Molecular Cell, Vol. 1, 1033–1042, June, 1998, Copyright 1998 by Cell Press
Transcriptional Pausing at 162
of the HIV-1 Nascent RNA Modulates
Formation of the TAR RNA Structure
Murali Palangat,* Timothy I. Meier,†§
Richard G. Keene,†k and Robert Landick*‡
* Department of Bacteriology
University of Wisconsin—Madison
Madison, Wisconsin 53706
† Division of Biology and Biomedical Sciences
Washington University
St. Louis, Missouri 63130
Summary
A strong transcriptional pause delays human RNA
polymerase II three nt after the last potentially paired
base in HIV-1 TAR, the RNA structure that binds the
transactivator protein Tat. We report here that the
HIV-1 pause depends in part on an alternative RNA
structure (the HIV-1 pause hairpin) that competes with
formation of TAR. By probing the nascent RNA structure in halted transcription complexes, we found that
the transcript folds as the pause hairpin before and
at the pause, and rearranges to TAR concurrent with
or just after escape from the pause. The pause signal
triggers a 2 nt reverse translocation by RNA polymerase that may block the active site and be counteracted
by formation of TAR. Thus, the HIV-1 pause site modulates nascent RNA rearrangement from a structure
that favors pausing to one that both recruits Tat and
promotes escape from the pause.
Introduction
The activation of HIV-1 transcription is the best-understood example of a eukaryotic control mechanism that
regulates the efficiency of RNA chain elongation rather
than the rate of initiation (for review, see Jones and
Peterlin, 1994; Bentley, 1995; Jones, 1997). In the absence of the transactivator protein Tat, which is encoded
by two distal exons in the single 10 kb HIV-1 transcription
unit, RNA polymerase II (RNAPII) initiates mRNA synthesis at the HIV-1 promoter in the upstream long terminal
repeat, but terminates transcription prematurely, thus
yielding primarily short untranslated RNAs rather than
programming viral replication. Tat can interact with numerous components of a transcription complex (TC),
including RNAPII (Mavankal et al., 1996), the cyclindependent kinase 7 subunit of TFIIH (Parada and Roeder,
1996; Cujec et al., 1997; Garcia-Martinez et al., 1997),
and the RNAPII CTD-kinase complex known as P-TEFb
(Zhu et al., 1997; Wei et al, 1998). However, to trigger
efficient RNA chain elongation either in vivo or in vitro,
Tat must bind to the TAR RNA structure, which forms
from the initial portion of the HIV-1 transcript (Berkhout
‡ To whom correspondence should be addressed.
§ Present address: Lilly Research Laboratories, Indianapolis, Indiana
46285.
k Present address: Department of Molecular Biology, Cleveland
Clinic Foundation, Cleveland, Ohio 44195.
et al., 1989; Marciniak et al., 1990; Kato et al., 1992;
Graeble et al., 1993 and references therein).
Tat appears to act by stimulating phosphorylation of
RNAPII by the kinase subunits of either TFIIH, P-TEFb,
or both (Parada and Roeder, 1996; Cujec et al., 1997;
Zhu et al., 1997). The position in the HIV-1 transcriptional
unit at which the critical phosphorylation occurs and
how it alters RNA chain elongation are unknown. However, formation of TAR from at least the first 42 nt of
the nascent RNA and its interaction with Tat are required
prior to complete assembly of an elongation-proficient
TC (Berkhout et al., 1989). Thus, Tat–TAR interaction
must occur after U42 exits RNAPII and becomes available for base-pairing with A20. Since 16–20 nt of nascent
RNA are protected by RNAPII (Rice et al., 1991; Gu et
al., 1996), synthesis of a 58–62 nt nascent RNA should
demarcate the earliest point for Tat–TAR interaction.
What molecular mechanism ensures that Tat–TAR interaction is established before the unmodified TC terminates transcription prematurely? In some other cases
of regulated transcriptional elongation, a delay in RNA
synthesis prior to the interaction of a regulatory molecule is programmed by a pause signal that temporarily
halts RNAP. For instance, promoter-proximal pausing
in Drosophila heat shock genes halts RNAPII around
120 until interaction with the heat shock transcription
factor (O’Brien and Lis, 1991). Similar promoter-proximal
pauses have been detected in many Drosophila genes
(Rougvie and Lis, 1990), in mammalian genes like c-myc
(Krumm et al., 1995), and in the late operons of several
lambdoid phages where interaction of the Q antitermination protein releases the paused RNAP (Ring and Roberts, 1994).
A transcriptional pause that could help present TAR
for timely interaction of Tat has been reported during
transcription of HIV DNA both in vivo (Kessler and Mathews, 1992) and in vitro (Parada et al., 1995) around
160, very close to the position at which the target for
Tat-binding emerges from RNAPII, but beyond the
position of known promoter-proximal pause sites. This
pause more resembles the class of promoter-distal
pause signals that are found in the leader regions of E.
coli operons like his and trp and that depend in part
on nascent RNA secondary structures. These pause signals halt RNAP until a ribosome initiates translation of
a leader peptide coding region, releases the paused
RNAP, and regulates transcriptional attenuation (Landick et al., 1996a). Like the his and trp pause sites, the
HIV-1 pause occurs just after the addition of the last
paired base in an important RNA secondary structure
(TAR for HIV-1, the A:B or 1:2 RNA structures for his
and trp). Further, the his pause site appears to modulate
initial formation of this RNA structure through a direct
RNAP–RNA interaction (Wang and Landick, 1997). We
report here that the HIV-1 pause signal includes an alternative RNA secondary structure that inhibits TAR formation in the nascent transcript and thus may control the
availability of TAR for interaction with Tat.
Molecular Cell
1034
Results
Experimental Approach
To study intrinsic pausing by RNAPII, we needed to
examine synchronous RNA chain elongation by RNAPII
TCs unperturbed by the excess of elongation factors
and DNA-binding proteins that are present in nuclear
extracts. To accomplish this, we first formed elongation
complexes halted after addition of U14 to the HIV-1
transcript by incubating an immobilized, 774 bp DNA
fragment encoding the HIV-1 promoter and early transcribed region fused to the human c-myc exon 1 in a
HeLa nuclear extract with dATP, CTP, GTP, and a-32PUTP (see Figure 1A, Experimental Procedures, and Kato
et al., 1992). These halted U14 TCs were recovered from
the extract and washed with buffer containing 0.15%
sarkosyl to remove residual preinitiation complexes,
transcription factors, and nonspecific DNA-binding proteins (Izban and Luse, 1991). Addition of all 4 NTPs to the
sarkosyl-washed complexes restarted chain elongation
efficiently, allowing synchronous transcription of the
HIV-1 pause site (Figure 1B). To obtain homogenous
complexes halted before, at, or after the HIV-1 pause,
we elongated the RNA chains in the immobilized TCs
by repeated incubation with different sets of 3 NTPs,
followed by washing to remove each NTP set (stepwise
transcription; see Figure 4, Experimental Procedures,
and Kashlev et al., 1993).
RNAPII Recognizes a Strong Intrinsic Pause Signal
before the Addition of G63 in the HIV-I
Early Transcribed Region
Synchronous elongation of the halted U14 complexes
revealed a strong pause RNA band of z62 nt that appeared z18 s after resumption of transcription at 1 mM
each NTP and gradually elongated into run-off transcript
over a period of several minutes (Figure 1B). Two additional RNAs z65–67 nt in length appeared at the same
time, only a fraction of which were further elongated
even after 5 min. We attribute these persistent RNAs to
transcriptional arrest. The z62 nt pause and z65–67 nt
arrest RNAs presumably correspond to the HIV-1 pause
RNAs reported in previous studies (Kessler and Mathews, 1992; Parada et al., 1995). Quantitation of the
z62 nt RNA revealed that the paused complex resumed
transcription with a pseudo-first-order half-life of 22 s
and that at most 70% of transcribing RNAPII molecules
entered the paused state (Figure 1C; see Experimental
Procedures and Landick et al., 1996b). Approximately
10% of the transcribing RNAPII became arrested at
z65–67. Since pol II requires z10 s to add the 48 nt
between U14 and the pause (Figure 1B), the 22 s pause
half-life represents a slowing of the rate of chain elongation by a factor of .100.
To determine the precise 39 ends of the pause and
arrest RNAs, we compared them to an RNA sequence
ladder generated with chain-terminating 39dNTPs (Figure 1D). The pause RNA terminated with U62 and the
arrest RNAs with U65 and U66. These RNAs end 3, 6,
and 7 nt after the last paired nucleotide in the stem of
the TAR RNA structure, only a portion of which could
actually form in the paused TC (Figure 1E). Thus, the
Figure 1. In Vitro Transcription from the HIV-1 Promoter
(A) Experimental approach and sequence of the RNA transcribed
from a template that carries the HIV-I promoter and early transcribed
region (2138 to 185 with respect to the HIV-I start site) followed
by c-myc sequences (see Experimental Procedures).
(B) Time course of transcription through the HIV-1 pause site. Samples were removed at indicated times after addition of 1 mM each
NTP to sarkosyl-washed U14 complexes, processed, and separated
on a denaturing 11% polyacrylamide gel (see Experimental Procedures). (M), 32P-labeled MspI digest of pBR322 with fragment sizes
indicated in nt.
(C) Relative concentrations of the pause RNA (open circles) and
total RNA at and above the pause (closed circles) in each lane of
Figure 1B. Back-extrapolation of the [pause RNA] to time 0 yields
a maximum pause efficiency of #0.7; nonlinear regression of the
[pause RNA] as a function of time gives a pause half-life of 22 s
(see Landick et al., 1996b).
(D) RNA sequencing ladder compared to pause and arrest RNAs.
The RNA sequencing ladder was generated by elongating U14 TCs
in the presence of all 4 NTPs and a 39-dNTP as a chain terminator
(see Experimental Procedures). Samples obtained at 40 s and 60 s
during a time course of elongation without 39dNTPs were electrophoresed next to the RNA sequence ladder on a 6% denaturing
polyacrylamide gel.
(E) Location of HIV-1 pause and Tat-binding sites relative to a conventional depiction of the TAR RNA structure. The shaded box indicates the segment of nascent RNA likely protected by RNAPII at
the pause site (see text).
HIV-1 pause exhibits two striking similarities to the wellcharacterized his and trp pause signals: (1) pausing occurs immediately after an RNA structure that can pair
to within a few nt of the pause site in free RNA, and
(2) pausing occurs where the active site must catalyze
reaction of a 39-terminal uridine with GTP.
Pausing Modulates HIV-1 Nascent RNA Folding into TAR
1035
the upper portion of the TAR structure with the RNA
hairpin that is bound by the MS2 coat protein (Figure
2B; see Valegard et al., 1994, and references therein).
Since overall stability but not sequence is important in
a prokaryotic pause hairpin (Chan and Landick, 1993),
we were surprised to find that the MS2 substitution
reduced the HIV-1 pause half-life by a factor of 3, even
though it should be more stable than TAR in the portion
of nascent RNA available for base-pairing at the HIV-1
pause site (Figure 2B). The 39-proximal substitution essentially eliminated the pause, whereas the downstream
change had little effect. Thus, the HIV-1 pause signal
is multipartite since both RNA hairpin and 39-proximal
sequences influenced pausing. Dissection of the role of
39-proximal sequences and more rigorous testing for
effects of downstream DNA must await future studies;
we chose to focus our effort on the interesting effect
on pausing of base substitutions in TAR.
Figure 2. Pausing at U62 on Mutant Templates and with Purified
RNAPII
(A) Effects on pausing of base substitutions in the TAR hairpin, 39proximal and downstream DNA mutants (using sarkosyl-washed
U14 complexes as in Figure 1B), and of transcription with purified
calf-thymus RNAPIIa (see Experimental Procedures). TAR hairpin
mutant, MS2 is shown in Figure 2B. 39-proximal mutant, replacement
of GGGAACCCACT62 before pause with GTCTTAGGGAT62. Downstream mutant, replacement of G63CTTAAGCCTCAATAAAGCTT
after pause with G 63CCGAGACTAGGGAACCTGCA. Cross symbol
indicates new pause created in the downstream DNA mutant.
(B) Pause half-lives with HeLa nuclear extract-generated TCs (black)
or purified calf-thymus RNAPII (shaded). Each value is an average
of at least three experiments. Base substititions are shown in bold.
The predicted free energies of formation for the portions of the RNA
structures that should be able to form in the paused TC (base pairs
C18·G44 and above) are: wild-type, 27.5 kcal/mol; MS2, 29.3 kcal/
mol; Dbulge, 213.5 kcal/mol; CA loop, 27.5 kcal/mol; UA loop, 27.4
kcal/mol; tetraloop, 210.8 kcal/mol (Zuker and Stiegler, 1981). The
predicted DG for the tetraloop was decreased by 2 kcal/mol based
on measurements of its unusual thermal stability (Tuerk et al., 1988);
the UA loop also is reported to be more stable than the predicted
value (Churcher et al., 1993), but its DG was not adjusted because
no measurement is available.
The HIV-1 Pause Signal Is Multipartite
In addition to bases in the active site, the his and trp
pause signals depend on an RNA secondary structure,
the 39-proximal RNA or DNA, and the downstream DNA
duplex (Chan and Landick, 1993; Chan et al., 1997). To
ask expeditiously if the HIV-1 pause signal is similarly
multipartite, we checked the effect on pausing of substitutions that should dramatically alter the TAR RNA structure, the 39-proximal sequence, or the downstream DNA
sequence (Figure 2A). We first tested a replacement of
RNA Secondary Structure Influences
the HIV-1 Pause
We next tested the effect on pausing of several previously characterized deletions and substitutions in TAR
(Dbulge, CA-loop, UA-loop, and tetraloop, Figure 2B; Wu
et al., 1991; Churcher et al., 1993). All four substitutions
decreased the pause half-life in sarkosyl-washed TC
assays, and the most significant effects were caused
by the substitutions that should increase the stability of
the TAR RNA structure (Figure 2B). In particular, the
UUCG tetraloop is known to stabilize RNA structures by
z2 kcal/mol (Tuerk et al., 1988); on TAR, it reduced the
pause half-life by a factor of 3 (Figure 2B). Since the
tetraloop substitutions are .25 nt from the pause RNA
39 end, whereas the RNAPII footprints on template DNA
and nascent RNA extend at most z20 bp or nt upstream
in halted complexes (Linn and Luse, 1991; Rice et al.,
1991; Gu et al., 1993, 1996), it is likely that these substitutions affected pausing through their influence on RNA
secondary structure. However, the strong effects on
pausing of substitutions that should stabilize rather than
destabilize the TAR structure seemed puzzling, unless
they were mediated by an auxiliary factor that was present in the HeLa nuclear extract and survived the 0.15%
sarkosyl wash. To test this idea, we performed transcription assays using highly purified calf-thymus RNAPII.
Recognition of the HIV-1 Pause Site
by RNAPII Required No Additional
Transcription Factors
Since purified RNAPII cannot initiate transcription at a
promoter sequence, we synthesized an HIV-I template
with a defined 39 extension (a “tailed” template) that
serves as an efficient initation site for RNAPII (Kadesch
and Chamberlin, 1982; Lang et al., 1994). Highly purified
calf-thymus RNAPII initiated in the absence of ATP
halted at position U34 on this DNA template (equivalent
to position U14 of the HIV-1 transcript; see Experimental
Procedures). After addition of 1 mM each NTP, these
complexes recognized the HIV-1 pause similarly to extract-initiated human RNAPII (pause half-life ≈20 s; Figures 2A and 2B). Further, a template that specified the
Molecular Cell
1036
UUCG tetraloop pause signal reduced the pause halflife by a factor of 2 (Figure 2B), consistent with the
behavior of human RNAPII initiated in a HeLa nuclear
extract. Transcripts synthesized on these tailed templates were sensitive to RNase T1 digestion, but not to
RNase H digestion, establishing that they were displaced from the template strand (data not shown; formation of persistent hybrids is a frequent complication of
transcription by purified RNAPII on tailed templates;
Kadesch and Chamberlin, 1982).
The calf-thymus RNAPII preparation used in these
experiments was not phosphorylated on its C-terminal
repeat (RNAPIIa). However, purified human RNAPIIo (the
hyperphosphorylated form of RNAPII) gave similar results (data not shown), suggesting that the extent of
phosphorylation of the C-terminal domain was not important for pause site recognition. We conclude that
recognition of the HIV-1 pause site is an intrinsic property of the mammalian RNAPII enzyme and requires only
the nucleic acid sequences and structures present when
the TC arrives at U62 on an HIV-1 template.
The HIV-I Pause Is Stimulated by a Pause RNA
Hairpin that Competes with Formation
of the TAR RNA Hairpin
Since the experiments with pure RNAPII appeared to
rule out involvement of an auxiliary factor in pausing,
and since we could not explain the effects on pausing
of substitutions in TAR by destabilization of the TAR
RNA structure, we next asked whether an RNA structure
other than TAR might be formed in the HIV-1 paused
TC. We used an RNA structure prediction algorithm to
examine the possible folding patterns in the first 44 nt
of the pause RNA (Zuker and Stiegler, 1981), assuming
that z18 nt of RNA upstream from the paused RNA 39
end should be unavailable for structure formation (Rice
et al., 1991; Gu et al., 1996). Interestingly, 11 to 144 of
the pause RNA was predicted to fold as an alternative
RNA structure that was both more stable than and mutually exclusive of the corresponding portion of TAR (Figure 3).
To test whether this alternative RNA structure could
be part of the HIV-1 pause signal, we constructed two
sets of substitutions that would replace base pairs in
either TAR or the alternative structure. The first set of
substitutions (nt 26–29 [a] or 36–39 [b]; Figure 3) separately would disrupt both TAR and the alternative RNA
structure, but restore base pairing only in TAR when they
were combined. Separately, substitution of nt 26–29 or
36–39 had little effect on the pause half-life (18 s and
19 s, as compared to 22 s for wt). However, when they
were combined, the pause half-life decreased by a factor of z3 (to 7 s). This result is inconsistent with stimulation of pausing by the TAR RNA structure.
The second set of substitutions (nt 5–15 [c] or 25–36
[d]; Figure 3) would disrupt either the alternative RNA
structure alone (5–15) or both it and TAR (25–36), but
restore only the alternative RNA structure when the two
groups of substitutions were combined. Separately,
these substitutions reduced the pause half-life significantly (to 12 s for 5–15) or modestly (to 17 s for 25–36),
but increased the pause half-life to 24 s when combined.
Figure 3. The Pause RNA Hairpin Is a Functional Component of the
HIV-1 Pause Signal
RNA structures in the first 44 nt of HIV-1 RNA predicted by the
method of Zuker and Stiegler (1981): the TAR RNA hairpin (DG 5
27.5 kcal/mol) and the alternative pause RNA hairpin (DG 5 212.6
kcal/mol). The shaded box represents the z18 nt segment of RNA
that should be protected by RNAPII. Potentially compensatory base
changes for the TAR RNA hairpin and the pause RNA hairpin are
shown in boxes.
(Inset) Relative pause half-lives for these substitutions alone and in
combination were measured as described in the legend to Figure
1 and in the Experimental Procedures.
These results are most easily explained if the alternative
RNA structure, which we term the HIV-1 pause hairpin,
stimulates pausing by preventing formation of TAR,
which itself stimulates escape from the pause site. This
would explain why substitutions that disrupt both structures had little effect, whereas selective disruption of
the pause hairpin or stabilization of TAR reduced pausing and stabilization of the pause hairpin restored pausing (Figures 2 and 3).
Mapping RNA Structures in Active TCs
To test whether the HIV-1 pause hairpin actually forms in
the paused TC, we probed the RNA secondary structure
present in halted TCs by partial digestion with RNase
T1, which cuts 39 to unpaired Gs. To prepare these TCs
and to simplify interpretation of the RNase T1 digestion
patterns, we needed to form the complexes by stepwise
transcription and to incorporate 32P-labeled nucleotide
only at or near the 39 end. Thus, we restarted transcription in nonradioactive, sarkosyl-washed U14 complexes
by addition of only ATP, GTP, and CTP, so that RNAPII
next halted before addition of U23. After washing with
transcription buffer to remove NTPs, RNAPII could be
moved stepwise to the pause site by repeating these
steps with different sets of 3 NTPs (Figure 4). A control
experiment with 32P-NMP incorporated during U14 complex formation, rather than during the last step, illustrates this procedure (Figure 4).
To help interpret the RNase T1 digestion patterns,
we analyzed purified RNAs that were predicted to form
either the pause RNA hairpin or the TAR RNA structure
(1–42 and 1–59, respectively; Figure 5), in addition to
TCs halted before, at, and after the pause. We synthesized and purified the 42mer and 59mer RNAs by stepwise elongation of transcripts in unlabeled U14 complexes, incorporation of 32 P-CMP in the last step to
Pausing Modulates HIV-1 Nascent RNA Folding into TAR
1037
Figure 4. Stepwise Transcription by RNAPII up to the HIV-1 Pause
Site
Positions of RNA 39 end in TCs halted sequentially by NTP deprivation are indicated in large italics within the pause hairpin RNA structure, with lines connecting them to the corresponding RNA bands
separated in a denaturing 15% polyacrylamide gel. Asterisks indicate positions of 32P label. The 59-labeled TCs used in this experiment generated significantly more of the undesired weak bands at
the positions other than the indicated ladder than the 39-labeled
complexes used for the RNA structure mapping experiment (Figure 5).
generate a 39 label, and recovery from denaturing polyacrylamide gels (see Experimental Procedures). The
C59, U62(paused), and C64 TCs were synthesized and
labeled similarly, but not disrupted prior to partial RNase
T1 digestion. After digestion, the 32P-labeled, 39-proximal fragments remained associated with RNAPII in active TCs since they could be extended further upon
addition of NTPs (data not shown). Thus, the partial
digestion patterns of the nascent transcripts in these
halted TCs should reflect the actual structure that the
nascent RNA assumes when RNAPII is located at a given
template position; comparison of these patterns to
those obtained from the model RNAs was used to identify these structures (Figure 5).
RNase T1 cut the model pause hairpin RNA strongly
after G16, G21, and G36, and to a lesser extent after
G26, G28, G32, G33, and G34 (Figure 5, lanes 4 and 5).
In contrast, RNase T1 cut the model TAR to significant
extent only in the loop regions bases G32, G33, and G34
(Figure 5, lanes 9 and 10; see also Berkhout et al., 1989).
Thus, the first 42 nt of the HIV-1 transcript fold in a
structure that is dramatically different from TAR and
that is consistent with the predicted pause hairpin structure. Interestingly, the nascent RNAs in both C59 and
U62(paused) complexes gave RNase T1 digestion patterns similar to the model pause RNA pattern (strong
cutting after G16, G21, and G36; Figure 5, lanes 12–14
Figure 5. The HIV-1 Nascent RNA Rearranges from the Pause Hairpin to TAR at or after the Pause Site
Purified 42mer and 59mer RNA, and TCs halted at C59, U62, and
C64 were partially digested with RNase T1 (20 U/ml) in transcription
buffer alone (lanes 4, 5, 9, 10, 12–14, 16–18, and 20–22) or with 4
M urea (lanes 2, 3, 7, and 8). Reactions were carried out for 10 s
(lanes 2, 4, 7, 9, 12, 16 and 20), 20 s (lanes 3, 5, 8, 10, 13, 17, and
21), or 30 s (lanes 14, 18, and 22). Samples in lanes 1, 6, 11, 15, and
19 were not digested with RNase T1. The 59 end of the digested
RNA is indicated. Cross symbol indicates an RNA band that could
not be assigned. RNA hairpin structures in purified model RNAs
(U42 and C59) and in TCs (U62(P) and C64) with the RNase T1sensitive (arrows) and hypersensitive (bold arrows) sites are shown
below the gel panels. Asterisks indicate positions of 32P label.
and 16–18), whereas the nascent RNA in the C64 complex appeared almost completely rearranged into the
TAR structure, with strong cleavage in the loop regions
Gs (G32, G33, and G34) and near complete protection
elsewhere (Figure 5, lanes 20–22; note that the band
near G21 is a partially extended RNA present in the
undigested sample in lane 19). A comparison of cutting
after G36 and G44, versus cutting after G32–34, is especially revealing. Although G36 and G44 are further from
the region that would be protected by RNAPII in the C64
complex, they are cut much less or not at all relative to
in C59 and U62(paused) complexes. However, the ratio
of G32–34 to G34 cutting is greater in the U62(paused)
complex than in the purified 42mer RNA (compare lanes
Molecular Cell
1038
Figure 6. Effect of TFIIS and Pyrophosphate on the HIV-1 Paused
TC
U62(paused) and C64 TCs with 59-proximal 32P label were prepared
by stepwise transcription (see Experimental Procedures and Figure
4) and then incubated with either 2.5 nM TFIIS (U62 TCs, lanes 1–7;
C64 TCs, lanes 15–21) or with 50 mM pyrophosphate (U62 TCs,
lanes 8–14; C64 complexes, lanes 22–28) for indicated times. RNA
samples were prepared and electrophoresed on a denaturing 7.5%
polyacrylamide gel as described in the Experimental Procedures.
Bands were assigned by comparison to markers from TCs halted
at 1 nt intervals from C59 to C64 (not shown).
4 and 17, Figure 5), suggesting that TAR may form as
a minor constituent of interconverting RNA structures
in the paused complex. We conclude that the nascent
RNA in U62 TCs folds predominantly as the HIV-1 pause
RNA hairpin, which inhibits complete formation of TAR
until after RNAPII escapes the pause site by no more
than 2 nt.
The Nascent RNA in the HIV-1 Paused TC
Is Reverse Translocated
Transcriptional pausing likely is caused by inability to
maintain proper alignment of the RNA 39 end in the active
site, either because the RNAP backtracks so that the
39-proximal RNA blocks the active site (reverse translocation) or because the RNA is pulled upstream out of the
active site (hypertranslocation; see Chan et al., 1997). In
the other well-characterized case of hairpin-dependent
pausing (the his leader pause), formation of the pause
hairpin appears to hypertranslocate the nascent RNA
based on resistance of the paused TC to transcript hydrolysis and to pyrophosphorolysis (Feng et al., 1994;
Chan et al., 1997). To distinguish these possibilities for
the HIV-1 paused TC, we tested its sensitivity to TFIISstimulated transcript cleavage and to pyrophosphorolysis. We found that the HIV-1 pause RNA is sensitive
to concentrations of TFIIS (2.5 nM) and pyrophosphate
(50 mM) that have lesser or no effect on other halted
TCs, most notably the C64 complex in which the TAR
RNA structure is formed (Figure 6). Further, both treatments shorten the pause RNA by 2 nt. We conclude that
RNA chain elongation most likely is inhibited in the HIV-1
paused complex because RNAPII is backtracked and
the RNA 39 end is reverse translocated downstream by
2 nt, thus blocking the active site (Figure 7).
Discussion
Our results lead to three principal conclusions. First,
strong transcriptional pausing at 162 of the HIV-1 transcript is stimulated by a multipartite signal that favors
backtracking of RNAPII and reverse translocation of the
nascent RNA by 2 nt. Second, one component of the
Figure 7. Model for Effect of HIV-1 Pausing on Formation of TAR
The pause hairpin allows backtracking of RNAP in response to the
39-proximal RNA and DNA sequence. The accompanying reverse
translocation of the RNA transcript through the active site blocks
RNA chain elongation. Formation of TAR forces the RNA 39 end
back into the active site to allow NTP binding and escape from the
pause. The hatched segment of RNA transcript is paired in the pause
hairpin, but not in the portion of TAR that can form at the pause
(see Figure 3).
pause signal is an RNA secondary structure, the HIV-1
pause hairpin, that allows reverse translocation and prevents formation of the TAR RNA structure. Third, rearrangement of the nascent RNA into TAR promotes
escape from the pause and occurs when RNAPII is at
or has just escaped from the HIV-1 pause site.
Determinants of Pausing in the HIV-1
Leader Region
Several types of prokaryotic pause sites have been studied in sufficient detail to establish that the signals are
generally multipartite and that some but not all include
an RNA secondary structure (Chan and Landick, 1994).
Two types of RNAPII pause sites have been examined
to date: (1) promoter-proximal pause sites such as found
in the Drosophila hsp and mammalian c-myc genes
(Rougvie and Lis, 1990; O’Brien and Lis, 1991; Krumm
et al., 1995), which like the l late operon pause site
(Ring et al., 1996) may be factor-dependent and reflect
incomplete loss of promoter contacts; and (2) the U-rich
sites such as adenovirus T1 site and the histone H3.3
site, which trigger both intrinsic pausing and transcriptional arrest by causing RNAPII to reverse-translocate
the RNA and DNA chains, presumably because the
U-rich RNA:DNA hybrid present in the elongation-competent conformation is less stable than the hybrid generated upon backtracking of RNAPII to an elongationincompetent conformation (Gu et al., 1993; Reeder and
Pausing Modulates HIV-1 Nascent RNA Folding into TAR
1039
Hawley, 1996; Komissarova and Kashlev, 1997; Nudler
et al., 1997). Arrest, but not pausing, at the U-rich sites
is relieved by the TFIIS-dependent transcript cleavage,
which reactivates the arrested TC to allow multiple attempts to overcome the thermodynamic barrier to chain
elongation (reviewed in Reines et al., 1996).
The HIV-1 pause signal represents a third class of
RNAPII pause signal that depends on neither extrinsic
factors nor U-rich sequences, but rather in part on an
RNA secondary structure. In this way, it is analogous to
the prokaryotic pause signals found in the leader regions
of amino acid biosynthetic operons regulated by attenuation. Like these prokaryotic signals, the HIV-1 pause
also is multipartite, since base changes in both the
pause hairpin and the 39-proximal sequence between
the hairpin and RNA 39 end can reduce pausing (Figure 2).
However, unlike these prokaryotic pause signals,
which appear to pull the RNA 39 end upstream out of
the active site and render it resistant to both transcript
cleavage and pyrophosphorolysis, the HIV-1 pause signal appears to cause reverse translocation by 2 nt,
based on sensitivity to TFIIS-stimulated transcript cleavage and pyrophosphorolysis (Figure 6). The primary
cause of this reverse translocation likely is the relative
instability of the RNA:DNA hybrid when the 39 end of
the paused transcript is properly positioned in the active
site (see Guajardo and Sousa, 1997; Komissarova and
Kashlev, 1997; Landick, 1997; Nudler et al., 1997). Assuming that the RNA:DNA hybrid for RNAPII is z8 bp,
as it appears to be for E. coli RNAP and RNAPI (see Lee
and Landick, 1992; Jeong et al., 1996; Nudler et al.,
1997), a 2 bp reverse translocation would add two unusually stable rG·dC bp to the hybrid with loss of rC·dG
and rU·dA bp, making it z1.2 kcal/mol more stable than
a 39-terminal hybrid (Sugimoto et al., 1995). In contrast,
a shift of the hybrid 2 bp upstream in the 39-proximal
substitution that virtually eliminates pausing (Figure 2A)
would confer no additional predicted stability. Thus, our
results are consistent with the idea that the relative
strength of nascent RNA:template DNA hybrids controls
the lateral stability of the TC; systematic variation of the
39-proximal sequence at the HIV-1 pause should test
this idea rigorously.
Formation of the TAR RNA Structure Releases
RNAPII from the HIV-1 Pause
Reverse translocation of the HIV-1 pause RNA also offers an attractive explanation for the decrease in pause
half-life that was observed when the TAR RNA structure
was stabilized by base substitution. Since the stem of
the TAR hairpin can extend closer to the RNA 39 end
than the pause hairpin stem, TAR formation may pull
the RNA back into reactive alignment by driving forward
translocation of RNAPII, thus favoring escape from the
pause (Figure 7). In the view that multiple laterally translocated states of RNAP exist in equilibrium (positional
equilibrium; Guajardo and Sousa, 1997; Landick, 1997;
Komissarova and Kashlev, 1997), this would trap the
conformation with a 39 OH properly positioned for NTP
addition. This antipausing effect of TAR is similar to
the inhibition of arrest caused by pairing of antisense
oligonucleotides or upstream RNA sequences to nascent RNA near the TC that is described by Reeder and
Hawley (1996) and Komissorova and Kashlev (1997).
The HIV-1 pause hairpin could play both indirect and
direct roles in pausing. By preventing TAR formation,
the pause hairpin may indirectly promote pausing by
allowing RNAPII to reverse translocate and remove the
RNA 39 end from the active site. It also is possible that
interaction of the pause hairpin with RNAPII in a manner
similar to the putative interaction of the his pause hairpin
with E. coli RNAP (Wang and Landick, 1997) could stabilize it relative to TAR or directly slow RNA chain elongation.
Our results also suggest that HIV-1 pause site controls
the timing of TAR formation. Thus, the most important
implication of our results is that TAR is unlikely to form
in the HIV-1 nascent transcript until RNAPII reaches or
escapes from the 162 pause site. Since Tat binding to
TAR is a central, and presumably early, step in the process of transactivation, strong transcriptional pausing
in the HIV-1 leader where TAR can first form could play
a role in transactivation. If Tat acts by stimulating phosphorylation of RNAPII (reviewed in Jones, 1997), then
rearrangement of the nascent transcript into TAR, either
upon Tat binding at the pause or spontaneously after
RNAPII escapes the pause, presumably precedes the
critical phosphorylation events. Further, if TAR forms
for only a small fraction of the time that RNAPII resides
at the pause (i.e., the pause hairpin and TAR are in an
equilibrium that favors the pause hairpin; Figure 7), then
the interaction of Tat with TAR would stabilize TAR relative to the pause hairpin and favor release from the
pause.
Does the HIV-1 Pause Play a Role
in Transcriptional Regulation?
Although the HIV-1 pause may help recruit Tat before
premature termination of RNAPII, there is currently no
compelling evidence that it plays an essential role in
viral replication. In fact, the pause is only likely to be
important for transactivation when Tat is present in limiting amounts. Transactivation as assayed by cotransfection of reporter and Tat-expression plasmids into cultured cells, conditions that overproduce Tat to high
levels, occurs independently of pausing. Under these
conditions, Tat can activate HIV-1 transcription when
tethered to a binding site upstream from the promoter,
even when TAR and the pause signal are not present
(Kamine et al., 1991; Southgate and Green, 1991). Further, transactivation occurs in cotransfection experiments when the 39-proximal region critical for pausing
is replaced with several different sequences (Berkhout
et al., 1989) and when TAR is replaced with different RNA
structures that can recruit Tat fusion proteins targeted to
the new structure (Selby and Peterlin, 1990; Southgate
et al., 1990).
Other arguments for or against a role of pausing
are contradictory and currently unresolved. Jeang and
Berkhout (1992) argue against a role of pausing in Tat
recruitment because placement of a self-cleaving hammerhead RNA structure just downstream from the 160
region, but not 500 bp later, abolishes transactivation.
Molecular Cell
1040
Because removing TAR from the TC soon after it forms
blocks transactivation, they conclude that Tat must ordinarily bind TAR after RNAPII moves past the 160 to
1100 region. However, this interpretation contradicts
the earlier findings of Berkhout et al. (1989), who concluded that Tat must bind TAR before nascent RNA
around 160 region emerges from RNAPII because insertion at 160 of a sequence known to destroy the TAR
structure by base-pairing with the 59 side of its stem
does not block transactivation. It seems most likely that
Tat binds TAR when or soon after it forms (for instance
at the pause site), but that the subsequent events of
transactivation such as RNAPII phosphorylation occur
as RNAPII moves further downstream, and that removal
of TAR (and Tat) when a hammerhead nuclease is present blocks completion of those steps. Keen et al. (1997)
have shown that these events include transfer of Tat
to stable interaction with RNAPII after the initial and
necessary Tat–TAR interaction, but prior to template
position z175 where TAR can be removed by nuclease
digestion without loss of Tat or transactivation.
In contrast to the conditions used in relevant experiments to date, it seems most likely that transcriptional
pausing would play a role in HIV-1 transactivation early
in HIV-1 replication, when premature termination of
HIV-1 transcription keeps Tat levels low. In these conditions, recruitment of Tat to the complex prior to premature termination should be inefficient. The pause signal,
which slows RNAPII by a factor of .100 relative to its
average elongation rate, could increase the effective
concentration of TCs at the critical position for Tat recruitment by a corresponding amount. Our results establish that the HIV21 pause site defines the position
at which the nascent RNA can rearrange to TAR, interact
with Tat, and initiate the events leading to transactivation.
Oslo, Norway) or on streptavidin-agarose (Sigma, St. Louis, MO)
through a streptavidin-biotin linkage according to the manufacturers’ recommendations.
Proteins and Substrates
HeLa cells were obtained from the Cell Culture Center (Connrapids,
MN). RNAPIIa was purified from frozen calf thymus (ANTEC, Tyler,
TX) using immobilized 8WG16 antibody as described by Thompson
and Burgess (1996). RNAPIIo was purified from HeLa nuclei as described by Lu et al. (1992). Transcription factor TFIIS was overexpressed in E. coli and purified as described by Yoo et al. (1991).
Purified NTPs and 29-dNTPs were obtained from Pharmacia (Piscataway, NJ) and 39-dNTPs from Boehringer Mannheim Biochemicals
(Indianapolis, IN).
Promoter-Dependent Transcription
Preinitiation complexes were formed by incubating the immobilized
DNA template (0.5 mg) with 2 ml of HeLa nuclear extract (Shapiro et
al., 1988) for 20 min at 308C in 16 ml of transcription buffer (10 mM
HEPES [pH 7.9], 33 mM KCl, 8 mM MgCl2, 0.1 mM Na2 EDTA, 1 mM
DTT, 6 %, v/v glycerol) and 1 U of Inhibitace (59-39, Boulder, CO).
Transcription was allowed to initiate for 1 min at 308C after addition
of NTPs in 4 ml of transcription buffer to give final concentrations
of 100 mM each 29dATP, CTP, and GTP and 0.5 mM [a-32P]UTP (10
mCi). The reaction was diluted with 10 vol of 0.15% sarkosyl in
BC100 buffer (20 mM Tris–HCl [pH 8.0], 100 mM KCl, 10 mM
b-mercaptoethanol, 0.2 mM Na2 EDTA, 20% v/v glycerol). The TCs
were collected by centrifugation at 2000 rpm for 2 min at 48C,
washed with 5 vol of BC100 buffer without sarkosyl, then washed
with transcription buffer containing acetylated BSA (1 mg/ml), and
suspended in the same buffer (20 ml). For pause half-life measurements, the U14 TCs were then elongated at 308C in the presence
of all 4 NTPs at 1 mM each. Samples were removed at the indicated
times and mixed with 100 ml of stop buffer (125 mM Tris–HCl [pH
8.0], 15 mM Na2 EDTA, 333 mM NaCl, 1.25% SDS, 170 mg tRNA/ml).
The samples were extracted with phenol:chloroform (1:1), ethanol
precipitated, dissolved at 908C for 1 min in formamide loading dye
(95% formamide, 15 mM Tris–HCl [pH 7.9], 5 mM EDTA, 0.1% bromphenol blue, 0.1% xylene cyanol), and separated on an 11% polyacrylamide gel (19:1) containing 8 M urea and 44 mM Tris·borate
[pH 8.3]. Gels were analyzed with a Phosphorimager (Molecular
Dynamics, Sunnyvale, CA) and quantitated as described previously
(Landick et al., 1996b).
Experimental Procedures
Template DNA
The 774 bp DNA fragment used for transcription of the wild-type
HIV-1 pause signal was amplified by PCR from plasmid pLL283
using universal M13 forward and biotinated reverse primers. pLL283
was constructed in multiple steps from plasmid pBSIIKS- (Stratagene; La Jolla, CA) by insertion of the following DNA fragments
into the HincII site (listed from the forward primer side toward the
reverse primer side of pBSIIKS2): a 220 bp ScaI–HindIII fragment
containing the promoter and early transcribed region from HIV-1; a
36 bp HindIII–SmaI fragment from the polylinker region of pUC19;
a 292 bp RsrII(blunt)–BsmI(blunt) fragment from exon 1 and intron
1 of the human c-myc gene.
Nucleotide changes in pLL283 were constructed by PCR-amplifying a DNA fragment from pLL283 using the M13 forward or reverse
primer and a second primer that specified the change and that
overlapped the unique NheI site in TAR. After digestion with NheI and
either EcoRI (forward-primer-amplified fragments) or XhoI (reverseprimer-amplified fragments), fragments were ligated between the
appropriate sites in pLL283.
The template for purified RNAPII (Figure 2) was constructed by
first introducing into pLL283 a unique BsmBI site that could produce
a 4 nt 59 staggered cut beginning at the HIV-I transcription start
site. A 20 bp synthetic DNA fragment with a 10 nt 39 overhang and
4 nt 59 overhang (59-GGGTCTCTTCTCGGTCGTCT top strand; 39accaaaaaaaCCCAGAGAAGAGCCAGCAGAccca bottom strand; duplex portion in uppercase) was then ligated to a BsmBI-digested
PCR fragment generated from the new plasmid as described above.
DNA templates were immobilized either on Dynabeads (Dynal,
Transcription with Purified Calf Thymus RNAPII
Purified RNAPII (250 ng) was preincubated with 1 mg of immobilized
tailed template (see above) for 10 min at 308C in 15 ml of RNAPII
buffer (70 mM HEPES–KOH [pH 7.9], 50 mM NH 4Cl, 6 mM MgCl2 ,
0.15 mM DTT, 5 mM spermidine, 20 %; v/v glycerol, 1 U of Inhibitace)
containing 400 mM UpG dinucleotide (Kadesch and Chamberlin,
1982; Lang et al., 1994). Transcription was allowed to initiate for 1
min at 308C by the addition of 5 ml of NTP mix in transcription buffer
to give final concentrations of 100 mM each CTP, GTP, and 0.5 mM
[a-32P]UTP (10 mCi). The TCs were washed three times with 10 vol
of RNAPII buffer, suspended in 20 ml of the same buffer, and allowed
to transcribe in the presence of all 4 NTPs (1 mM each). At the
indicated times, aliquots were removed, processed, electrophoresed, and analyzed as described above.
RNA Sequencing
RNA sequence ladders were generated by elongating the 32P-labeled
U14 TCs in the presence of all 4 NTPs (1 mM each) and a given
39dNTP (0.8 mM) at 308C for 20 min (Figure 1). After processing
of samples as described above, the RNA was separated in a 6%
polyacrylamide, 8 M urea gel next to pause and arrest RNAs.
Stepwise Transcription and 39-Proximal Transcript Labeling
U14 TCs were formed on the HIV-1 template immobilized on streptavidin-agarose beads as described above, either with [a-32P]UTP
(Figures 4 and 6) or with all nonradioactive NTPs (Figure 5). The U14
complexes were moved to position A22 by incubation with ATP,
GTP, and CTP (50 mM each) for 5 min at 308C. The complexes were
then washed four times with 10 vol of transcription buffer to remove
Pausing Modulates HIV-1 Nascent RNA Folding into TAR
1041
the unincorporated NTPs and moved stepwise along the DNA by
repeated incubation with different sets of 3 NTPs at 50 mM each
separated by washing (shown in Figure 4 with 59-proximal 32P-UMPlabeling). To label RNAs near their 39 ends (Figure 5), [a-32P]CTP
was included in the final step of the procedure or in the next to final
step (C64 TCs).
Structural Probing of the Pause RNA Structure
with Ribonuclease T1
Gel-purified C42 or C59 RNAs (10 ml each) or C59, U62(paused), or
C64 TCs (30 ml each) were incubated at 308C with RNase T1 (20
U/ml) in transcription buffer with or without 4 M urea for 10, 20, or 30 s
(see legend to Figure 5). The reaction was terminated by addition to
an equal volume of phenol:chloroform (1:1). Samples were processed, separated on a polyacrylamide (20%; 19:1)–urea (8M) gel,
and analyzed as described above.
Acknowledgments
We thank Irina Artsimovitch, Kati Geszvain, Chad Metcalf, Rachel
Mooney, Vladimir Svetlov, and Wilma Ross for helpful discussions
and comments on the manuscript. This work was supported by
grants from the National Institutes of Health (GM38660) and the
National Science Foundation (MCB9696042).
Received February 10, 1998; revised April 13, 1998.
References
Bentley, D.L. (1995). Regulation of transcriptional elongation by RNA
polymerase II. Curr. Opin. Genet. Dev. 5, 210–216.
Berkhout, B., Silverman, R.H., and Jeang, K.T. (1989). Tat transactivates the human immunodeficiency virus through a nascent RNA
target. Cell 59, 273–282.
translocation of the elongation complex on DNA. J. Biol. Chem. 268,
25604–25616.
Gu, W., Wind, M., and Reines, D. (1996). Increased accommodation
of nascent RNA in a product site on RNA polymerase II during arrest.
Proc. Natl. Acad. Sci. USA 93, 6935–6940.
Guajardo, R., and Sousa, R. (1997). A model for the mechanism of
polymerase translocation. J. Mol. Biol. 265, 8–19.
Izban, M.G., and Luse, D.S. (1991). Transcription on nucleosomal
templates by RNA polymerase II in vitro: inhibition of elongation
with enhancement of sequence-specific pausing. Genes Dev. 5,
683–696.
Jeang, K.T., and Berkhout, B. (1992). Kinetics of HIV-1 long terminal
repeat trans-activation. Use of intragenic ribozyme to assess ratelimiting steps. J. Biol. Chem. 267, 17891–17899.
Jeong, S.W., Lang, W.H., and Reeder, R.H. (1996). The yeast transcription terminator for RNA polymerase I is designed to prevent
polymerase slippage. J. Biol. Chem. 271, 16104–16110.
Jones, K.A. (1997). Taking a new TAK on Tat transactivation. Genes
Dev. 11, 2593–2599.
Jones, K.A., and Peterlin, B.M. (1994). Control of RNA initiation and
elongation at the HIV-1 promoter. Annu. Rev. Biochem. 63, 717–743.
Kadesch, T.R., and Chamberlin, M.J. (1982). Studies of in vitro transcription by calf thymus RNA polymerase II using a novel duplex
DNA template. J. Biol. Chem. 257, 5286–5295.
Kamine, J., Subramanian, T., and Chinnadurai, G. (1991). Sp1dependent activation of a synthetic promoter by human immunodeficiency virus type 1 Tat protein. Proc. Natl. Acad. Sci. USA 88,
8510–8514.
Kashlev, M., Martin, E., Polyakov, A., Severinov, K., Nikiforov, V., and
Goldfarb, A. (1993). Histidine-tagged RNA polymerase: dissection of
the transcription cycle using immobilized enzyme. Gene 130, 9–14.
Kato, H., Sumimoto, H., Pognonec, P., Chen, C.H., Rosen, C.A., and
Roeder, R.G. (1992). HIV-1 Tat acts as a processivity factor in vitro in
conjunction with cellular elongation factors. Genes Dev. 6, 655–666.
Chan, C., Wang, D., and Landick, R. (1997). Spacing from the transcript 39 end determines whether a nascent RNA hairpin interacts
with RNA polymerase to prolong pausing or triggers termination. J.
Mol. Biol. 268, 54–68.
Keen, N., Churcher, M., and Karn, J. (1997). Transfer of Tat and
release of TAR RNA during the activation of the human immunodeficiency virus type-1 transcription elongation complex. EMBO J. 16,
5260–5272.
Chan, C.L., and Landick, R. (1993). Dissection of the his leader pause
site by base substitution reveals a multipartite signal that includes
a pause RNA hairpin. J. Mol. Biol. 233, 25–42.
Kessler, M., and Mathews, M.B. (1992). Premature termination and
processing of human immunodeficiency virus type 1-promoted transcripts. J. Virol. 66, 4488–4496.
Chan, C.L., and Landick, R. (1994). New perspectives on RNA chain
elongation and termination by E. coli RNA polymerase. In Transcription: Mechanisms and Regulation, R.C. Conaway and J.W. Conaway,
eds. (New York: Raven Press), pp. 297–321.
Komissarova, N., and Kashlev, M. (1997). RNA polymerase switches
between inactivated and activated states by translocating back and
forth along the DNA and the RNA. J. Biol. Chem. 272, 15329–15338.
Churcher, M.J., Lamont, C., Hamy, F., Dingwall, C., Green, S.M.,
Lowe, A.D., Butler, JG, Gait, M.J., and Karn, J. (1993). High affinity
binding of TAR RNA by the human immunodeficiency virus type-1
tat protein requires base-pairs in the RNA stem and amino acid
residues flanking the basic region. J. Mol. Biol. 230, 90–110.
Cujec, T., Okamoto, H., Fujinaga, K., Meyer, J., Chamberlin, H.,
Morgan, D., and Peterlin, B. (1997). The HIV transactivator TAT binds
to the CDK-activating kinase and activates the phosphoyrlation of
the carboxy-terminal domain of RNA polmyerase II. Genes Dev. 11,
2645–2657.
Feng, G., Lee, D.N., Wang, D., Chan, C.L., and Landick, R. (1994).
GreA-induced transcript cleavage in transcription complexes containing Escherichia coli RNA polymerase is controlled by multiple
factors, including nascent transcript location and structure. J. Biol.
Chem. 269, 22282–22294.
Garcia-Martinez, L.F., Mavankal, G., Neveu, J.M., Lane, W.S., Ivanov,
D., and Gaynor, R.B. (1997). Purification of a Tat-associated kinase
reveals a TFIIH complex that modulates HIV-1 transcription. EMBO
J. 16, 2836–2850.
Graeble, M.A., Churcher, M.J., Lowe, A.D., Gait, M.J., and Karn, J.
(1993). Human immunodeficiency virus type 1 transactivator protein,
tat, stimulates transcriptional read-through of distal terminator sequences in vitro. Proc. Natl. Acad. Sci. USA 90, 6184–6188.
Gu, W., Powell, W., Mote, J., Jr., and Reines, D. (1993). Nascent RNA
cleavage by arrested RNA polymerase II does not require upstream
Krumm, A., Hickey, L.B., and Groudine, M. (1995). Promoter-proximal pausing of RNA polymerase II defines a general rate-limiting
step after transcription initiation. Genes Dev. 9, 559–572.
Landick, R. (1997). RNA polymerase slides home: pause and termination site recognition. Cell 88, 741–744.
Landick, R., Turnbough, C., Jr., and Yanofsky, C. (1996a). Transcription attenuation. In Escherichia coli and Salmonella: Cellular and
Molecular Biology, 2nd Edition, F. Neidhardt, R. Curtiss, III, J. Ingraham, E. Lin, K. Low, B. Magasanik, W. Reznikoff, M. Riley, M.
Schaechter, and H. Umbarger, eds. (Washington, DC: ASM Press),
pp. 1263–1286.
Landick, R., Wang, D., and Chan, C. (1996b). Quantitative analysis
of transcriptional pausing by RNA polymerase: the his leader pause
site as a paradigm. Methods Enzymol. 274, 334–352.
Lang, W.H., Morrow, B.E., Ju, Q., Warner, J.R., and Reeder, R.H.
(1994). A model for transcription termination by RNA polymerase I.
Cell 79, 527–534.
Lee, D.N., and Landick, R. (1992). Structure of RNA and DNA chains
in paused transcription complexes containing Escherichia coli RNA
polymerase. J. Mol. Biol. 228, 759–777.
Linn, S.C., and Luse, D.S. (1991). RNA polymerase II elongation
complexes paused after the synthesis of 15- or 35-base transcripts
have different structures. Mol. Cell. Biol. 11, 1508–1522.
Lu, H., Zawel, L., Fisher, L., Egly, J.M., and Reinberg, D. (1992).
Human general transcription factor IIH phosphorylates the C-terminal domain of RNA polymerase II. Nature 358, 641–645.
Molecular Cell
1042
Marciniak, R.A., Calnan, B.J., Frankel, A.D., and Sharp, P.A. (1990).
HIV-1 Tat protein trans-activates transcription in vitro. Cell 63,
791–802.
Wu, F., Garcia, J., Sigman, D., and Gaynor, R. (1991). Tat regulates
binding of the human immunodeficiency virus trans-activating region RNA loop-binding protein TRP-185. Genes Dev. 5, 2128–2140.
Mavankal, G., Ignatius Ou, S.H., Oliver, H., Sigman, D., and Gaynor,
R.B. (1996). Human immunodeficiency virus type 1 and 2 Tat proteins
specifically interact with RNA polymerase II. Proc. Natl. Acad. Sci.
USA 93, 2089–2094.
Yoo, O.J., Yoon, H.S., Baek, K.H., Jeon, C.J., Miyamoto, K., Ueno,
A., and Agarwal, K. (1991). Cloning, expression and characterization
of the human transcription elongation factor, TFIIS. Nucleic Acids
Res. 19, 1073–1079.
Nudler, E., Mustaev, A., Lukhtanov, E., and Goldfarb, E. (1997). The
RNA:DNA hybrid maintains the register of transcription by preventing backtracking of RNA polymerase. Cell 89, 33–41.
Zhu, Y., Pe’ery, T., Peng, J., Ramanathan, Y., Marshall, N., Marshall,
T., Amendt, B., Mathews, M., and Price, D. (1997). Transcription
elongation factor P-TEFb is required for HIV-1 Tat transactivation
in vitro. Genes Dev. 11, 2622–2632.
O’Brien, T., and Lis, J.T. (1991). RNA polymerase II pauses at the
59 end of the transcriptionally induced Drosophila hsp70 gene. Mol.
Cell. Biol. 11, 5285–5290.
Parada, C.A., and Roeder, R.G. (1996). Enhanced processivity of
RNA polymerase II triggered by Tat-induced phosphorylation of its
carboxy-terminal domain. Nature 384, 375–378.
Parada, C.A., Yoon, J.B., and Roeder, R.G. (1995). A novel LBP-1mediated restriction of HIV-1 transcription at the level of elongation
in vitro. J. Biol. Chem. 270, 2274–2283.
Reeder, T., and Hawley, D. (1996). Promoter proximal sequences
modulate RNA polymerase II elongation by a novel mechanism. Cell
87, 767–777.
Reines, D., Conaway, J.W., and Conaway, R.C. (1996). The RNA
polymerase II general elongation factors. Trends Biochem. Sci. 21,
351–355.
Rice, G.A., Kane, C.M., and Chamberlin, M.J. (1991). Footprinting
analysis of mammalian RNA polymerase II along its transcript as an
alternate view of transcription elongation. Proc. Natl. Acad. Sci. USA
88, 1245–1249.
Ring, B., Yarnell, W., and Roberts, J. (1996). Function of E. coli
RNA polymerase s factor s70 in promoter-proximal pausing. Cell 86,
485–493.
Ring, B.Z., and Roberts, J.W. (1994). Function of a nontranscribed
DNA strand site in transcription elongation. Cell 78, 317–324.
Rougvie, A., and Lis, J. (1990). Postinitiation transcriptional control
in Drosophila melanogaster. Mol. Cell. Biol. 10, 6041–6045.
Selby, M.J., and Peterlin, B.M. (1990). Trans-activation by HIV-1 Tat
via a heterologous RNA binding protein. Cell 62, 769–776.
Shapiro, D., Wahli, W., and Keller, M. (1988). A high-efficiency HeLa
cell nuclear transcription system. DNA 7, 47–55.
Southgate, C., Zapp, M.L., and Green, M.R. (1990). Activation of
transcription by HIV-1 Tat protein tethered to nascent RNA through
another protein. Nature 345, 640–642.
Southgate, C.D., and Green, M.R. (1991). The HIV-1 Tat protein
activates transcription from an upstream DNA-binding site: implications for Tat function. Genes Dev. 5, 2496–2507.
Sugimoto, N., Nakano, S., Katoh, M., Matsumura, A., Nakamuta, H.,
Ohmichi, T., Yoneyama, M., and Sasaki, M. (1995). Thermodynamic
parameters to predict stability of RNA/DNA hybrid duplexes. Biochemistry 34, 11211–11216.
Thompson, N.E., and Burgess, R.R. (1996). Immunoaffinity purification of RNA polymerase II and transcription factors using
polyol-responsive monoclonal antibodies. Methods Enzymol. 274,
513–526.
Tuerk, C., Gauss, P., Thermes, C., Groebe, D.R., Gayle, M., Guild,
N., Stormo, G., d’Aubenton-Carafa, Y., Uhlenbeck, O.C., Tinoco, I.J.,
Brody, E.N., and Gold, L. (1988). CUUCGG hairpins: extraordinarily
stable RNA secondary structures associated with various biochemical processes. Proc. Natl. Acad. Sci. USA 85, 1364–1368.
Valegard, K., Murray, J.B., Stockley, P.G., Stonehouse, N.J., and
Liljas, L. (1994). Crystal structure of an RNA bacteriophage coat
protein-operator complex. Nature 371, 623–626.
Wang, D., and Landick, R. (1997). A nascent RNA hairpin that stimulates transcriptional pausing interacts with RNA polymerase near
amino acid 900 of the b subunit. Proc. Natl. Acad. Sci. USA 94,
8433–8438.
Wei, P., Garber, M., Fang, S.-M., Fischer, W., and Jones, K. (1998).
A novel CDK9-associated C-type cyclin interacts directly with HIV-1
Tat and mediates in high-affinity, loop-specific binding to TAR RNA.
Cell 92, 451–462.
Zuker, M., and Stiegler, P. (1981). Optimal computer folding of large
RNA sequences using thermodynamics and auxilliary information.
Nucleic Acids Res. 9, 133–148.