glycerol, 0.1% (w/v) bromophenol blue) was
added to each reaction, and samples (9 μl) were applied to
Description
Source or note
Plasmids
pIA423
pIT138
pIA171
pRLG770 UP fullcon
pRLG770
Expresses α+ β +β′-CBP/intein from T7 promoter
Deletion of β′aa 251-264 in pIA423
T7 A1 promoter–A29–transcription template plasmid
Full consensus promoter with strong UP element derived from pRLG3749 (fullcon promoter)
Full consensus promoter
7
This work
9
17
16
Oligonucleotides
5025
5026
947
3996
645
4371
4372
5027 (NS1)
5028 (TS1)
5029 (NS2)
5030 (TS2)
5031 (NS3)
5032 (TS3)
5041 (NS4)
4891 (TS4)
5033 (RNA14)
5034 (RNA8)
4881 (RNA9)
5′-GTACTGCCGCCAGATCTGCGTGGAGGAGGACTGAACGATCTGTATCGTCG
5′-CGACGATACAGATCGTTCAGTCCTCCTCCACGCAGATCTGGCGGCAGTAC
5′-GGAGAGACAACTTAAAGAG
5′-CACTAATTTATTCCATGTCACACTTTTCGCATCTTTTTTATGCTATAATTATTTCATCGAGAGGGACACGGGG
5′-CAGTTCCCTACTCTCGCATG
5′-CCGCGGATCGTATCACGAGGCCCTTTCG
5′-GCGCTACGGCGTTTCACTTCTGAGTTC
5′-CTATAGGATACTTACAGCCATCGAGAAACACCTGACTAGTCTTTCAGGCGATGTGTGCTGGAAGACATTCAGATCTTCC
5′-GGAAGATCTGAATGTCTTCCAGCACACATCGCCTGAAAGACTAGTCAGGTGTTTCTCGATGGCTGTAAGTATCCTATAG
5′-CTATAGGATACTTACAGCCATCAACAGGCCTGCTGCTAATCGCAGGCCTTTTTATTTGGGGGAGAGGGAAGTCATG
5′-CATGACTTCCCTCTCCCCCAAATAAAAAGGCCTGCGATTAGCAGCAGGCCTGTTGATGGCTGTAAGTATCCTATAG
5′-CTATAGGATACTTACAGCCATCGAGAAACACCAGACTAGTCTTTCTGGCGATG
5′-CATCGCCAGAAAGACTAGTCTGGTGTTTCTCGATGGCTGTAAGTATCCTATAG
5′-GGTCAGTACGTCCTAATGTGTGCTGGAAGAGATTCAGAG
5′-CTCTGAATCTCTTCCAGCACACATTAGGACGTACTGACC
5′-UUUUUACAGCCAUC
5′-CAGCCAUC
5′-AUGUGUGCU
β′Δ(251-264)ΩGly3 top
β′Δ(251-264)ΩGly3 bottom
T7A1 upstream
galP1con upstream
T7A1 and galP1con downstream
UP-full consensus upstream
UP-full consensus downstream
Top strand, the his pause signal, 24
Bottom strand (his pause signal)
Top strand (C22; λtR2 terminator)
Bottom strand (C22; λtR2 terminator)
Top strand (C28)
Bottom strand (C28)
Top strand (Figure 2(b))
Bottom strand (Figure 2(b))
24
Transcription templates
T7A1
galP1con
UP fullcon
Fullcon
PCR
PCR
PCR
PCR
of pIA171 with 947 and 645
of pIA251 with 3996 and 645
of pRLG770-UP fullcon with 4371 and 4372
of pRLG770 with 4371 and 4372
Role of Lid Element in Transcription by RNAP
Table 1. Plasmids, oligonucleotides, and transcription templates
9
655
656
a running 4% (w/v) native gel poured and run in 0.5× TBE
buffer (20 mM Tris-borate (pH 8.3), 1 mM EDTA). The gels
were run at low voltage (90–100 V) for 1 h.
Role of Lid Element in Transcription by RNAP
single-stranded template, reconstitutions were done without addition of the DNA non-template strand. Sequences
of oligonucleotides for reconstitution are shown in Figure
4(a) and in Table 1.
Determination of lifetimes of open complex
Probing of nascent RNA structure with RNase T1,
RNaseH and KMnO4
Lifetimes of open complexes were measured on linear
DNA template (UP-fullcon) using a single-round transcription assay.15 RNAP and template DNA were incubated
∼15 min at 37 °C in transcription buffer (20 mM Tris-HCl
(pH 8.0), 20 mM NaCl, 10 mM MgCl2, 10 mM βmercaptoethanol). At various times after heparin addition
(200 μg/ml final concentration) aliquots (10 μl) were
removed to a tube containing 1.5 μl of NTPs to yield final
concentrations of 200 μM ATP, 200 μM GTP, 200 μM CTP,
20 μM UTP and 1 μCi [α-32P]UTP (3000 Ci/mmol).
Transcription was stopped after 10 min by addition of an
equal volume of STOP buffer (10 M urea, 20 mM EDTA,
45 mM Tris borate, pH 8.3). For the zero time point, an
aliquot was taken prior to heparin addition and incubated
with NTPs. RNA samples were analyzed by denaturing gel
electrophoresis as described below.
The half-lives of open complexes were estimated by
linear regression of the amount of transcript produced as a
function of the time elapsed between the heparin addition
and NTP addition to preformed open complexes.
Samples (20 μl) of 32P-labeled TECs were incubated at
25 °C with RNase T1 (100 units/ml) or RNase H (10 units/
ml; Boehringer Mannheim) for 15 min. The reactions were
terminated by addition of an equal volume of phenol:
chloroform (1:1). The aqueous samples were recovered,
combined with an equal volume of stop buffer, and
electrophoresed through a denaturing 15% polyacrylamide gel.
For permanganate probing, TEC8 were reconstituted on
TS3 DNA oligo 32P-labeled at the 5′-end with or without
the non-template strand and extended in the presence of
ATP, GTP, CTP to produce TEC22y. TEC22y were treated
with 1 mM KMnO4 for 1 min at room temperature.
Reactions were terminated by the addition of β-mercaptoethanol to 300 mM, followed by phenol-extraction,
ethanol-precipitation, and 20 min treatment with 10%
piperidine at 95 °C. Reaction products were analyzed
using 12% polyacrylamide urea gels.
In vitro transcription
Molecular modeling
Transcription initiation reactions contained, in 20 μl of
transcription buffer (20 mM Tris-HCI (pH 7.9), 10 mM
MgCl2, 20 mM NaCl and 10 mM β-mercaptoethanol),
40 nM of promoter fragments and 50 nM of RNAP
holoenzyme. For transcription on T7 A1 and galP1con
promoters, reactions were incubated for 10 min at 37 °C,
followed by the addition of initiating dinucleotide ApU
(0.1 mM final), ATP, GTP and CTP to 20 μM final, and
1 μCi of [α-32P]CTP (3000 Ci/mmol). Incubation was then
continued for 15 to 25 min at 37 °C. Samples (5 μl) were
removed at times indicated in the legend to Figure 2 and
were quenched by the addition of STOP buffer. In separate
experiments, transcription reactions on T7A1 promoter
template were initiated upon addition of all four NTPs
(1 mM final). For the full consensus and full consensus
with UP element promoters, transcription reactions were
initiated by addition of all four NTPs (200 μM ATP, 200 μM
GTP, 200 μM CTP, 200 μM UTP and 3 μCi [α-32P] UTP
(3000 Ci/mmol). Transcription was stopped after 15 or
25 min by addition of an equal volume of STOP buffer.
Reaction products were resolved by electrophoresis in
denaturing (8 M urea) 20% (19:1) polyacrylamide gel,
visualized by autoradiography, and quantified using the
Molecular Dynamics PhosphorImager.
The structural model for core RNAP (Figure 1(a)) was
derived from the coordinates of the T. thermophilis
holoenzyme crystal structure2 and the positions of
RNAP domains observed in a S. cerevisiae RNAPII TEC
crystal structure,3 as described.26 The location of sigma, in
particular the position of the sigma region 3-4 linker in the
RNA exit channel (Figure 1(c)) is based on the T.
thermophilis holoenzyme crystal structure. The location of
the RNA transcript in the RNA exit channel (Figure 1(d))
was modeled based on crosslinking data obtained with E.
coli RNAP.23 The coordinates of the A-form RNA:DNA
hybrid (Figure 7(a)) were generated using the program
NAMOT 2.1†.48 The persistent hybrid was positioned in
the model of the bacterial TEC (Figure 7) by superposing
the RNA 3′ O atom of the persistent hybrid on the position
of the RNA 3′ O atom in the TEC model26 and then
moving the hybrid to the position of minimal steric clash
while maintaining superposition of the RNA 3′ O atoms.
The open position of the clamp domain that could
accommodate a persistent hybrid (Figure 7(b)) was
modeled by repositioning the clamp domain in the TEC
model to align with the clamp domain observed in the S.
cerevisiae ten subunit RNAPII crystal structure1 (PDB
coordinates 1I50). All molecular models (Figures 1 and 7)
were created using PyMOL (DeLano Scientific LLC, San
Carlos, CA‡).
TEC reconstitution
Wild-type and mutant TECs were assembled using
complementary oligos as described.14,24 Briefly, 100 nM
template strand DNA oligo and RNA were mixed in
20 mM Tris-HCl (pH 7.9), 20 mM NaCl, 0.1 mM EDTA,
incubated for 2 min at 75 °C, and cooled to room
temperature in 1 deg.C/min decrements, and then
incubated with 150 nM wild-type or mutant RNAP in
the same buffer plus 5% glycerol, 10 mM MgCl2, 0.1 mM
DTT, 25 μg/ml BSA for 10 min at 22 °C. After incubation at
37 °C with non-template DNA oligo (250 nM) for 10 min,
NTPs were added to assembled TEC. For transcription on
Acknowledgements
We thank T. Gaal for the gift of plasmid samples
(pRLG770 and pRLG770 UP fullcon) and for advice
† http://www.t10.lanl.gov/namot/
‡ http://www.delanoscientific.com
657
Role of Lid Element in Transcription by RNAP
with open complex stability experiments; and K.
Severinov for communicating information prior to
publication. This work was supported by a grant
from the NIH (GM38660) to R.L.
16.
References
17.
1. Cramer, P., Bushnell, D. & Kornberg, R. (2001).
Structural basis of transcription: RNA polymerase II
at 2.8 Å resolution. Science, 292, 1863–1876.
2. Vassylyev, D. G., Sekine, S., Laptenko, O., Lee, J.,
Vassylyeva, M. N., Borukhov, S. & Yokoyama, S.
(2002). Crystal structure of a bacterial RNA polymerase holoenzyme at 2.6 A resolution. Nature, 417,
712–719.
3. Gnatt, A., Cramer, P., Fu, J., Bushnell, D. & Kornberg,
R. D. (2001). Structural basis of transcription: an RNA
polymerase II elongation complex at 3.3 Å resolution.
Science, 292, 1876–1882.
4. Murakami, K. S., Masuda, S. & Darst, S. (2002).
Structural basis of transcription initiation: RNA
polymerase holoenzyme at 4 Å resolution. Science,
296, 1280–1284.
5. Westover, K. D., Bushnell, D. A. & Kornberg, R. D.
(2004). Structural basis of transcription: separation of
RNA from DNA by RNA polymerase II. Science, 303,
1014–1016.
6. Arthur, T. M. & Burgess, R. R. (1998). Localization of a
sigma70 binding site on the N terminus of the
Escherichia coli RNA polymerase beta′ subunit. J. Biol.
Chem. 273, 31381–31387.
7. Artsimovitch, I., Svetlov, V., Murakami, K. & Landick,
R. (2003). Co-overexpression of E. coli RNA polymerase subunits allows isolation and analysis of mutant
enzymes lacking lineage-specific sequence insertions.
J. Biol. Chem. 278, 12344–12355.
8. Kuznedelov, K., Minakhin, L., Niedziela-Majka, A.,
Dove, S. L., Rogulja, D., Nickels, B. E. et al. (2002). A
role for interaction of the RNA polymerase flap
domain with the sigma subunit in promoter recognition. Science, 295, 855–857.
9. Geszvain, K., Gruber, T. M., Mooney, R. A., Gross, C. A.
& Landick, R. (2004). A hydrophobic patch on the flaptip helix of E. coli RNA polymerase mediates sigma
(70) region 4 function. J. Mol. Biol. 343, 569–587.
10. Kumar, A., Grimes, B., Fujita, N., Makino, K., Malloch,
R. A., Hayward, R. S. & Ishihama, A. (1994). Role of
the sigma 70 subunit of Escherichia coli RNA polymerase in transcription activation. J. Mol. Biol. 235,
405–413.
11. Daube, S. S., Hart, C. R. & von Hippel, P. H. (1994).
Coupling of RNA displacement and intrinsic termination in transcription from synthetic RNA.DNA bubble
duplex constructs. Proc. Natl Acad. Sci. USA, 91,
9539–9543.
12. Daube, S. S. & von Hippel, P. H. (1992). Functional
transcription elongation complexes from synthetic
RNA-DNA bubble duplexes. Science, 258, 1320–1324.
13. Daube, S. S. & von Hippel, P. H. (1999). Interactions of
Escherichia coli sigma(70) within the transcription
elongation complex. Proc. Natl Acad. Sci. USA, 96,
8390–8395.
14. Sidorenkov, I., Komissarova, N. & Kashlev, M. (1998).
Crucial role of the RNA:DNA hybrid in the processivity of transcription. Mol. Cell. 2, 55–64.
15. Barker, M. M., Gaal, T., Josaitis, C. A. & Gourse, R. L.
(2001). Mechanism of regulation of transcription
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
initiation by ppGpp. I. Effects of ppGpp on transcription initiation in vivo and in vitro. J. Mol. Biol. 305,
673–688.
Gaal, T., Ross, W., Estrem, S. T., Nguyen, L. H.,
Burgess, R. R. & Gourse, R. L. (2001). Promoter
recognition and discrimination by EsigmaS RNA
polymerase. Mol. Microbiol. 42, 939–954.
Mooney, R. A. & Landick, R. (2003). Tethering
sigma70 to RNA polymerase reveals high in vivo
activity of sigma factors and sigma70-dependent
pausing at promoter-distal locations. Genes Dev. 17,
2839–2851.
Estrem, S. T., Gaal, T., Ross, W. & Gourse, R. L. (1998).
Identification of an UP element consensus sequence
for bacterial promoters. Proc. Natl Acad. Sci. USA, 95,
9761–9766.
Ross, W. & Gourse, R. L. (2005). Sequence-independent upstream DNA-alphaCTD interactions strongly
stimulate Escherichia coli RNA polymerase-lacUV5
promoter association. Proc. Natl Acad. Sci. USA, 102,
291–296.
Ross, W., Gosink, K., Salomon, J., Igarashi, K., Zou, C.,
Ishihama, A. et al. (1993). A third recognition element
in bacterial promoters: DNA binding by the alpha
subunit of RNA polymerase. Science, 262, 1407–1413.
Hsu, L. M. (2002). Promoter clearance and escape in
prokaryotes. Biochim. Biophys. Acta, 1577, 191–207.
Mekler, V., Kortkhonjia, E., Mukhopadhyay, J.,
Knight, J., Revyakin, A., Kapanidis, A. N. et al.
(2002). Structural organization of bacterial RNA
polymerase holoenzyme and the RNA polymerasepromoter open complex. Cell, 108, 599–614.
Korzheva, N., Mustaev, A., Kozlov, M., Malhotra, A.,
Nikiforov, V., Goldfarb, A. & Darst, S. A. (2000). A
structural model of transcription elongation. Science,
289, 619–625.
Toulokhonov, I., Artsimovitch, I. & Landick, R. (2001).
Allosteric control of RNA polymerase by a site that
contacts nascent RNA hairpins. Science, 292, 730–733.
Komissarova, N., Becker, J., Solter, S., Kireeva, M. &
Kashlev, M. (2002). Shortening of RNA:DNA hybrid
in the elongation complex of RNA polymerase is a
prerequisite for transcription termination. Mol. Cell.
10, 1151–1162.
Toulokhonov, I. & Landick, R. (2003). The flap domain
is required for pause RNA hairpin inhibition of
catalysis by RNA polymerase and can modulate
intrinsic termination. Mol. Cell. 12, 1125–1136.
Kireeva, M. L., Komissarova, N., Waugh, D. S. &
Kashlev, M. (2000). The 8-nucleotide-long RNA:DNA
hybrid is a primary stability determinant of the RNA
polymerase II elongation complex. J. Biol. Chem. 275,
6530–6536.
Nudler, E., Avetissova, E., Markovtsov, V. & Goldfarb,
A. (1996). Transcription processivity: protein-DNA
interactions holding together the elongation complex.
Science, 273, 211–217.
Gopal, V., Brieba, L. G., Guajardo, R., McAllister, W. T.
& Sousa, R. (1999). Characterization of structural
features important for T7 RNAP elongation complex
stability reveals competing complex conformations
and a role for the non-template strand in RNA
displacement. J. Mol. Biol. 290, 411–431.
Kireeva, M. L., Komissarova, N. & Kashlev, M. (2000).
Overextended RNA:DNA hybrid as a negative regulator of RNA polymerase II processivity. J. Mol. Biol.
299, 325–335.
Mentesana, P. E., Chin-Bow, S. T., Sousa, R. &
McAllister, W. T. (2000). Characterization of halted
658
32.
33.
34.
35.
36.
37.
38.
39.
Role of Lid Element in Transcription by RNAP
T7 RNA polymerase elongation complexes reveals
multiple factors that contribute to stability. J. Mol. Biol.
302, 1049–1062.
Murakami, K. S., Masuda, S., Campbell, E. A.,
Muzzin, O. & Darst, S. (2002). Structural basis of
transcription initiation: an RNA polymerase holoenzyme/DNA complex. Science, 296, 1285–1290.
Naryshkin, N., Revyakin, A., Kim, Y., Mekler, V. &
Ebright, R. H. (2000). Structural organization of the
RNA polymerase-promoter open complex. Cell, 101,
601–611.
Zenkin, N. & Severinov, K. (2004). The role of RNA
polymerase sigma subunit in promoter-independent
initiation of transcription. Proc. Natl Acad. Sci. USA,
101, 4396–4400.
Davis, C. A., Capp, M. W., Record, M. T., Jr. & Saecker,
R. M. (2005). The effects of upstream DNA on open
complex formation by Escherichia coli RNA polymerase. Proc. Natl Acad. Sci. USA, 102, 285–290.
Saecker, R., Tsodikov, O., McQuade, K.., Schlax, P.,
Jr, Capp, M. & Record, M., Jr (2002). Kinetic
studies and structuralmodels of the association of
E. coli σ70 RNA polymerase with the lPR promoter:
large scale conformational changes in forming kinetically significant intermediates. J. Mol. Biol. 319,
649–671.
Sclavi, B., Zaychikov, E., Rogozina, A., Walther, F.,
Buckle, M. & Heumann, H. (2005). Real-time characterization of intermediates in the pathway to open
complex formation by Escherichia coli RNA polymerase at the T7A1 promoter. Proc. Natl Acad. Sci. USA,
102, 4706–4711.
Kettenberger, H., Armache, K. J. & Cramer, P. (2004).
Complete RNA polymerase II elongation complex
structure and its interactions with NTP and TFIIS.
Mol. Cell. 16, 955–965.
Korzheva, N., Mustaev, A., Nudler, E., Nikiforov, V. &
Goldfarb, A. (1998). Mechanistic model of the elonga-
40.
41.
42.
43.
44.
45.
46.
47.
48.
tion complex of Escherichia coli RNA polymerase. Cold
Spring Harbor Symp. Quant. Biol. 63, 337–345.
Yarnell, W. S. & Roberts, J. W. (1999). Mechanism of
intrinsic transcription termination and antitermination. Science, 284, 611–615.
Chamberlin, M. & Berg, P. (1964). Mechanism of
RNA polymerase action: formation of DNA-RNA
hybrids with single-stranded templates. J. Mol. Biol.
78, 297–313.
Uptain, S. M. & Chamberlin, M. J. (1997). Escherichia
coli RNA polymerase terminates transcription efficiently at rho-independent terminators on singlestranded DNA templates. Proc. Natl Acad. Sci. USA,
94, 13548–13553.
Daube, S. S. & von Hippel, P. H. (1994). RNA displacement pathways during transcription from synthetic RNA-DNA bubble duplexes. Biochemistry, 33,
340–347.
Tomizawa, J. & Masukata, H. (1987). Factor-independent termination of transcription in a stretch of deoxyadenosine residues in the template DNA. Cell, 51,
623–630.
Zhang, G., Campbell, E. A., Minakhin, L., Richter, C.,
Severinov, K. & Darst, S. A. (1999). Crystal structure of
Thermus aquaticus core RNA polymerase at 3.3 Å
resolution. Cell, 98, 811–824.
Darst, S. A., Opalka, N., Chacon, P., Polyakov, A.,
Richter, C., Zhang, G. & Wriggers, W. (2002).
Conformational flexibility of bacterial RNA polymerase. Proc. Natl Acad. Sci. USA, 99, 4296–4301.
Zenkin, N., Naryshkina, T., Kuznedelov, K. & Severinov, K. (2006). The mechanism of DNA replication
primer synthesis by RNA polymerase. Nature, 439,
617–620.
CarterII, E. S. & Tung, C. S. (1996). NAMOT2–a
redesigned nucleic acid modeling tool: construction of
non-canonical DNA structures. Comput. Appl.Biosci.
12, 25–30.
Edited by M. Gottesman
(Received 14 March 2006; received in revised form 26 June 2006; accepted 28 June 2006)
Available online 27 July 2006