This information is current as
of June 15, 2017.
IL-4 Confers NK Stimulatory Capacity to
Murine Dendritic Cells: A Signaling Pathway
Involving KARAP/DAP12-Triggering
Receptor Expressed on Myeloid Cell 2
Molecules
J Immunol 2004; 172:5957-5966; ;
doi: 10.4049/jimmunol.172.10.5957
http://www.jimmunol.org/content/172/10/5957
References
Subscription
Permissions
Email Alerts
This article cites 62 articles, 35 of which you can access for free at:
http://www.jimmunol.org/content/172/10/5957.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2004 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Magali Terme, Elena Tomasello, Koji Maruyama, Florent
Crépineau, Nathalie Chaput, Caroline Flament, Jean-Pierre
Marolleau, Eric Angevin, Erwin F. Wagner, Benoi?t
Salomon, François A. Lemonnier, Hiro Wakasugi, Marco
Colonna, Eric Vivier and Laurence Zitvogel
The Journal of Immunology
IL-4 Confers NK Stimulatory Capacity to Murine Dendritic
Cells: A Signaling Pathway Involving KARAP/
DAP12-Triggering Receptor Expressed on Myeloid
Cell 2 Molecules1
Magali Terme,* Elena Tomasello,† Koji Maruyama,* Florent Crépineau,* Nathalie Chaput,*
Caroline Flament,* Jean-Pierre Marolleau,‡ Eric Angevin,* Erwin F. Wagner,§
Benoı̂t Salomon,¶ François A. Lemonnier,储 Hiro Wakasugi,# Marco Colonna,** Eric Vivier,†
and Laurence Zitvogel2*
L
ocated at ports of entry, dendritic cells (DC)3 are unique
sentinels of the immune system, able to sense pleiotropic
danger signals and to transmit antigenic information from
the periphery to lymphoid organs (1, 2). After activation, they
migrate into T cell areas of lymph nodes, where they encounter
naive T lymphocytes and undergo final maturation for efficient
*ERM0208 Institut National de la Santé et de la Recherche Médicale, Department of
Clinical Biology, Institut Gustave Roussy, Villejuif, France; †Centre d’Immunologie
Institut National de la Santé et de la Recherche Médicale/Centre National de la Recherche Scientifique de Marseille Luminy, Marseille, France; ‡Blood Bank and Cell
Therapy Unit, Hôpital St. Louis, Paris, France; §Institute of Molecular Pathology,
University of Vienna, Vienna, Austria; ¶Centre National de la Recherche Scientifique
Unité Mixte de Recherche 7087, Hôpital de la Pitié-Salpêtrière, Paris, France; 储Unité
d’Immunologie Cellulaire Antivirale, Institut Pasteur, Paris, France; #Pharmacology
Division, National Cancer Center, Tokyo, Japan; and **Department of Pathology and
Immunology, Washington University School of Medicine, St. Louis, MO 63110
Received for publication July 31, 2003. Accepted for publication March 10, 2004.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
M.T. has received a fellowship from the Ligue Française Contre le Cancer. This work
has also been supported by the Association Recherche et Transfusion, Association pour la
Recherche sur le Cancer, Ligue Labellissee Française Contre le Cancer, and Association
française des Greffes. K.M. was supported by Institut National de la Santé et de la Recherche Médicale (Poste Vert) and Association pour la Recherche sur le Cancer.
2
Address correspondence and reprint requests to Dr. Laurence Zitvogel, ERM0208
Institut National de la Santé et de la Recherche Médicale, Department of Clinical
Biology, Institut Gustave Roussy, 39 rue Camille Desmoulins, 94805 Villejuif Cedex,
France. E-mail address: [email protected]
3
Abbreviations used in this paper: DC, dendritic cell; BM-DC, bone marrow-derived
DC; DAK, DC-activated NK cell; ITAM, immunoreceptor tyrosine-based activation
motif; MDC, macrophage-derived chemokine; MDL, myeloid DAP12-associating
lectin; RAG, recombination-activating gene; TREM, triggering receptor expressed on
myeloid cells; WT, wild type; Cyc, CyChrome; KARAP-DAP 12, killer cell-activating receptor-activating protein-DNAX-activating protein of 12 kDa.
Copyright © 2004 by The American Association of Immunologists, Inc.
priming (3, 4). DC also interact with NK and NKT cells (5–9).
First, immature DC can be recognized by IL-2-activated NK cells,
this effector process leading to either DC maturation in a TNF-␣dependent manner (10), or to DC lysis in a NKp30-dependent
manner (11). Second, DC can prime NK cell activation. Although
the DC/NK cell cross talk is silent in the absence of inflammatory
stimuli, both DC maturation and NK cell activity are promoted in
the presence of LPS, IFN-␣, or mycobacteria (10, 12, 13). Similarly, mature DC are capable of triggering resting NK cell effector
functions in vitro (14). Such DC-mediated NK cell priming resulting from the DC triggering through Toll-like or acute inflammation
cytokine receptors involves cell surface molecules not yet identified (9, 11, 14).
DC have also been found in chronic inflammatory processes
(15). Chronic inflammation often involves IL-4 produced by activated lymphocytes, eosinophils, and/or mast cells. An elevated
intragraft IL-4 production correlates with eosinophil infiltration
and CD8⫹ T cell-independent transplant arteriosclerosis (16).
Conversely, IL-4 deficiency decreases the formation of atherosclerotic lesions (17). In experimental colitis, IL-4 and IL-13 are required to sustain chronic inflammation (18). IL-4 has also been
involved in the pathogenesis of inflammatory skin diseases, including atopic dermatitis. Mice expressing transgenic IL-4 under
the control of the MHC class I regulatory sequences display reduced skin Langerhans cell emigration, increased number of mast
cells, focal deposition of collagen, and acanthosis (19). Disrupting
the IL-4 gene rescues mice homozygous for the tight skin mutation
from skin fibrosis by diminishing TGF-␤ production by
fibroblasts (20).
Interestingly, two chemokines encoded by a linked locus on
chromosome 16q13 chemokines, namely macrophage-derived
0022-1767/04/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Dendritic cells (DC) regulate NK cell functions, but the signals required for the DC-mediated NK cell activation, i.e., DC-activated
NK cell (DAK) activity, remain poorly understood. Upon acute inflammation mimicked by LPS or TNF-␣, DC undergo a maturation process allowing T and NK cell activation in vitro. Chronic inflammation is controlled in part by Th2 cytokines. In this
study, we show that IL-4 selectively confers to DC NK but not T cell stimulatory capacity. IL-4 is mandatory for mouse bone
marrow-derived DC grown in GM-CSF (DCGM/IL-4) to promote NK cell activation in the draining lymph nodes. IL-4-mediated
DAK activity depends on the KARAP/DAP12-triggering receptor expressed on myeloid cell 2 signaling pathway because: 1) gene
targeting of the adaptor molecule KARAP/DAP12, a transmembrane polypeptide with an intracytoplasmic immunoreceptor
tyrosine-based activation motif, suppresses the DCGM/IL-4 capacity to activate NK cells, and 2) IL-4-mediated DAK activity is
significantly blocked by soluble triggering receptor expressed on myeloid cell 2 Fc molecules. These data outline a novel role for
Th2 cytokines in the regulation of innate immune responses through triggering receptors expressed on myeloid cells. The Journal
of Immunology, 2004, 172: 5957–5966.
5958
IL-4-MEDIATED DC-ACTIVATED NK CELL ACTIVITY
chemokine (MDC) and thymus- and activation-regulated chemokine, are regulated by IL-4 and IL-13 (21, 22) and play a critical
role to recruit both DC and NK cells (23, 24). Adenoviral gene
transfer of MDC has been reported to mediate IL-4-dependent antitumor effects (25). IL-13 administration to SIV-infected macaques leads to monocytosis (26) and NK cell infiltration of duodenal villi with consequent apoptosis of intestinal epithelial
cells (27).
Therefore, we investigated the role of IL-4 or IL-13 in regulating DC-activated NK cell (DAK) activity. Both Th2 cytokines
confer to mouse and human DC the selective capacity to stimulate
NK cells (but not alloreactive T cells) in vitro. Moreover, IL-4
dramatically enhances the capacity of adoptively transferred DC to
activate NK cells in lymph nodes. By selectively up-regulating
transcription of triggering receptors expressed on myeloid cells
(TREM molecules), IL-4 facilitates engagement of KARAP/
DAP12 signaling pathway in DC following encountering with NK
cells, ultimately leading to NK cell activation. These data outline
a new pathway through which Th2 cytokines may shape innate
immune responses.
SCID mice or KARAP/DAP12 knock-in mice were negatively selected
using the Spin Sep kit (StemCell Technologies, Vancouver, Canada).
Materials and Methods
Assessment of NK cell effector functions
Mice
Cytotoxicity assays. Cells from 20 h of coculture were collected. Viable
trypan blue-excluded NK cells were counted and used as effector cells.
Cytotoxicity of NK cells was measured in a standard 4-h 51Cr release assay
using Na251CrO4-labeled YAC-1 targets. Experiments were conducted in
triplicate at various E:T ratios.
Cytokine detection and quantification (murine IFN-␥). After 20 h of
BM-DC/NK coculture, supernatants were harvested, stored at ⫺80°C, and
assessed either directly or after 2–10 times dilution using commercial
ELISA kits (OptEIATM ELISA kit; BD PharMingen). The sensitivity of
the murine IFN-␥ kit was ⬎31.5 pg/ml.
Procedures have been previously described (9). NK cells (splenocytes from
immunodeficient mice) were seeded at 1.5 ⫻ 105/well in 96-well plates for
20 h. DC/NK ratios of mouse cocultures were 0.5:1 (unless otherwise specified). In blocking experiments, mouse TREM2Fc or CTLA4Ig (Roche,
Milan, Italy), both containing an IgC␥1, were added at increasing dosages
in the mouse BM-DC/NK cell cocultures or to NK or DC alone (as described in Fig. 6 legend). Mouse TREM2 extracellular region was amplified by PCR from cloned TREM2 cDNA (31) using the following oligonucleotides: 5⬘-TAGTAGGAATTCGCCATGGGACCTCTCCACCAGT
TTCTCCTGC; 3⬘-TAGTAGAAGCTTATACTTACCGGAGGTGGGTGGG
AAGGAGGT.
The PCR product was digested with EcoRI and HindIII, subcloned into
a vector encoding human IgG1 Fc, and expressed as TREM2-human IgG1
fusion protein in J558L mouse myeloma cells, as previously
described (32).
Allogeneic MLR
Splenocytes were harvested from BALB/c (H-2d) mice. Splenic nonadherent cells were generated by subjecting RBC splenocytes to 3-h adherence
at 37°C. Procedures of MLR have been detailed in figure legends.
Statistical analyses of cytokine levels
Student’s t test was used to compare means ⫾ SE of IFN-␥ production in
between various culture conditions, and significant differences at 95% confidence are depicted with * on each graph.
Generation of DC in vitro
Lymph node analyses of NK cells
Bone marrow-derived DC were propagated from BM progenitor cells in
culture medium supplemented with 1000 IU/ml murine rGM-CSF (R&D
Systems, Minneapolis, MN) with or without 1000 IU/ml murine rIL-4
(R&D Systems), as previously described (30). For the induction of maturation, cultures of bone marrow-derived DC (BM-DC) were supplemented
with 2 ␮g/ml LPS (Sigma-Aldrich, St. Louis, MO) or 20 ng/ml murine
rTNF-␣ (R&D Systems) on day 6 of culture for 24 h before use. Culture
medium was renewed at days 2 and 4. Day 6 DC were harvested, spun
down, and transferred into new six-well plates. For phenotypic analyses,
cells were incubated with FITC-conjugated anti-I-Ab (AF6-120.1); PEconjugated anti-CD11c (HL-3); FITC-conjugated anti-CD86 (GL1), CD40
(3/23), and H-2Kb (AF6-885); and PE-conjugated anti-CD80 (16-10A1)
and H-2Db (KH95). All Abs were purchased from BD PharMingen (San
Diego, CA). Cells were gated according to size and granulosity with exclusion of propidium iodide-positive cells. Residual B lymphocytes
(B220⫹ cells) and granulocytes (Gr1⫹ cells) were detected in the CD11c⫺/
I-Ab⫺ cells and constitute ⬍20% of whole cell population. T and NK cells
were not propagated in these DC culture conditions. Phenotypic profiles are
shown for each individual condition in Fig. 1. BM-DC derived from genetargeted mice were analyzed for MHC class I expression and exhibited
levels of MHC class II, CD80, CD86, and CD40 expression comparable to
those of WT BM-DC and a similar allostimulatory capacity in the absence
or presence of LPS (data not shown).
Following three washing steps in PBS, one million day 7 BM-DC, grown
with various cytokine mixtures and derived from various strains of mice,
were inoculated in one footpad of BL6 nude mice. Popliteal homo- and
controlateral nodes were harvested at 24 or 72 h. Lymph node mononuclear
cells were mechanically minced. Cells were enumerated using trypan blue
exclusion before immunostaining with three-color mAb (anti-CD3 FITC,
anti-DX5 PE, anti-CD69 Cyc or anti-CD3 Cyc, anti-NK1.1 PE, anti-CD69
FITC).
Preparation of NK cells
Splenocytes were harvested from BL6-RAG2⫺/⫺ or BALB/c SCID mice,
as stated in figure legends. Splenic nonadherent cells were generated by
subjecting RBC-deprived splenocytes to 3-h adherence at 37°C. Nonadherent cells were incubated overnight with 1000 U/ml human rIL-2, and
analyzed in a FACScan cytofluorometer using anti-CD3 FITC, DX5 PE (or
NK1.1 PE in BL6 mice), and CD69 CyChrome (Cyc) mAb (or an isotype
control Ab) before coculture with BM-DC. Up to 40% of such splenocytes
were CD3⫺/DX5⫹. In some experiments, spleen-derived NK cells from
Analysis of KARAP/DAP12 and associated membrane receptors
RT-PCR studies. Total RNA was extracted from BM-DC using RNeasy
Mini kit (Life Technologies, Carlsbad, CA). One microgram of RNA was
then used to produce cDNA in a final reaction volume of 50 ␮l using
SuperScript II reverse transcriptase, according to the manufacturer’s instructions. Eventual contamination by genomic DNA was avoided by treatment with RNase-free DNase (Life Technologies). Serial dilutions of
cDNA (5, 0.5, and 0.05 ␮l) were then used to perform PCR in a final
volume of 50 ␮l. Following primers were used: myeloid DAP12-associating lectin-1 (MDL-1) forward, ATGAACTGGCACATGATCATCT;
MDL-1 reverse, ATTTGGCATTCATTTCGCAGA; TREM forward,
ATGGGACCTCTCCACCAGTTT; TREM reverse, CGGGTCCAGT
GAGGATCTGAA; KARAP forward, GCTCTGGAGCCCTCCTGGTGC;
KARAP reverse, CTCAGTCTCAGCAATGTGTTG; actin forward,
CATCCATCATGAAGTGTGACG; actin reverse, CATACTCCTGCTT
GCTGATCC. Reaction was perform with the following program: 94°C for
2 min, followed by 40 cycles of 94°C for 50 s, 56°C for 50 s, 72°C for 1
min, and finally 72°C for 7 min.
Results
DAK activity upon acute inflammation
The dynamics of the human DC/NK cell cross talk using monocyte-derived DC and peripheral blood CD3⫺/CD56⫹ purified NK
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Female C57BL/6 (H-2b) wild-type (WT) or recombination-activating gene
(RAG) 2⫺/⫺ or nude mice and female BALB/c (H-2d) WT or SCID mice
were obtained from the Center d’ Elevage Janvier (Le Genest St Isle,
France), the Center d’ Elevage Iffa Credo (L’Arbresle, France), and maintained in Institut Gustave Roussy animal facilities according to the Animal
Experimental Ethics Committee Guidelines. Double H-2Kb⫺/⫺Db⫺/⫺
knockout mice were generated, as previously described (5), bred in the
animal facility of Institut Pasteur, and used at the sixth backcross generation onto C57BL/6 mice. All female mice were used at 6 –25 wk of age.
Female 6 – 8 wk of age KARAP/DAP12 homozygous knock-in mice were
previously described (28). B7-1 and B7-2 loss-of-function mice were bred
in the Centre d’Etudes et de Recherches en Virologie et Immunologie
animal facility (29).
Preparation of DC/NK cell cocultures
The Journal of Immunology
IL-4 confers NK stimulatory capacity to DC
When cultured in the presence of IL-4 or IL-13, BM-DC exhibit
low MHC class II surface expression (Fig. 1, and data not shown)
and poor allostimulatory capacity, yet manifesting the capacity to
enhance NK cell effector functions (Fig. 3, A and B). The phenotypic comparison between BM-DCGM vs BM-DCGM/IL-4 does not
reveal major differences in the expression of MHC class I, II,
CD80, CD86, and CD40 molecules (Fig. 1) as well as in the allogeneic MLR (Fig. 3A). Although BM-DCGM barely trigger NK
cell activation in coculture at various DC:NK cell ratios, BMDCGM/IL-4 are apparently endowed with elective NK cell stimulatory capacity in vitro at a DC:NK cell ratio of 1:2 and 1:5 (Fig. 3B,
and data not shown). As previously reported (9), cell-to-cell contact was required for this effect and BM-DCGM/IL-4 were not lysed
by NK cells. Moreover, BM-DCGM/IL-4 also trigger the secretion
of IFN-␥ by NK cells (Fig. 3B, inset). IL-13 (⬎2 ng/ml) was as
potent as IL-4 (between 500 and 1000 IU/ml) to endow DC with
the capacity to activate NK cells (Fig. 3B). However, neither of
these Th2 cytokines does directly modulate NK cell functions in
the absence of DC in vitro (data not shown). Importantly, the IL4-mediated BM-DC capacity to activate NK cells was comparable
whether NK cells were syngeneic or allogeneic (Fig. 3C). A kinetic study for the introduction of IL-4 in the BM-DC culture
underscores a requirement for IL-4 in the last 4 days of in vitro
cultures (Fig. 3D).
Altogether, these data indicate that while IL-4 or IL-13 do not
promote overt DC maturation, IL-4 and IL-13 do confer a NK cell
stimulatory capacity i.e., DAK activity to mouse DC in vitro.
IL-4-propagated DC promote NK activation in vivo
To test whether IL-4 modulates DAK activity in vivo, we examined NK cell activation in the draining lymph nodes of BL6 Nu/Nu
mice inoculated with syngeneic BM-DC in the footpad at 24 and
72 h. NK cells represented ⬃5% of total lymph node mononuclear
cells in nude BL6 mice and could be stained either with anti-DX5
mAb or anti-NK1.1 mAb. The proportion of CD69⫹ cells among
gated NK1.1⫹ or DX5⫹/CD3⫺ NK cells in these nodes is shown
in Fig. 4A, and enumeration is depicted at 24 h in Fig. 4B. Absolute
numbers of homolateral popliteal lymph node resident DX5⫹/
CD3⫺ NK cells were calculated 72 h following injection of
FIGURE 1. Phenotypic analyses of ex vivo propagated BM-DC. BM-DC propagated either in GM-CSF alone or a combination of GM-CSF ⫹ IL-4 for
7 days were analyzed in flow cytometry. BM-DC propagated in GM-CSF alone were subjected to 24-h stimulation at day 6 with either TNF-␣ or LPS. A
two-color staining (anti-CD11c PE and anti-I-Ab FITC mAb) or one-color staining (anti-CD40, anti-CD86, anti-H-2Kb FITC mAb, anti-CD80, anti-H-2Db
PE mAb) was performed at day 7 before analysis. Hatched lines represent staining with a control isotype-matched mAb.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
cells have been reported recently (12–14). In resting conditions,
when immature DC encounter resting NK cells, NK cell effector
functions remain inert. In contrast, in the presence of inflammatory
stimuli such as LPS, DC readily promote NK cell activation (12).
Similarly, resting NK cells encountering mature DC become activated (14). We investigated the dynamics of the mouse BMDC/NK cell interaction using DC stimulated with the acute inflammatory cytokine TNF-␣ or the microbial product LPS. The
vast majority of day 7 BM-DC propagated in GM-CSF alone (BMDCGM) express low levels of MHC class II (I-Ab), MHC class I
(Kb, Db), and costimulatory CD86, CD40 molecules (Fig. 1) compared with their counterparts stimulated with TNF-␣ or LPS. Indeed, BM-DCGM/TNF and BM-DCGM/LPS homogeneously display
a mature phenotype with surface expression of MHC class II
molecules (Fig. 1) and a strong allostimulatory capacity (Fig.
2A). In contrast to BM-DCGM, such mature BM-DC enhanced
NK cell lytic activity against YAC-1 cells (Fig. 2B) and IFN-␥
secretion (inset, Fig. 2B). At various DC/NK cell ratios, BMDCGM remain poorly effective. We conclude from these experiments that mouse DC, like human DC, become potent T/NK
cell stimulators when exposed to danger signals such as LPS or
TNF-␣.
5959
5960
IL-4-MEDIATED DC-ACTIVATED NK CELL ACTIVITY
IL-4-mediated DAK activity does not involve B7 or MHC class I
molecules
KARAP/DAP12-TREM2 is involved in the IL-4-mediated DAK
activity
FIGURE 2. Activated BM-DC promote both T and NK cell stimulation.
A, Day 6 H-2b BM-DC incubated for 24 h in GM-CSF alone or a combination of GM-CSF ⫹ LPS, or GM-CSF ⫹ TNF-␣ were used to stimulate
the proliferation of 105 allogeneic H-2d splenocytes for 5 days at various
DC:T ratios in an MLR assay. Incorporation of [3H]TdR is measured at day
6. The DC:T ratio of 1:25 is shown. Means of proliferation counts with SE
of triplicate wells are depicted. B, 51Cr release cytolysis assay against
YAC-1 target cells of cocultures containing BM-DC and BALB/c SCIDderived NK cells at a 1 NK:0.5 DC ratio for 20 h. In the inset are depicted
the levels of IFN-␥ secretion (measured in ELISA) of NK cells alone or
cocultured in the presence of BM-DC. A typical experiment is shown of
three performed and resulting in similar data.
BM-DC in the homolateral footpad and compared with those residing in controlateral popliteal nodes. Although BM-DCGM neither activated (Fig. 4, A and B) nor recruited (Fig. 4C) resident
DX5⫹/CD3⫺ cells, BM-DCGM/IL-4 significantly promoted NK cell
recruitment and/or proliferation in situ (63,140 ⫾ 7,153 NK cells
in homolateral vs 47,470 ⫾ 7,365 on controlateral node, p ⫽
0.006) at 72 h as well as activation of a subset of resident NK cells
(10,650 ⫾ 1,364 CD69⫹ NK cells in homolateral vs 5,958 ⫾ 933
on controlateral node, p ⫽ 0.002) at 24 h. Similarly, splenic NK
cell activation was achieved using i.v. injection of BM-DCGM/IL-4,
but not BM-DCGM (data not shown).
In conclusion, adoptively transferred DC propagated in IL-4 are
capable of eliciting NK cell activation in lymph nodes.
Knock-in mice bearing a nonfunctional KARAP/DAP12 immunoreceptor tyrosine-based activation motif (ITAM) exhibit altered
innate immune responses associated with an accumulation of DC
in cutaneous and mucosal epithelia, suggesting that KARAP/
DAP12 acts as an endogenous modulator of DC functions (28, 36).
We therefore investigated the role of this transmembrane protein in
the DAK activity mediated by BM-DCGM/IL-4. Homozygous
KARAP/DAP12 loss-of-function mutant BM-DCGM/IL-4 were
cocultured with WT NK cells. Homozygous knock-in DC completely failed to activate NK cells at the level of cytolytic activity
and IFN-␥ secretion (Fig. 5C). Interestingly, KARAP/DAP12
knock-in NK cells do respond to WT BM-DC (Fig. 5D), strengthening that BM-DC and not NK cells require KARAP-DAP12 signaling. We next addressed the possibility that IL-4 might up-regulate the mRNA expression of KARAP/DAP12 adaptor and/or its
membrane-associated receptors expressed on DC, i.e., triggering
receptors expressed on myeloid cells (32, 37) and the myeloid
DAP12-associated lectin-1 (38). Although KARAP/DAP12
mRNA or protein expression levels were not modulated by incubation of BM-DC with IL-4, TREM, but not MDL-1 cDNA were
significantly more transcribed in BM-DCGM/IL-4 as compared with
BM-DCGM (Fig. 6A). TREM mRNA levels were also augmented
in KARAP/DAP12 knock-in DC (data not shown). Bouchon et al.
(31) reported a strong down-regulation of MDL-1 and TREM-1
during monocyte differentiation toward the dendritic lineage in the
presence of IL-4 associated with a concomitant up-regulation of
TREM2. TREM2 is a member of the Ig superfamily characterized
by a single V-type extracellular domain, a transmembrane region
with a charged residue of lysine, and a short cytoplasmic tail with
no signaling motifs. TREM2 is associated with KARAP/DAP12 in
human monocyte-derived DC (32). To further demonstrate that
TREM2 is involved in the IL-4-mediated DAK activity, soluble
mouse TREM2Fc molecules were used to block the BM-DCGM/IL-4mediated NK cell activation in vitro. Indeed, while CTLA4Ig had
no effect, confirming the results achieved with B7 loss-of-function
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Because CD28 is expressed on resting NK cells and has been
claimed to be costimulatory for NK cell activation (33, 34), we
investigated the role of B7-1 and B7-2 in BM-DCGM/IL-4-mediated
NK cell activation in vivo and in vitro. B7 loss-of-function BMDCGM/IL-4 remain fully competent to recruit and activate a subset
of DX5⫹/CD3⫺ NK cells in the draining lymph node of Nu/Nu
mice (Fig. 4D). Such B7-deficient BM-DCGM/IL-4 also maintain
their capacity to activate NK cells in vitro, as determined by
YAC-1 killing and IFN-␥ secretion (Fig. 5A). NK cell activation
results from a balance between inhibitory and activating signaling
regulated by specific ligands (35). Abrogation of inhibitory signals
could account for the BM-DCGM/IL-4-mediated NK cell activation.
However, the surface expression of MHC class I molecules, i.e.,
H-2Db and H-2Kb, is not down-modulated on DC propagated in
the presence of IL-4 (Fig. 1). Moreover, we performed DC/NK cell
cocultures using H-2Db⫺/⫺Kb⫺/⫺ double-knockout BM-DC propagated in GM-CSF ⫹ IL-4 in H-2-matched model systems. The
loss of inhibitory ligands significantly augmented the capacity of
DCGM/IL-4 to promote NK cell effector functions, i.e., cytolysis
against YAC-1 (Fig. 5B) and IFN-␥ secretion (Fig. 5B, inset).
Thus, a down-regulation of the inhibitory pathway is unlikely to
account for the IL-4-mediated DAK activity.
The Journal of Immunology
5961
DC, soluble TREM2Fc molecules significantly abrogated BMDCGM/IL-4-mediated NK cell lytic activity against YAC-1 cells
(Fig. 6, B and C). However, soluble TREM2Fc molecules were
not sufficient to directly trigger NK cell lytic activity in vitro
(Fig. 6B), even when TREM2Fc molecules were coated on
Maxisorb wells to allow cross-linking of NK cell counterreceptors. Interestingly, incubation of NK cells with IL-2 and
TREM2Fc in the absence of BM-DC could trigger NK cell
IFN-␥ production, while neither agent alone could trigger it,
and while CTLA4Ig could not, emphasizing that TREM2 molecules do interact with counterreceptors on mouse NK cells
(data not shown). However, we ruled out a role for IL-2
secreted by BM-DCGM/IL-4 in the IL-4-mediated DAK activity
(data not shown). Therefore, one possibility suggested by these
results is that NK cell binding to DC TREM2 molecules: 1)
triggers TREM2/KARAP signaling in DC, 2) promotes
KARAP/DAP12-dependent up-regulation of a membrane sur-
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 3. Th2 cytokines confer to
DC elective NK cell stimulatory capacity
in vitro. A, Similar experimental setting as
in Fig. 2A, but using two groups of
BM-DC cultures (propagated in GM-CSF
or in GM-CSF ⫹ IL-4). B, Similar experimental setting as in Fig. 2B, but using
two groups of BM-DC cultures (GM-CSF
vs GM-CSF ⫹ IL-4 or IL-13). In the inset
are depicted the levels of IFN-␥ secretion
(measured in ELISA) of NK cells alone or
cocultured in the presence of BM-DCGM
vs DCGM/IL-4 or DCGM/IL-13. C, Similar
experimental setting as in B, but using two
types of NK cells: BALB/c SCID- or BL6
RAG2⫺/⫺-derived NK cells. Similar data
were achieved using syngeneic or allogeneic NK cells. D, Kinetic study of IL-4
introduction in BM-DC differentiation. Instead of being introduced from day 0 onto
day 7, IL-4 is introduced from day 4 to
day 7 (D4) or from day 5 to day 7 (D5) or
from day 6 to day 7 (D6). IFN-␥ secretion
levels accumulated over 20 h are measured in ELISA, and means ⫾ SE of triplicate wells are presented. Each depicted
experiment has been reproduced twice
with similar data.
face molecule that will engage activating receptors on NK cells,
3) thereby counterbalancing DC MHC class I inhibition of NK
cells. To exemplify that NK cell binding to DC TREM2
molecules signals through KARAP/DAP12 pathway, we investigated the levels of I-Ab and costimulatory molecules expressed on CD11c⫹ BM-DC WT vs KARAP/DAP12⫺/⫺ following incubation with negatively selected NK cells from
BALB/c SCID mice. Although I-Ab and CD40 did not significantly translocate to cell surface in WT nor in KARAP-DAP12
knock-in BM-DC following contact with NK cells, CD80 molecules were up-regulated, with no significant difference between
WT and KARAP/DAP12 knock-in BM-DC (Table I). However,
and in accordance with the reported TREM2 signaling in human
MD-DC (32), CD86 was significantly up-regulated in WT BM-DC
encountering WT NK cells, but not in KARAP knock-in BM-DC,
suggesting that an alternate pathway of activation via KARAP/
DAP12 ITAM signaling in DC is triggered.
5962
IL-4-MEDIATED DC-ACTIVATED NK CELL ACTIVITY
Discussion
Our data point to a critical role of IL-4 in regulating: 1) NK cell
recruitment or in situ proliferation and activation through DC in
lymph nodes; 2) DAK activity through KARAP-dependent triggering receptors expressed on myeloid cells.
The effects of IL-4 on DC functions have been mostly studied in
vitro. In contrast to GM-CSF, which plays a primary role in precursor
survival, proliferation, and early differentiation, IL-4 promotes the final differentiation of DC. IL-4 has been reported to induce the loss of
macrophage features, increase MHC expression, up-regulate costimulatory and DC-SIGN molecules, enhance Ag uptake and processing,
and synergize with other factors to increase IL-12 production (39 –
43). However, when added to DC precursors differentiated from
CD34⫹ progenitors, IL-4 delays maturation of Langerhans cells and
reduces the allostimulatory function of DC (44, 45). We confirmed
these findings and showed that mouse BM-DCGM/IL4 behave like
BM-DCGM in the sense that they acquired a fully mature phenotype
only after LPS stimulation (M. Terme, data not shown). Similarly,
addition of human rIL-4 to CD34⫹ human DC progenitors incubated
for 5 days in stem cell factor, GM-CSF, and TNF-␣ did not enhance
their allostimulatory capacities, but significantly promoted the lytic
activity against K562 of CD3⫺/CD56⫹ NK cells purified from
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 4. DC differentiated in the presence of IL-4 activate and recruit NK cells in vivo. A, BM-DCGM or BM-DCGM/IL-4 were injected in the footpad
of BL6 nude mice and 24 –72 h later, NK resident popliteal lymph node (LN) was examined in flow cytometry using three-color staining (CD3 FITC, DX5
PE, CD69 Cyc, or its isotype control Ab) in the homo- and contralateral lymph nodes. B, At 24 h: enumeration of lymph node mononuclear cells and of
CD3⫺/NK1.1⫹/CD69⫹ NK cells. C, At 72 h: enumeration of lymph node mononuclear cells and of CD3⫺/DX5⫹ resident NK cells. D, Similar experimental
setting as in A, but using B7 loss-of-function BM-DC. For A and D, one representative animal is depicted of 12–15 mice of 5 pooled experiments. For B
and C, each dot represents the number of NK cells in the homo- or contralateral lymph node of each single mouse, and data pooled from 5 experiments
are shown. Similar data were achieved using anti-DX5 or anti-NK1.1 mAb in the BL6 background. Significant differences at 95% confidence using
Student’s t test are outlined with ⴱ.
The Journal of Immunology
5963
normal volunteers (C. Flament, data not shown). IL-4 facilitates
NK cell stimulation at the level of DC precursors and not at that of
differentiated DC, because addition of IL-4 the last 24 h of a day
6 BM-DC culture did not empower DC for NK cell stimulation
(Fig. 3D). It is also conceivable that IL-4R␣ could be expressed at
various kinetics during in vitro bone marrow cultures in GM-CSF
⫹ IL-4, rendering DC precursors optimal for the responsiveness to
IL-4. Interestingly, Roth et al. (46, 47) reported increased DC
numbers and functions in both mice and cancer patients following
continuous administration of GM-CSF and IL-4. As compared
with GM-CSF alone, the combination of GM-CSF plus IL-4
promoted antitumor effects associated with signs of DC differentiation. Despite these changes, freshly isolated DC from GM or
GM/IL-4 groups exhibited a functionally immature phenotype in
MLRs. Moreover, earlier studies reported that a mixture of tumor
cell lines secreting rGM-CSF ⫹ rIL-4 generated more effective
antitumor responses than did the same number of tumor cells
secreting only rGM-CSF (48, 49). Although NK cell functions
were not assessed in these reports, it is likely that the enhanced
antitumor effects observed in the elective presence of IL-4 be
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 5. Molecular mechanisms underlying IL-4-mediated DAK activity in vitro.
A–C, Similar experimental setting as in Fig.
2B, using GM-CSF ⫹ IL-4-propagated BL6
BM-DC and comparing WT BM-DC vs B7
(A), H-2KbDb (B), or KARAP/DAP12 (C)
loss-of-function BM-DC. BL6 RAG2⫺/⫺- or
BALB/c SCID-derived NK cells were used
with similar results. IFN-␥ secretions were
measured in ELISA, and means ⫹ SE of triplicate wells are presented in the insets of each
panel. Results of a representative experiment
of three are shown. D, Similar experimental
setting as in Fig. 3B, but using negatively
selected KARAP/DAP12⫺/⫺ NK cells.
mediated through NK cells. Indeed, enhanced antitumor CTL
responses were reported following NK cell-mediated tumor regression (50). IL-4 does not directly trigger NK cell activation, as
indicated by the fact that addition of IL-4 to human or mouse NK
cells (in the absence of DC) fails to enhance NK cell functions (our
data not shown). According to published reports, IL-4 negatively
regulates adhesion and transendothelial migration of activated NK
cells (51). Our findings unravel a novel regulatory role of IL-4 on
DC, conferring to DC NK cell stimulatory capacity in vitro and
in vivo.
The DC/NK cell interaction has been formally described in the
setting of acute inflammation mimicked by TNF-␣, IFN-␣, LPS,
and Mycobacterium tuberculosis (12, 14). However, numerous
clinical acute inflammatory settings such as asthma, autoimmune skin
or bowel diseases, and arteriosclerosis convert into chronic inflammatory disorders. Th2 cytokines have been found in such chronic
inflammatory lesions, and their role in the pathogenesis has been documented. Limited studies have investigated the role of infiltrating NK
cells in chronic inflammatory processes. Chronic inflammatory diseases of the lungs, such as asthma, are frequently associated with
5964
IL-4-MEDIATED DC-ACTIVATED NK CELL ACTIVITY
mixed Th1 and Th2 T cell responses. Trying to recapitulate the disease, Ford et al. (52) have coinstilled IL-13 along with IFN-␥ into
mouse airways. IFN-␥ and IL-13 synergized to provoke recruitment
of NK cells and CD11c⫹/MHC class II⫹/CD86⫹ APCs, resulting in
goblet cell hyperplasia, airway eosinophilia, and hyperreactivity. Evidence for enhanced NK cell activity after bronchial allergen challenge in asthmatic subjects was brought up (53) and later on, Korsgren
et al. (54) demonstrated the role of NK cells during the immunization
phase of allergen-induced eosinophilic airway inflammation in mice.
Our data point to a role for Th2 cytokines in providing NK cellderived local IFN-␥ production that might enhance ongoing Th1 inflammatory processes.
The role of the IL-4-mediated DAK activity in the Th2 differentiation pathway remains to be clarified. IL-4-treated DC were
shown to enhance IL-4 production in a paracrine/autocrine positive
feedback loop (55). MacDonald and Pearce (56) recently reported
that Th2 polarization following adoptively transferred IL-4-producing DC only depends on IL-4 production by recipient cells.
These data suggest a role for IL-4-producing DC at the site of Ag
encounter rather than during DC/T cell interaction. The source of
the recipient-derived IL-4 remains unknown, but it is conceivable
that the DC/NK cell cross talk could result in the secretion of
recipient NK cell-derived regulatory cytokines such as IL-5, IL-13,
or IFN-␥ (57–59).
Table I. WT, but not KARAP/DAP12⫺/⫺ BM-DC up-regulate CD86 molecules in coculture with WT NK cellsa
BM-DC KARAP-DAP12⫺/⫺
BM-DC WT
CD86
CD80
CD40
I-Ab
%
MFIb
%
MFI
%
MFI
%
MFI
0
⫹NK
0
⫹NK
82 ⫾ 2
677 ⫾ 94
62 ⫾ 7
107 ⫾ 53
56 ⫾ 8
76 ⫾ 16
87 ⫾ 2
169 ⫾ 24
87 ⫾ 2
821 ⫾ 102*
80 ⫾ 9
156 ⫾ 73
60 ⫾ 2
77 ⫾ 18
87 ⫾ 1
168 ⫾ 27
74 ⫾ 3
605 ⫾ 74
48 ⫾ 12
132 ⫾ 64
45 ⫾ 5
66 ⫾ 15
81 ⫾ 3
139 ⫾ 13
75 ⫾ 3
655 ⫾ 74
71 ⫾ 10
167 ⫾ 86
58 ⫾ 2
72 ⫾ 12
83 ⫾ 3
152 ⫾ 22
a
Spleen-derived NK cells of SCID mice were negatively selected using the Spin Sep kit (StemCell Technologies), then stimulated overnight in 1000
IU/ml IL-2 and incubated (or not) with BM-DC (GM/IL-4) WT vs KARAP-DAP12 knockin for 24 h at a ratio of 1 DC to 2 NK cells. After coculture
or incubation alone, FACS analyses gating on CD11c⫹ cells were performed using anti-I-Ab, CD40, CD80, and CD86 mAb. Mean ⫾ SD of three
independent experiments are shown for each individual molecular pattern, Student’s t test was used to compare expression of molecules on BM-DC alone
vs BM-DC after coculture with NK cells. *p ⬍ 0.05.
b
MFI, mean fluorescence intensity.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 6. The role of TREM2 molecules in IL-4-mediated DAK activity. 〈, RT-PCR of BM-DC cultured in GM-CSF or both GM-CSF ⫹ IL-4 were
performed using primers specific for KARAP, TREM, MDL-1, and actin. For each condition, serial dilutions of cDNA (5 ␮g (left lane), 0.5 ␮g (middle
lane), and 0.05 ␮g (right lane)) were then used to perform PCR in a final volume of 50 ␮l. B, Similar setting as in Fig. 2B, but adding 20 ␮g/ml soluble
mouse TREM2Fc or CTLA4Ig molecules on NK cells or on DC/NK cell cocultures. C, Similar setting as in Fig. 2B, but adding increasing dosages of
soluble TREM2Fc (5 ␮g/ml, 20 ␮g/ml).
The Journal of Immunology
Acknowledgments
We are indebted to A. Moretta and A. Caignard for critical reading of the
manuscript.
References
1. Inaba, K., and R. M. Steinman. 1985. Protein-specific helper T lymphocyte formation initiated by dendritic cells. Science 229:475.
2. Reis e Sousa, C. 2001. Dendritic cells as sensors of infection. Immunity 14:495.
3. Banchereau J., F. Briere, C. Caux, J. Davoust, S. Lebecque, Y. J. Liu,
B. Pulendran, and K. Palucka. 2000. Immunobiology of dendritic cells. Annu.
Rev. Immunol. 18:767.
4. Schüler, G., and R. M. Steinman. 1985. Murine epidermal Langerhans cells mature into potent immunostimulatory dendritic cells in vitro. J. Exp. Med. 161:526.
5. Ikarashi, Y., R. Mikami, A. Bendelac, M. Terme, N. Chaput, M. Terada, T. Tursz,
E. Angevin, F. A. Lemonnier, H. Wakasugi, and L. Zitvogel. 2001. Dendritic cell
maturation overrules H-2D-mediated NKT cell inhibition: a critical role of B7 in
CD1d-dependent NKT cell Th1 polarization. J. Exp. Med. 194:1179.
6. Yu, Y., M. Hagihara, K. Ando, B. Gansuvd, H. Matsuzawa, T. Tsuchiya,
Y. Ueda, H. Inoue, T. Hotta, and S. Kato. 2001. Enhancement of human cord
blood CD34⫹ cell derived NK cell cytotoxicity by DC. J. Immunol. 166:1590.
7. Nishioka, Y., N. Nishimura, Y. Suzuki, and S. Sone. 2001. Human monocytederived and CD83⫹ blood DC enhance NK cell mediated cytotoxicity. Eur. J. Immunol. 31:2633.
8. Bandyopadhyay, S., S. Perussia, G. Trinchieri, D. S. Miller, and S. E. Starr. 1986.
Requirement for HLA-DR⫹ accessory cells in natural killing of cytomegalovirusinfected fibroblasts. J. Exp. Med. 164:180.
9. Fernandez, N. C., A. Lozier, C. Flament, P. Ricciardi-Castagnoli, D. Bellet,
M. Suter, M. Perricaudet, T. Tursz, E. Maraskovsky, and L. Zitvogel. 1999.
Dendritic cells directly trigger NK cell functions: a cross-talk relevant in innate
antitumor immune responses in vivo. Nat. Med. 5:405.
10. Piccioli, D., S. Sbran, E. Melandri, and N. M. Valiante. 2002. Contact-dependent
stimulation and inhibition of dendritic cells by natural killer cells. J. Exp. Med.
195:335.
11. Ferlazzo, G., M. L. Tsang, L. Moretta, G. Melioli, R. M. Steinman, and C. Munz.
2002. Human dendritic cells activate resting natural killer cells and are recognized via the NKp30 receptor by activated NK cells. J. Exp. Med. 195:343.
12. Gerosa, F., B. Baldani-Guerra, C. Nisii, V. Marchesini, G. Carra, and
G. Trinchieri. 2002. Reciprocal activating interaction between natural killer cells
and dendritic cells. J. Exp. Med. 195:327.
13. Zitvogel, L. 2002. Dendritic and natural killer cells cooperate in the control/
switch of innate immunity. J. Exp. Med. 195:F9.
14. Fernandez, N. C., C. Flament, F. Crepineau, E. Angevin, E. Vivier, and
L. Zitvogel. 2002. Dendritic cells promote natural killer cell functions: dynamics
of the human DC/NK cell cross talk. Eur. Cytokine Network 13:17.
15. Katou F., H. Ohtani H., T. Nakayama, H. Nagura, O. Yoshie, and K. Motegi.
2003. Differential expression of CCL19 by DC-Lamp⫹ mature DC in human
lymph node versus chronically inflamed skin. J. Pathol. 199:98.
16. Ensminger, S. M., B. M. Spriewald, H. V. Sorensen, O. Witzke, E. G. Flashman,
A. Bushell, P. J. Morris, M. L. Rose, A. Rahemtulla, and K. J. Wood. 2001.
Critical role for IL-4 in the development of transplant arteriosclerosis in the
absence of CD40-CD154 costimulation. J. Immunol. 167:532.
17. King, V. L., S. J. Szilvassy, and A. Daugherty. 2002. Interleukin-4 deficiency
decreases atherosclerotic lesion formation in a site-specific manner in female
LDL receptor⫺/⫺ mice. Arterioscler. Thromb. Vasc. Biol. 22:456.
18. Spencer, D. M., G. M. Veldman, S. Banerjee, J. Willis, and A. D. Levine. 2002.
Distinct inflammatory mechanisms mediate early versus late colitis in mice. Gastroenterology 122:94.
19. Elbe-Burger, A., A. Egyed, S. Olt, R. Klubal, U. Mann, K. Rappersberger,
A. Rot, and G. Stingl. 2002. Overexpression of IL-4 alters the homeostasis in the
skin. J. Invest. Dermatol. 118:767.
20. Kodera, T., T. L. McGaha, R. Phelps, W. E. Paul, and C. A. Bona. 2002. Disrupting the IL-4 gene rescues mice homozygous for the tight-skin mutation from
embryonic death and diminishes TGF-␤ production by fibroblasts. Proc. Natl.
Acad. Sci. USA 99:3800.
21. Mantovani, A., P. A. Gray, J. Van Damme, and S. Sozzani. 2000. Macrophagederived chemokine (MDC). J. Leukocyte Biol. 68:400.
22. Greaves, D. R., T. Hakkinen, A. D. Lucas, K. Liddiard, E. Jones, C. M. Quinn,
J. Senaratne, F. R. Green, K. Tyson, J. Boyle, et al. 2001. Linked chromosome
16q13 chemokines, macrophage-derived chemokine, fractalkine, and thymusand activation-regulated chemokine, are expressed in human atherosclerotic lesions. Arteriosler. Thromb. Vasc. Biol. 21:923.
23. Godiska, R., D. Chantry, C. J. Raport, S. Sozzani, P. Allavena, D. Leviten,
A. Mantovani, and P. W. Gray. 1997. Human macrophage-derived chemokine
(MDC) a novel chemoattractant for monocytes, monocyte-derived dendritic cells
and natural killer cells. J. Exp. Med. 185:1595.
24. Inngjerdingen, M., B. Damaj, and A. A. Maghazachi. 2000. Human NK cells
express CC chemokine receptors 4 and 8 and respond to thymus and activationregulated chemokine, and I-309. J. Immunol. 164:4048.
25. Guo, J., B. Wang, M. Zhang, T. Chen, Y. Yu, E. Regulier, H. E. Homann, Z. Qin,
D. W. Ju, and X. Cao. 2002. Macrophage-derived chemokine gene transfer results
in tumor regression murine lung carcinoma model through efficient induction of
antitumor immunity. Gene Ther. 71:941.
26. Lai, Y. H., J. M. Heslan, S. Poppema, J. F. Elliot, and T. R. Mosmann. 1996.
Continuous administration of IL-13 to mice induces extramedullary hemopoiesis
and monocytosis. J. Immunol. 156:3166.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
We showed that DC differentiated in IL-4 are able to recruit or
enhance in situ proliferation and activation of NK cells in the
draining lymph nodes following s.c. injection. This is the first observation demonstrating NK cell recruitment or in situ NK cell
proliferation driven by DC in secondary lymphoid organs. It is
tempting to speculate that NK cells are recruited from peripheral
blood through high endothelial venules and that MDC or thymusand activation-regulated chemokine might be key Th2 chemokines
(21, 60) to account for NK cell attraction. It is also conceivable
that peripheral DC might secrete such chemokines that might leak
to lymph nodes and chemoattract NK cells from the circulating
blood. Therefore, the BM-DCGM/IL-4/NK cell cross talk could be
considered in the design of CTL peptide-based cancer vaccines.
However, whether the DC/NK cell cross talk is critical to promote
the Ag-specific cognate T cell responses mediated by DC remains
to be determined.
Our data show that KARAP/DAP12 are critical ITAM-bearing
activating receptors involved in the DC capacitation to trigger NK
cells in vitro. KARAP/DAP12 has been shown to be involved at
the level of Ag presentation for T cell activation during the development of experimental autoimmmune encephalomyelitis Th1 experimental model (36), and for hapten sensitization (28). KARAP/
DAP12 has also been involved in NK cell-dependent protection
against murine CMV replication (61). The relevance of the DC/NK
cell cross talk in mediating murine CMV eradication has been
recently reported (62). Indeed, the authors showed that DC promote NK cell proliferation in a cytokine-dependent manner, while
DAP12-dependent Ly-49H NK cells appear to mediate DC survival through cell-to-cell contact. We showed in Fig. 5D that
KARAP/DAP12 knockin NK can be activated for IFN-␥ secretion
following contact with WT BM-DC, suggesting that KARAP/
DAP12 is not required for the NK cell ability to respond to DC.
We showed in Fig. 5C and Table I that KARAP/DAP12 is a
critical pathway at the DC level for DAK activity. These conclusions hold only when IL-4 mediates DAK activity, because we
were not able to show that KARAP/DAP12 was critical in the
DAK activity mediated through acute inflammatory signals (i.e.,
LPS; M. Terme and E. Tomasello, unpublished data). Importantly,
IL-4 up-regulates KARAP/DAP12-associated TREM mRNA levels in BM-DC, and soluble TREM2Fc molecules abrogate IL-4mediated DAK activity. KARAP/DAP12-TREM2 triggering on
human DC promotes incomplete maturation process, i.e., DC upregulation of CCR7, CD40, CD86, and MHC class II molecules,
but not TNF-␣ nor IL-12 production (32). Accordingly, in our
experimental mouse setting, whereby DC are triggered through
TREM2 molecules by counterreceptors of unknown origin on NK
cells, we did not observe TNF-␣ nor IL-12 production by DC in
the cocultures (our data not shown). However, we did observe a
significant KARAP-dependent up-regulation of CD86. We ruled
out the role for B7 molecules (Figs. 4D and 5A) and CD40 molecules (data not shown) in the DAK activity mediated by IL-4 in
vitro. Lymphocyte activation gene 3, an alternate ligand for MHC
class II, has been ruled out as a specific mode of natural killing
(63).
Our preliminary data using TREM2Fc molecules for NK cell
cross-linking showed that IL-2 was required to trigger NK cell
IFN-␥ production in the absence of DC. Therefore, because BMDCGM/IL4 do not produce IL-2, the hypothesis is that NK cells
might allow signal transduction in DC through KARAP/DAP12,
thereby triggering surface expression of an alternate activating ligand for NK cell receptors. In this setting, IL-4 would contribute
to DC recognition by NK cells through a TREM2/KARAP/DAP12
signaling pathway.
5965
5966
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
CD34⫹ cell-derived CD1a⫹CD14⫺ and CD1a⫺CD14⫹ dendritic cell precursors.
J. Leukocyte Biol. 64:235.
Basak, S. K., A. Harui, M. Stolina, S. Sharma, K. Mitani, S. M. Dubinett, and
M. D. Roth. 2002. Increased dendritic cell number following continuous in vivo
infusion of granulocyte macrophage-colony-stimulating factor and interleukin-4.
Blood 99:2869.
Roth, M. D., B. J. Gitlitz, S. M. Kiertscher, A. N. Park, M. Mendenhall,
N. Moldawer, and R. A. Figlin. 2000. Granulocyte macrophage colony-stimulating factor and interleukin 4 enhance the number and antigen-presenting activity
of circulating CD14⫹ and CD83⫹ cells in cancer patients. Cancer Res. 60:1934.
Gunji, Y., M. Tagawa, H. Matsubara, K. Takenaga, H. Shimada, F. Kondo,
T. Suzuki, K. Nakajima, M. Sugaya, T. Asano, et al. 1997. Antitumor effect of
murine colon carcinoma cells retrovirally transduced with interleukin-4 and granulocyte macrophage-colony stimulating factor. Oncology 54:69.
Tasaki, K., Y. Gunji, H. Matsubara, K. Takenaga, T. Suzuki, T. Asano, T. Ochiai,
K. Isono, T. Kouzu, S. Sakiyama, and M. Tagawa. 1998. Induction of T cell
dependent acquired immunity in syngeneic mice by the combined expression of
interleukin-4 and granulocyte macrophage-colony stimulating factor gene in murine carcinoma cells. Anticancer Res. 18:1453.
Smyth, M. J., D. I. Godfrey, and J. A. Trapani. 2001. A fresh look at tumor
immunosurveillance and immunotherapy. Nat. Immunol. 2:293.
Allavena, P., G. Bianchi, C. Paganin, G. Giardina, and A. Mantovani. 1996.
Regulation of adhesion and transendothelial migration of natural killer cells. Nat.
Immun. 15:107.
Ford, J. G., D. Rennick, D. D. Donaldson, R. Venkayya, C. McArthur, E. Hansell,
V. P. Kurup, M. Warnock, and G. Grunig. 2001. IL-13 and IFN-␥: interactions
in lung inflammation. J. Immunol. 167:1769.
Vesterinen, E., and T. Timonen. 1988. Natural killer cell activity in specific and
non-specific bronch challenge. Ann. Allergy 60:247.
Korsgren, M., C. G. Persson, F. Sundler, T. Bjerke, T. Hansson, B. J. Chambers,
S. Hong, L. Van Kaer, H. G. Ljunggren, and O. Korsgren. 1999. Natural killer
cells determine development of allergen-induced eosinophilic airway inflammation in mice. J. Exp. Med. 189:553.
Knight, S. C., and P. A. Bedford. 2001. Dendritic cell/dendritic cell interaction.
In Dendritic Cells: Biology and Clinical Application, 2nd Ed.
M. T. Lotze and A. W. Thomson, eds. Academic Press, New York.
MacDonald, A. S., and E. Pearce. 2002. Cutting edge: polarized Th cell response
induction by transferred antigen-pulsed dendritic cells is dependent on IL-4 and
IL-12 production by recipient cells. J. Immunol. 168:3127.
Loza, M. J., and B. Perussia. 2001. Final steps of natural killer cell maturation:
a model for type 1-type 2 differentiation? Nat. Immunol. 2:917.
Loza, M. J., L. Zamai, L. Azzoni, E. Rosati, and B. Perussia. 2002. Expression
of type 1 (interferon ␥) and type 2 (interleukin-13, interleukin-5) cytokines at
distinct stages of natural killer cell differentiation from progenitor cells. Blood
99:1273.
Loza, M. J., S. P. Peters, J. G. Zangrilli, and B. Perussia. 2002. Distinction
between IL-13⫹ and IFN-␥⫹ natural killer cells and regulation of their pool size
by IL-4. Eur. J. Immunol. 32:413.
Bonecchi, R., S. Sozzani, J. T. Stine, W. Luini, G. D’Amico, P. Allavena,
D. Chantry, and A. Mantovani. 1998. Divergent effects of interleukin-4 and interferon-␥ on macrophage-derived chemokine production: an amplification circuit of polarized T helper 2 responses. Blood 92:2668.
Sjolin, H., E. Tomasello, M. Mousavi-Jazi, A. Bartolazzi, K. Karre, E. Vivier,
and C. Cerboni. 2002. Pivotal role of KARAP/DAP12 adaptor molecule in the
natural killer cell-mediated resistance to murine cytomegalovirus infection.
J. Exp. Med. 195:825.
Andrews, D. M., A. A. Scalzo, W. M. Yokoyama, M. J. Smyth, and
M. A. Degli-Esposti. 2003. Functional interactions between dendritic cells and
NK cells during viral infection. Nat. Immunol. 4:175.
Huard, B., M. Tournier, and F. Triebel. 1998. LAG-3 does not define a specific
mode of natural killing in human. Immunol. Lett. 61:109.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
27. Zou, W., A. Coulomb, A. Venet, A. Foussat, D. Berrebi, C. Beyer, M. C. Crevon,
A. Minty, A. Couedel-Courteille, E. Vivier, et al. 1998. Administration of interleukin-13 to simian immunodeficiency virus-infected macaques: induction of intestinal epithelial atrophy. AIDS Res. Hum. Retroviruses 14:775.
28. Tomasello, E., P. O. Desmoulins, K. Chemin, S. Guia, H. Cremer, J. Ortaldo,
P. Love, D. Kaiserlian, and E. Vivier. 2000. Combined natural killer cell and
dendritic cell functional deficiency in KARAP/DAP12 loss of function mutant
mice. Immunity 13:355.
29. Borriello, F., M. P. Sethna, S. D. Boyd, A. N. Schweitzer, E. A. Tivol, D. Jacoby,
T. B. Strom, E. M. Simpson, G. J. Freeman, and A. H. Sharpe. 1997. B7-1 and
B7-2 have overlapping, critical roles in immunoglobulin class switching and
germinal center formation. Immunity 6:303.
30. Mayordomo, J. I., D. J. Loftus, H. Sakamoto, C. M. De Cesare, P. M. Appasamy,
M. T. Lotze, W. J. Storkus, E. Appella, and A. B. DeLeo. 1996. Therapy of
murine tumors with p53 wild-type and mutant sequence peptide-based vaccines.
J. Exp. Med. 183:1357.
31. Bouchon, A., J. Dietrich, and M. Colonna. 2000. Cutting edge: inflammatory
responses can be triggered by TREM-1, a novel receptor expressed on neutrophils
and monocytes. J. Immunol. 164:4991.
32. Bouchon, A., C. Hernandez-Munain, M. Cella, and M. Colonna. 2001. A DAP12mediated pathway regulates expression of CC chemokine receptor 7 and maturation of human dendritic cells. J. Exp. Med. 194:1111.
33. Nandi, D., J. A. Gross, and J. P. Allison. 1994. CD28-mediated costimulation is
necessary for optimal proliferation of murine NK cells. J. Immunol. 152:3361.
34. Geldhof, A. B., G. Raes, M. Bakkus, S. Devos, K. Thielemans, and
P. De Baetselier. 1995. Expression of B7.1 by highly metastatic mouse T lymphomas induces optimal natural killer cell-mediated cytotoxicity. Cancer Res.
55:2730.
35. Moretta, A., C. Bottino, M. Vitale, D. Pende, C. Cantoni, M. C. Mingari,
R. Biassoni, and L. Moretta. 2001. Activating receptors and coreceptors involved
in human natural killer cell-mediated cytolysis. Annu. Rev. Immunol. 19:197.
36. Bakker, A. B., R. M. Hoek, A. Cerwenka, B. Blom, L. Lucian, T. McNeil,
R. Murray, L. H. Phillips, J. D. Sedgwick, and L. L. Lanier. 2000. DAP12deficient mice fail to develop autoimmunity due to impaired antigen priming.
Immunity 13:345.
37. Daws, M. R., L. L. Lanier, W. E. Seaman, and J. C. Ryan. 2001. Cloning and
characterization of a novel mouse myeloid DAP12-associated receptor family.
Eur. J. Immunol. 31:783.
38. Bakker, A., E. Baker, G. R. Sutherland, J. H. Phillips, and L. L. Lanier. 1999.
Myeloid DAP12-associating lectin (MDL)-1 is a cell surface receptor involved in
the activation of myeloid cells. Proc. Natl. Acad. Sci. USA 96:9792.
39. Nelms, K., A. D. Keegan, J. Zamorano, J. J. Ryan, and W. E. Paul. 1999. The
IL-4 receptor: signaling mechanisms and biologic functions. Annu. Rev. Immunol.
17:701.
40. Sallusto, F., and A. Lanzavecchia. 1994. Efficient presentation of soluble antigen
by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and down-regulated by tumor necrosis
factor ␣. J. Exp. Med. 179:1109.
41. Labeur, M. S., B. Roters, B. Pers, A. Mehling, T. A. Luger, T. Schwarz, and
S. Grabbe. 1999. Generation of tumor immunity by bone marrow-derived dendritic cells correlates with dendritic cell maturation stage. J. Immunol. 162:168.
42. Mayordomo, J. I., T. Zorina, W. J. Storkus, L. Zitvogel, M. D. Garcia-Prats,
A. B. DeLeo, and M. T. Lotze. 1997. Bone marrow-derived dendritic cells serve
as potent adjuvants for peptide-based vaccines. Stem Cells 15:94.
43. Hochrein, H., M. O’Keeffe, T. Luft, S. Vandenabeele, R. J. Grumont,
E. Maraskovsky, and K. Shortman. 2000. Interleukin (IL)-4 is a major regulatory
cytokine governing bioactive IL-12 production by mouse and human dendritic
cells. J. Exp. Med. 192:823.
44. Rougier, N., D. Schmitt, and C. Vincent. 1998. IL-4 addition during differentiation of CD34 progenitors delays maturation of dendritic cells while promoting
their survival. Eur. J. Cell Biol. 75:287.
45. Canque, B., S. Camus, M. Yagello, and J. C. Gluckman. 1998. IL-4 and CD40
ligation affect differently the differentiation, maturation, and function of human
IL-4-MEDIATED DC-ACTIVATED NK CELL ACTIVITY