0013-7227/03/$15.00/0
Printed in U.S.A.
Endocrinology 144(6):2728 –2740
Copyright © 2003 by The Endocrine Society
doi: 10.1210/en.2003-0006
Growth Hormone-Releasing Hormone (GHRH) Neurons
in GHRH-Enhanced Green Fluorescent Protein
Transgenic Mice: A Ventral Hypothalamic Network
N. BALTHASAR, P.-F. MERY, C. B. MAGOULAS, K. E. MATHERS, A. MARTIN, P. MOLLARD,
I. C. A. F. ROBINSON
AND
Division of Molecular Neuroendocrinology (N.B., C.B.M., K.E.M., A.M., I.C.A.F.R.), National Institute for Medical Research,
Mill Hill, London NW7 1AA, United Kingdom; and Institut National de la Santé et de la Recherche Medicale Unité-469
(P.-F.M., P.M.), 34094 Montpellier Cedex 5, France
The hypothalamic GHRH neurons secrete pulses of GHRH to
generate episodic GH secretion, but little is known about the
mechanisms involved. We have made transgenic mice expressing enhanced green fluorescent protein (eGFP) specifically
targeted to the secretory vesicles in GHRH neurons. GHRH
cells transported eGFP from cell bodies in the arcuate nucleus
to extensively arborized varicose fiber terminals in the median eminence. Patch clamp recordings from visually identified GHRH cells in mature animals showed spontaneous action potentials, often firing in short bursts up to 10 Hz. GHRH
neurons received frequent synaptic inputs, as demonstrated
by the recording of abundant inward postsynaptic currents,
but spikes were followed by large after-hyperpolarizations,
P
ULSATILE GH SECRETION IS regulated by two opposing hypothalamic hypophysiotropic systems, producing GHRH (1) and somatostatin (2). GHRH neurons,
mostly in the hypothalamic arcuate (ARC) nuclei (3), project
their terminals to the median eminence (ME) (4), from which
they release GHRH episodically into portal blood to stimulate pituitary GH release (5, 6). Somatostatin neurons in the
periventricular nuclei also project to the ME and release their
peptide to inhibit GH release periodically. Much circumstantial evidence supports a model (7) in which episodic GH
release is controlled by phasic secretion of GHRH and somatostatin. The mechanisms regulating pulsatility are important because different patterns of GH release have different effects on body growth (8 –10), signal transduction
mechanisms (11, 12), and target gene expression (13).
The regularity of spontaneous GH pulses implies an underlying pulse generator, either intrinsic to GHRH or somatostatin
cells or extrinsic to them but driving their episodic activity in a
coordinated fashion (14). Electrophysiological recordings have
been made from unidentified ARC neurons (15), but it has not
been possible to characterize the electrophysiological properties
of identified GHRH neurons to know whether they show periodic increases in firing rates or bursting patterns of activity, as
has been described for other hypothalamic neuroendocrine
cells (16). To generate a GHRH pulse, there is likely to be some
Abbreviations: ARC, Arcuate; DIG, digoxigenin; eGFP, enhanced
green fluorescent protein; hGH, human GH; ME, median eminence; NT,
nontransgenic; rGHRH, rat GHRH; RNase, ribonuclease; SV, secretory
vesicle; T, transgenic.
which limited their firing rate. Because many GHRH neurons
lie close to the ventral hypothalamic surface, this was examined by wide-field binocular epifluorescence stereomicroscopy. This approach revealed an extensive horizontal network of GHRH cells at low power and individual fiber
projections at higher power in the intact brain. It also showed
the dense terminal projections of the GHRH cell population in
the intact median eminence. This model will enable us to characterize the properties of individual GHRH neurons and their
structural and functional connections with other neurons and
to study directly the role of the GHRH neuronal network in
generating episodic secretion of GH. (Endocrinology 144:
2728 –2740, 2003)
temporal synchronization of episodic firing in a network of
GHRH cells connected directly or indirectly via interneurons
(14, 17). To investigate this, it is necessary to study structural
and functional properties of populations of identified GHRH
cells and monitor their connectivity and activity. Because peptide release from terminals can be regulated independently of
firing activity in neuroendocrine cell bodies (18), an approach
that could give some insight into the transport and release of
GHRH from secretory vesicles (SVs) in the GHRH neuron terminals would also be useful.
Recently, enhanced green fluorescent protein (eGFP) expressed from transgenes has been shown to be a useful way
to first identify and then record from specific hypothalamic
neurons (19 –22). We have now generated transgenic mice
with eGFP targeted to GHRH cells, using a genomic GHRH
promoter construct (23). By using an eGFP variant that is
packaged in SVs (24), the transport of eGFP-tagged vesicles
to terminals and exocytotic release events may also be
visualized (22, 24, 25). In this study we present the first
electrophysiological recordings of bursting activity from
preidentified GHRH-eGFP neurons and use multiple approaches to image a network of GHRH cells and their terminals at the subcellular, single cell, and multicellular levels
at the intact ventral surface of the brain.
Materials and Methods
The rat GHRH (rGHRH)-eGFP cosmid construct
The rGHRH-eGFP transgene is illustrated in Fig. 1. The eGFP reporter
cassette has been described (24); it contains genomic sequences for the
signal peptide, first intron, and N-terminal 22 residues of human GH
2728
Balthasar et al. • GHRH-eGFP Transgenic Mice
Endocrinology, June 2003, 144(6):2728 –2740 2729
FIG. 1. Construction of the rGHRH-eGFP transgene. A, We used the Mlu1 fragment (described in Ref. 24) containing genomic sequences for
the signal peptide (SP), first intron, and N-terminal 22 residues of hGH (dark bars) fused in frame via a 15-mer oligonucleotide linker to the
coding sequence of eGFP (hatched bar). B, This fragment was subcloned into a 12-kb KpnI plasmid containing rGHRH genomic sequence via
a single MluI restriction site previously introduced in the 5⬘untranslated region of the first hypothalamic exon of GHRH (23). C, This was then
packaged into a rat GHRH cosmid (23), containing 16 kb of 5⬘- and 14 kb of 3⬘-flanking sequence and the insert released by digestion with NotI.
(hGH) fused in frame via a 15-mer oligonucleotide linker to the coding
sequence of eGFP (Fig. 1A). After cleavage of the GH signal peptide, the
fluorescent product is eGFP with a short N-terminal peptide extension;
for simplicity this will be referred to as eGFP. This cassette was cloned
into a 12-kb KpnI plasmid containing rGHRH genomic sequence via a
single MluI restriction site introduced in the 5⬘untranslated region of the
first hypothalamic exon of GHRH (Fig. 1B) and then packaged (Gigapack III XL, Stratagene, Amsterdam, The Netherlands) into a rat GHRH
cosmid, containing 16 kb of 5⬘- and 14 kb of 3⬘-flanking sequence (Fig.
1C), all as previously described (23).
Generation and analysis of GHRH-eGFP transgenic mice
The rGHRH-eGFP DNA insert was released by digestion with NotI,
purified by ultracentrifugation in a 5–20% salt gradient, and brought to
a concentration of 1–5 ng/␮l in 10 mm TrisHCl (pH 7.5), 0.1 mm EDTA
(pH 8.0). Transgenic mice were generated by pronuclear microinjection
of this construct into fertilized oocytes of superovulated (CBa/Ca ⫻
C57Bl/10 F1) mice followed by oviductal transfer into pseudopregnant
recipients. Genomic DNA from tail biopsies was obtained and analyzed
for transgene DNA by Southern blotting and PCR. Southern blots were
performed on BglII-digested genomic DNA with a probe homologous to
the hGH sequences and 65 bp of eGFP sequence in the reporter cassette,
radiolabeled with [␣32P]dCTP and [␣32P]dATP] by random-prime labeling (Prime-a-gene kit, Promega Corp., Southampton, UK) and hybridized to 4.9-kb and 1.4-kb fragments in transgenic and wild-type
DNA, respectively. Progeny were subsequently genotyped using a PCR
assay (24) that amplifies across the first intron of hGH present in the
transgene. All lines were maintained as hemizygous, with nontransgenic
(NT) littermates serving as controls for the transgenic (T) animals. All
T mice were generated and maintained at the National Institute for
Medical Research, London; breeding pairs were then sent to establish a
parallel colony of line 39 at Institut National de la Santé et de la Recherche Medicale Unité-469, Montpellier, for other experiments. All
animal experiments were carried out strictly in accordance with the
relevant institutional and national guidelines at both centers.
RT-PCR
RNA was extracted using Trizol reagent (Life Technologies, Inc.,
Paisley, United Kingdom) and 500 ng transcribed with 200 U Moloney
murine leukemia virus reverse transcriptase (Roche Diagnostics, Lewes,
UK) in 1⫻ Moloney murine leukemia virus reverse transcriptase buffer
(Roche Diagnostics) supplemented with 1 ␮g random primers (Invitrogen, Paisley, UK), deoxynucleotide triphosphates (0.3 mm, Amersham
Pharmacia Biotech, Little Chalfont, UK), 40 U ribonuclease (RNase)
inhibitor (Promega Corp.), and 5 mm dithiothreitol. The mixture was
incubated at 37 C for 2 h and cDNAs amplified by PCR. For the transgene
product, the primers spanned from hGH to eGFP sequences and were
AACCACTCAGGGTCCTGTGGACAG (forward) and GAGGACGGCAACATCCTGGGGCA (reverse) to amplify a predicted fragment
size of 950 bp. Mouse ␤-actin control transcripts were amplified using
the primers TTGTAACCAACTGGGACGATATGG (forward) and
GATCTTGATCTTCATGGTGCTAGG (reverse) to amplify a predicted
fragment size of 764 bp.
RNase protection assay
RNase protection assays were performed using the RNase protection
assay III kit (Ambion, Inc., Huntingdon, UK). [␣32P]-uridine 5-triphosphate-labeled RNA probes were generated by in vitro transcription (see
below) and purified by 5% acrylamide gel electrophoresis. For mGHRH,
a PvuII digest of an mGHRH clone (I.M.A.G.E., 1496474, HGMP Resource Centre, Cambridge, UK) was transcribed to generate a 330-bp
probe that protects a 300-bp 3⬘ fragment of mGHRH. For ␤-actin a 334-bp
probe was generated to protect a 246-bp fragment of RNA. Labeled
probes (1 ⫻ 105 cpm) were incubated with 10 ␮g hypothalamic RNA
samples at 42 C overnight. For quantification, RNA samples from two
hypothalami were pooled and four extracts each of T or NT mice were
processed separately. After hybridization, samples were treated with
RNase and protected fragments separated on 5% acrylamide gels. Gels
were analyzed using ImageQuant (Molecular Dynamics, Inc., Sunny-
2730
Endocrinology, June 2003, 144(6):2728 –2740
vale, CA), and the amounts of protected sample RNA were normalized
to ␤-actin RNA measured in the same samples.
In situ hybridization
Antisense and sense riboprobes corresponding to full-length cDNAs
for eGFP or mouse GHRH were labeled with either [␣35S]-uridine
5-triphosphate or digoxigenin (DIG) using SP6/T7 transcription kits
(Roche Diagnostics), treated with Dnase I for 15 min at 37 C, and purified
by gel filtration or phenol/chloroform extraction and ethanol precipitation. For radiolabeled probes, in situ hybridizations were performed
as previously described (26). Slides were exposed to autoradiographic
films that were scanned and analyzed using NIH Image. Slides were
then dipped in photographic emulsion (G5, Ilford Imaging, Knutsford,
UK) for several days, developed, and counterstained in cresyl-fast violet.
For DIG-labeled probes, paraffin-embedded slides were rehydrated,
permeabilized (10 ␮g/ml proteinase K, Sigma, Poole, UK), fixed in 4%
paraformaldehyde, acetylated, and incubated in prehybridization buffer
(4⫻ saline sodium citrate, 50% formamide). Sections were then hybridized overnight, washed, and incubated with RNase (40 mg/ml) at 37 C
for 30 min. DIG labeling was visualized (27) using sheep anti-DIGalkaline phosphatase and Nitro-blue tetrazolium/Bromo-chloroindolyl-phosphate as substrate.
RIAs
Tissues were homogenized and assayed for eGFP protein or GH using
RIAs as previously described (24).
Confocal microscopy
Coronal vibratome sections (150 ␮m) were cut from GHRH-eGFP
mouse brains and placed in a recording chamber on a microscope stage,
perfused with artificial cerebrospinal fluid (mm: 120 NaCl, 3 KCL, 1.2
NaH2PO4, 2 CaCl2, 1 MgSO4, 23 NaHCO3, 10 glucose; gassed with 95%
O2 and 5% CO2 at 32 C). These were imaged using a Axioskop upright
microscope (Carl Zeiss, Le Pecq, France), a ⫻60, 0.9 NA, long-working
distance water immersion objective (Olympus Corp.), and an MRC 1000
scanning confocal microscope (Bio-Rad Laboratories, Inc., Hemel
Hempstead, UK). For excitation, the 488-nm line of an argon ion laser
was used, and emission filters were optimized for eGFP. Digital images
were collected in COMOS (Bio-Rad Laboratories, Inc.) and analyzed
offline in NIH Image.
Culture of hypothalamic neurons
Brains from a litter of 1- to 2-d old pups were placed in ice-cold
HDMEM (25 mm HEPES-buffered Dulbecco’s medium, pH 7.3, Life
Technologies, Inc.) and the hypothalamus dissected into an ice-cold
solution of 25 mm HEPES-buffered Ca2⫹ and Mg2⫹-free Earle’s BSS, pH
7.3 (Life Technologies, Inc.). Tissues were transferred into a solution
containing 6 mg/ml papain, 1 mg/ml DL-cysteine, 250 ␮m EDTA, 50 ␮m
␤-mercaptoethanol in 25 mm HEPES-buffered Ca2⫹ and Mg2⫹-free Earle’s BSS, pH 7.3 (Life Technologies, Inc.), and incubated at 37 C in a
shaking water bath for 20 –25 min. Tissue was washed and then incubated with 1 mg/ml chick egg white trypsin inhibitor, 0.1 mg/ml Dnase
in HDMEM (Life Technologies, Inc.). After dilution with 5 ml culture
medium (1% N2 medium supplement, 10% horse serum, 1% antibiotics,
1 mm sodium pyruvate, 20 mm glucose in glutamine-free basal medium
Eagle, Life Technologies, Inc.), tissue was dissociated by trituration,
centrifuged (200 ⫻ g for 2 min), and the cell pellet resuspended and
layered on 13-mm coverslips coated with poly-d-lysine- and laminin.
Coverslips were removed from culture every 24 h, fixed in 4% paraformaldehyde, mounted in Mowiol (Harco, Essex, UK), and examined
by bright-field and fluorescence microscopy.
Slice preparation for electrophysiological recording
The procedure was essentially as described in (28) but adapted for
adult mice. The GHRH-eGFP mice (6 –12 wk old, line 39) were anesthetized by isoflurane inhalation, killed by decapitation, and brains
quickly removed into cold (0 – 4 C) solution-1 (in mm; 92 NMDG-Cl, 2.3
KCl, 1 CaCl2, 6 MgCl2, 26 NaHCO3, 1.2 KH2PO4, 25 glucose, 0.2 ascorbic
Balthasar et al. • GHRH-eGFP Transgenic Mice
acid, 0.2 thiourea (pH 7.4), gassed with 95% CO2, 5% O2). Meninges and
blood vessels were carefully dissected from the ventral hypothalamus,
sagittal sections (300 ␮m) cut with a vibrating blade microtome (DSK,
Kyoto, Japan) and stored at 34 C in solution-2 (mm; 115 NaCl, 2.5 KCl,
1 CaCl2, 4 MgCl2, 26 NaHCO3, 1.25 NaH2PO4, 25 glucose, 0.2 ascorbic
acid, 0.2 thiourea, pH 7.4, gassed with 95% CO2, 5% O2) for at least 30
min.
Patch-clamp recordings
Slices were immobilized with a nylon grid in a submersion chamber
on the stage of an upright microscope (Axioskop FS, Carl Zeiss) and
superfused continuously with solution-3 (mm; 125 NaCl, 2.5 KCl, 2
CaCl2, 1 MgCl2, 26 NaHCO3, 1.25 NaH2PO4, 5 glucose, pH 7.4, gassed
with 95% CO2, 5% O2) at a rate of approximately 4 ml/min for at least
30 min at 25–27 C. They were viewed with a ⫻63 immersion objective
(Achroplan, Carl Zeiss) and Nomarski differential interference contrast
optics. Infrared differential interference contrast illumination was used
to visualize neurons deeper in the slices and the images captured with
an infrared camera (Hamamatsu Photonics, Massy, France), displayed,
and stored on a computer controlled by Scion 1.62c (NIH Image). Bosilicate glass pipettes (5– 8 m⍀) filled with a standard intracellular solution (in mm; 100 K-gluconate, 40 KCl, 2 MgATP, 3 EGTA, 10 HEPES,
pH 7.3 with KOH) were used for whole-cell patch clamp experiments in
voltage- or current-clamp modes. Alexa 350 (0.1 mm, Molecular Probes,
Inc., Eugene, OR) was added to the pipette solution as an intracellular
marker dye (29). Pipettes were connected to the head stage of an EPC-9
amplifier (HEKA, Lambrecht, Germany) to acquire and store patchclamp data using Pulse 8.09 software (HEKA). Pipette and cell capacitances were fully compensated, and recorded voltages were corrected
for a junction potential of ⫺10 mV (30). Spontaneous activity was recorded in current-clamp mode or at a fixed membrane potential (typically ⫺70 mV) in voltage-clamp mode. Passive and active membrane
properties were examined in current-clamp mode by injecting triggered
current pulses (50 msec or 200 msec duration) through the pipette.
Recordings were analyzed with IgoPro version 3.0 (Wavemetrics,
Lake Oswego, OR) and Axograph 4.0 (Axon Instruments Inc., Foster
City, CA).
Intact brain imaging by epifluorescence stereomicroscopy
Brains were removed as described above and kept in cold solution-2.
Care was taken when cutting the pituitary stalk to avoid damaging the
median eminence. Whole brains were transferred, ventral surface uppermost, to the stage of a modified stereomicroscope equipped with
epifluorescence and ⫻1.6, ⫻2.5, or ⫻20 objectives (Carl Zeiss; Kramer,
Valley Cottage, NY). The intensity of the fluorescent lamp (HBO 100 W;
Osram, Munsen, Germany) was reduced to less than 50% by an AttoArc
power supply (Carl Zeiss). Fluorescence images (16 bit) were acquired
with a cooled CCD (Roper Scientific, Evry, France) controlled using
Metamorph 4.0 (Universal Imaging, West Chester, PA). Image stacks
were collected with a motorized Z-controller (LEP, Hawthorne, NY) at
fixed step amplitudes (typically 200 nm) and deconvoluted with Huygens2 as previously described (31).
Data analysis
Unless otherwise stated, data are shown as mean ⫾ sem. Differences
between groups were analyzed by t test, with P less than 0.05 taken as
significant (n.s. ⫽ nonsignificant).
Results
Of 23 pups born, four were transgenic for the rGHRHeGFP construct and bred with C57Bl/10 mice. One founder
was sterile; from the other three founders, lines (39, 151, and
342) were established in which the transgenes transmitted
50:50% to both males and females. PCR and Southern blotting readily distinguished T from NT animals (Fig. 2, A and
B), and RT-PCR detected an eGFP transgene product of the
expected size in hypothalamic extracts from T but not NT
Balthasar et al. • GHRH-eGFP Transgenic Mice
Endocrinology, June 2003, 144(6):2728 –2740 2731
FIG. 2. Analysis of GHRH-eGFP transgenic
mice. A, PCR of tail DNA was used to identify the
transgenic founder in line 39 (F#39) and distinguish between its T and NT progeny using primers spanning the first GH intron (350 bp for transgene and 300 bp for mouse GH). B, Southern blot
of tail DNA showed a strong 4.9-kb transgene
band and a weaker 1.4-kb band corresponding to
endogenous mouse GH. C, RT-PCR on hypothalamic RNA extracts amplified the expected
950-bp hGH/eGFP mRNA fragment in T but not
NT progeny, and ␤-actin transcripts (764 bp)
were amplified from both. Control reactions without reverse transcriptase (⫺RT) or input RNA
(⫺RNA) gave no product.
mice (Fig. 2C). Many of the subsequent studies were performed on all three lines, but for clarity, data presented will
be from line 39, unless stated otherwise.
Animals were weighed weekly for 18 wk, and the growth
curves of T and NT littermates were indistinguishable for all
three lines. At 18 wk, body weights were 35.1 ⫾ 1.7 vs. 35.1 ⫾
2.2 g, T vs. NT males, and 25.1 ⫾ 0.8 vs. 26.1 ⫾ 0.9 g, T vs. NT
females (n ⫽ 5–9 per group, n.s.). Pituitary GH contents were
also unaffected (42.0 ⫾ 5.2 vs. 37.1 ⫾ 5.6 ␮g, male T vs. NT
mice, n ⫽ 5, n.s.).
RIA of hypothalamic extracts showed eGFP-immunoreactive protein in T but not NT mice from each line (Fig. 3),
with line 151 showing a 6- to 10-fold higher hypothalamic
eGFP protein content than the other two lines. Extracts from
groups of males and females from line 39 showed similar
eGFP contents (9.7 ⫾ 2.2 vs. 8.1 ⫾ 1.5 ng eGFP/hypothalamic
extract, n ⫽ 7). RNase protection assays, performed on hypothalamic extracts from adult NT and T mice from line 39
showed that expression of eGFP protein in GHRH neurons
did not affect endogenous mouse GHRH mRNA abundance
(2.61 ⫾ 0.4 vs. 2.45 ⫾ 0.5 arbitrary densitometer units, n ⫽ 4
pairs per group, n.s.).
In situ hybridization was used to screen for eGFP mRNA
in the central nervous system and a variety of peripheral
tissues in line 39. Strong eGFP expression was seen mainly
in the ARC nuclei (Fig. 4Aa), with a few positive neurons also
apparent in more dorsomedial hypothalamic regions. No
signal was observed in NT animals (Fig. 4Ab) or in T animals
with a sense eGFP riboprobe. No eGFP expression was seen
in any other brain area, pancreas, thymus, pituitary, stomach,
testes, spleen, liver, or heart. Some eGFP signal was detected
sporadically in a few glomerular podocyte cells in the kidney
cortex, but the relevance of this was unclear because it was
seen in all three lines and some but not other T littermates of
FIG. 3. Hypothalamic content of eGFP protein in three lines of
GHRH-eGFP mice. Hypothalami were dissected from groups of six
transgenic animals from litters from the three different lines (39, 151,
342) of GHRH-eGFP transgenic mice and from six NT mice, homogenized and assayed for eGFP protein by RIA. EGFP was not detectable
(n.d.) in NT mice but present in all three transgenic lines, with line
151 showing significantly larger amounts than in the other two lines.
***, P ⬍ 0.001.
each line, and mouse GHRH mRNA expression was not
detected in these cells.
Emulsion dipping and counterstaining the sections confirmed that eGFP transcripts were expressed in a distinct
population of ventral ARC neurons (Fig. 4, Ac–Af) spreading
from medial to lateral areas of the ARC. The overall pattern
matched that of GHRH expression examined separately by
in situ hybridization (Fig. 4Ag), and simultaneous double in
situ hybridization using an 35S-labeled riboprobe for eGFP,
and a DIG-labeled riboprobe for GHRH confirmed that eGFP
and GHRH mRNAs were colocalized in the ARC neuronal
cell bodies when examined under high power (Fig. 4Ah). Of
108 labeled ARC neurons examined in sections from GHRHeGFP transgenic mice of line 39, both mRNAs were colocal-
2732
Endocrinology, June 2003, 144(6):2728 –2740
Balthasar et al. • GHRH-eGFP Transgenic Mice
FIG. 4. Expression and distribution of eGFP in arcuate GHRH neurons. A, Cryostat sections of hypothalamus were taken for in situ hybridization with a 35S-labeled eGFP riboprobe and exposed to x-ray film. EGFP expression was detected predominantly in the ARC (arrow) in T
(a) but not NT (b) mice. Sense control probes gave no signal (not shown). After dipping in photoemulsion and counterstaining, the distribution
of eGFP-positive cells could be observed at low power (⫻10) in the bilateral ARC (c, d) on either side of the third ventricle, concentrated in the
ventral portion of ARC. Individual cell bodies were resolved at higher power (⫻40), under bright field (e), and the silver grains visualized as
bright spots in dark-field images of the same sections (f). A 35S-labeled riboprobe for mouse GHRH confirmed its expression in a similar pattern
in ARC (g), and double in situ hybridization with a DIG-labeled GHRH riboprobe (blue) and a 35S-labeled eGFP riboprobe (silver grains, black)
showed coexpression in most ARC GHRH cells when examined individually (h) at high power (⫻100) after emulsion dipping and development.
B, Freshly prepared hypothalamic slices (150 ␮m) from GHRH-eGFP mice (line 39) were placed in a perfusion chamber, maintained in artificial
cerebrospinal fluid, and regions of the arcuate nucleus (a, b) and ME (c– e) examined by confocal microscopy. Clusters of brightly fluorescing
eGFP-positive neurons could be seen in ARC, which at higher power (b) showed a punctate appearance of eGFP in their axons. Numerous
eGFP-filled varicose were evident, coursing toward the ME (c), which showed a very bright accumulation of eGFP-filled terminals. Individual
fibers, beaded varicosities, and terminals could be resolved (d, e) in the external zone of the ME. 3v, Third ventricle. C, Dissociated cells from
neonatal hypothalami of GHRH-eGFP mice (line 39) were placed in tissue culture and examined by confocal microscopy 4 h (top panels) and
72 h (bottom panels) later. Left panels, eGFP fluorescence; right panels, bright-field illumination. Scale bars, 10 ␮m.
ized in 90% of the cells, and in 6% and 4%, only eGFP or
GHRH mRNAs were detected, respectively.
Similar results were obtained for transgenic mice from line
342. However, animals from line 151 showed much more
widespread and intense eGFP expression with many more
eGFP-labeled cells in many other hypothalamic areas in addition to the ventral ARC, consistent with the higher
amounts of eGFP protein detected in this line (Fig. 3). In the
ARC of this line, colocalization of eGFP and GHRH was
observed in only 81% of the cells. Because eGFP was clearly
Balthasar et al. • GHRH-eGFP Transgenic Mice
not a specific reporter for GHRH cells in line 151, these
animals were not studied further.
Fluorescence microscopy
Fluorescence microscopy on vibratome slices (150 ␮m) of
hypothalamus from transgenic mice from lines 39 and 342
showed fluorescent neurons in ARC and a stronger fluorescent signal in the ME. No other regions of the hypothalamus
showed eGFP fluorescence in these lines. Using confocal
microscopy, individual GHRH cell bodies and their primary
axons were resolved, which showed a punctate pattern of
eGFP fluorescence (Fig. 4, Ba and Bb). In the ME, the terminal
fields of these neurons were brightly fluorescent (Fig. 4Bc),
and fluorescent beaded varicosities were evident along the
entire length of these projections (Fig. 4, Bd and Be) coursing
throughout both internal and external zones of the ME. These
images were consistent with the packaging of the eGFP product into SVs, and their transport along the axons, to be stored
in the ME terminals of GHRH neurons.
We tested whether GHRH-eGFP neurons could be identified after in vitro culture of dissociated hypothalamic cells
from newborn mice from line 39. Because the hemizygous
mice could not be genotyped before pooling for cell culture,
the cells originated from both T and NT pups. Very few
eGFP-fluorescent rounded cells were visible after 4 h of culturing (Fig. 4C, upper panels). After 72 h, only one to two eGFP
fluorescing neurons per coverslip could be detected, but
these were bright and had clearly discernible projections
containing fluorescent material at their tips (Fig. 4C, lower
panels).
Electrophysiological recordings from GHRH-eGFP neurons
Patch-clamp experiments were performed on eGFP-positive GHRH neurons visualized in acutely prepared parasagittal brain slices from adult GHRH-eGFP mice (Fig. 5). Two
eGFP-positive neurons were seen in the field shown in Fig.
5Ab and the left one brought into focus. Infrared illumination
was used to monitor the shape of this neuron before (Fig.
5Aa) and during (Fig. 5Ac) patch-clamp recording. The patch
pipette was loaded with a blue fluorescent dye (Alexa 350,
Molecular Probes, Inc.), which labeled the cytoplasm of the
eGFP-positive neuron being recorded (Fig. 5Ad).
All eGFP-positive neurons of rGHRH-eGFP mice displayed significant spontaneous membrane activity when
studied in the current-clamp mode. For the recording shown
in Fig. 5B, the mean action potential firing rate was 0.83 Hz,
although the firing rate was frequently higher in brief bursts
of activity, when the instantaneous firing rate could reach up
to 10 Hz. Subthreshold depolarizations were also observed,
especially between bursts of action potentials. Action potential spikes were always preceded by brief depolarizations
and followed by sharp hyperpolarizations.
Triggered current injection was performed to resolve passive membrane properties and action potential kinetics of
GHRH-eGFP neurons. Constant negative current injection
was often required to minimize spontaneous activity under
steady-state conditions, upon which 50-msec-duration
pulses of varying amplitude were delivered. In Fig. 5C, the
membrane potential was driven in a linear manner by sub-
Endocrinology, June 2003, 144(6):2728 –2740 2733
threshold current injections (⫺15 to 40 pA). Current injections above 40 pA elicited action potential firing as membrane potential exceeded threshold. Note again the large
afterhyperpolarization phase following repolarization. The
responses of GHRH-eGFP neurons to longer (200 msec) current pulses were also examined (Fig. 5D). Moderate current
injections elicited action potentials that shared almost identical threshold, peak, and afterhyperpolarization characteristics. However, increasing current amplitude from 40 (top
panel) to 55 pA (bottom panel) increased both the depolarization rate near threshold and action potential firing. On average, the action potential threshold was ⫺47.7 ⫾ 1.6 mV (n ⫽
8), and the action potential peaked at 10.1 ⫾ 3.8 mV (n ⫽ 8),
followed by an afterhyperpolarization (⫺62.8 ⫾ 2.2 mV, n ⫽
8), well below the resting potential (⫺54.1 ⫾ 1.89 mV, n ⫽ 10).
Spontaneous ionic currents were always observed in the
voltage-clamp mode (15 experiments). In the recording
shown in Fig. 5E, inward synaptic currents are shown in an
eGFP-positive neuron held at ⫺70 mV. These inward currents were often clustered or even superimposed, and their
fast kinetics are shown in Fig. 5F. The maximal amplitude of
the inward currents increased as the holding potential was
lowered to ⫺90 mV and decreased when the potential was
held at ⫺50 mV (data not shown). No outward currents were
observed under these experimental conditions.
Imaging the GHRH ventral neuronal population in intact
brains from GHRH-eGFP mice
Because many of the GHRH cells are very close to the
ventral hypothalamic surface, we examined the ventral surface of the intact brain of a GHRH-eGFP mouse with an
epifluorescence binocular stereomicroscope. Figure 6 shows
that a large population of eGFP-positive cells, their fibers,
and terminals is readily visible with this technique. At low
magnifications (Fig. 6, A and B), an intense eGFP signal was
evident in the ME. As magnification was progressively increased (Fig. 6, C–E), numerous eGFP-positive neuronal cell
bodies became evident in the vicinity of the ME, with more
scattered eGFP-positive neurons in lateral areas of the hypothalamus. At the highest magnifications (Fig. 6, E and F),
individual rGHRH-eGFP neurons could be distinguished
and the punctate subcellular distribution of eGFP fluorescence could be resolved in discrete areas of the cells and their
processes (Fig. 6, E and F). Intriguingly, many bright eGFPcontaining beaded processes were seen apparently coursing
between nearby rGHRH-eGFP neurons (Fig. 6F).
The distribution of GHRH-eGFP-positive neurons in the
ARC was also examined in the Z axis, moving into the
brain from the ventral surface in 800-nm steps (Fig. 7, A–F).
The GHRH-eGFP neurons could be resolved up to 80 ␮m
deep within the brain, and several layers of eGFP-positive
neurons could be seen in closely apposed clusters in a
parasagittal region close to the ME. In more lateral regions,
GHRH-eGFP neurons were localized in deeper areas of the
hypothalamus.
The intact ME was also examined at higher magnifications.
Figure 8, A–F, shows a similar gallery of images moving from
the ventral surface of the ME inward. Myriad small highly
arborized brightly eGFP fluorescent bundles of fiber termi-
2734
Endocrinology, June 2003, 144(6):2728 –2740
Balthasar et al. • GHRH-eGFP Transgenic Mice
FIG. 5. Electrophysiology of eGFP-positive neurons in GHRH-eGFP mice. Whole-cell patch-clamp recordings from eGFP-positive neurons were
performed in brain slices from GHRH-eGFP mice from line 39 (A). The tissue was visualized with a ⫻63 objective under infrared light before
(Aa) and during (Ac) the patch-clamp recording of an eGFP-positive neuron (Ab). Diffusion of Alexa 350 from the pipette confirmed that the
recordings had been obtained from the GHRH-eGFP neuron. B, Spontaneous membrane potential variations are evident in an GHRH-eGFP
neuron. C, Active and passive membrane potential variations were elicited by current injections. Pulses (50-msec duration) of varying amplitudes
were delivered as indicated in the upper panel. D, Same neuron as in C. Representative recordings of the bursting activity, elicited by injection
of 40 pA (top) or 55 pA (bottom) for 200 msec as indicated by the solid line. E, Spontaneous membrane currents recorded in an GHRH-eGFP
neuron at a holding potential of ⫺70 mV. F, Enlarged view of part of the membrane current recording in E indicated by the star. In B–D, the
0 mV level is indicated by dotted lines.
Balthasar et al. • GHRH-eGFP Transgenic Mice
Endocrinology, June 2003, 144(6):2728 –2740 2735
FIG. 6. Epifluorescence visualization of the ventral GHRH-eGFP neuronal population in the intact brain. The whole brain of an GHRH-eGFP
mouse from line 39 was removed and immersed ventral side uppermost in a cold Ringer solution on the stage of a binocular epifluorescence
stereomicroscope. A–F, Images of the ventral surface of the hypothalamus were taken sequentially from the lowest (⫻1.5 in A) to the highest
magnification (⫻80 in F). The box (D) indicates the location of the image F, Images were acquired and processed as detailed in Materials and
Methods. Scale bars (A), 1 mm; (B), 400 ␮m; (C), 200 ␮m; (D and E), 100 ␮m; (F), 20 ␮m. Cb, Ventral side of the cerebellum; OC, optic chiasm.
The bright central mass (A) is the median eminence.
nals of varying lengths were apparent as well as small
dots (500 – 800 nm apparent diameter), which reflect the
axons, varicosities, and nerve terminals of the GHRH-eGFP
neurons; no GHRH-eGFP neuronal cell bodies were visible.
Discussion
There are two main requirements for using transgene reporters to identify and study specific neuronal cell groups (32).
2736
Endocrinology, June 2003, 144(6):2728 –2740
Balthasar et al. • GHRH-eGFP Transgenic Mice
FIG. 7. Distribution of GHRH-eGFP neurons within the ARC in the intact brain. Images were obtained from the intact brain of a GHRH-eGFP
mouse from line 39 using a binocular epifluorescence stereomicroscope. A series of images (A–F) were acquired from the ventral surface of the
hypothalamus just lateral to the border of the ME from inside outward in 800-nm steps and processed as described in Materials and Methods.
Note the clusters of closely apposed GHRH cell bodies throughout the region of ARC just parasagittal to the ME. Scale bar, 50 ␮m.
The first is that the construct must contain appropriate regulatory sequences to drive high-level expression, specifically restricted to the cells of interest. This is straightforward for neuroendocrine neurons because one can use the strong promoter
and regulatory sequences of the genes coding for the major
peptide secretory products that define these cells. The second
requirement is that the reporter must be readily imaged in
living cells and not affect cell function. This is readily satisfied
by eGFP and its variants (33), which have been expressed in a
wide variety of cells without deleterious effects (34).
Balthasar et al. • GHRH-eGFP Transgenic Mice
Endocrinology, June 2003, 144(6):2728 –2740 2737
FIG. 8. Distribution of GHRH-eGFP neuron fibers and terminals within the ME in the intact brain. Images were obtained from the intact brain
of a GHRH-eGFP mouse from line 39 using a binocular epifluorescence stereomicroscope. A series of images (A–F) were acquired from the ME
from inside outward in 800-nm steps and processed as described in Materials and Methods. They show an extensive network of eGFP-containing
processes, varicosities, and terminals at all depths within the ME. Scale bar, 20 ␮m.
Although neuroendocrine promoter transgenes driving
GFP have proved successful in targeting other hypothalamic neuronal systems (19 –22), short GHRH promoter
sequences have not succeeded (35) (Robinson, I. C. A. F.,
unpublished observations), probably because of the presence of several upstream promoters in this locus (36, 37)
whose enhancer and regulatory elements are poorly defined. However, we have engineered a GHRH cosmid that
does drive transgene expression specifically in hypothalamic GHRH neurons in most lines (23, 38, 39), although
low-level transgene expression can be detected in other
tissues, reflecting low-level production of endogenous
2738
Endocrinology, June 2003, 144(6):2728 –2740
GHRH (40), other products from the GHRH precursor (41),
or ectopic expression.
We generated three GHRH-eGFP transgenic lines, none of
which showed any overt phenotypic differences from their
NT littermates. Hypothalamic GHRH mRNA, pituitary GH
contents, and growth rates were all normal, suggesting that
the rGHRH-eGFP transgene had no deleterious effect on the
GHRH/GH axis. All three lines expressed a fluorescent eGFP
product in ARC, but the specificity and intensity of expression differed between the lines. Two lines showed transgene
expression highly restricted to the hypothalamic GHRH
cells, mainly in ARC (42, 43) but with few scattered eGFPand GHRH-positive neurons in more dorsal hypothalamic
regions (4). Colocalization studies showed that GHRH and
eGFP mRNAs were coexpressed in at least 90% of the labeled
ARC neurons in these two lines. This is probably an underestimate because GHRH signal intensity varies markedly
from cell to cell, and the sensitivities of the probes are lower
when used in double-label studies. Because only 6% of the
ARC eGFP cells did not show detectable GHRH expression
in line 39, eGFP identifies the vast majority of ARC GHRHexpressing neurons in this line. Although 4% of the GHRH
cells that did not show eGFP expression probably reflect
differences in RNA abundance and detection, it is possible
that they activate their GHRH expression from a promoter
element other than that into which the eGFP reporter was
cloned.
Other tissues showed no eGFP expression, with the exception of a few eGFP-positive cells in the kidney in some
T individuals. The cosmid might contain cryptic kidneyspecific sequences but why these would be active in some
animals but not others is unclear, and no GHRH transcripts
were detected in these cells. However, because transgenic
line 151 showed more widespread eGFP expression in other
parts of the central nervous system, it is clear that even our
38-kb rGHRH cosmid does not contain all the locus control
sequences (44) necessary for position-independent, tissuespecific GHRH expression in every line, and it was necessary
to assess several lines of mice to identify one (line 39) in
which eGFP was a reliable reporter for GHRH neurons.
Because we wished to visualize GHRH terminals as well
as cell bodies, we used an eGFP variant targeted to the
secretory pathway (24) and obtained a distribution of eGFP
fluorescence very similar to that of GHRH in mice (42, 43).
Fluorescence and confocal microscopy showed ARC neurons
with bright perinuclear fluorescence in the soma, from which
axons could be traced to the ME, filled with intensely fluorescent varicose terminals. That the eGFP accumulates in the
ME is expected because the vast majority of GHRH neurons
project to this site, storing their peptide in terminal varicosities for release into hypophysial portal blood (43). In the
outer zone of the ME, eGFP was clearly contained in vesicular varicosities, typical of those identified in beaded strands
in GHRH neurons and their terminal arborizations by immunostaining and EM (45). Whether this eGFP variant is
costored with GHRH in the same SVs will require a doubleimmunogold EM study, but in other studies in GH cells (24),
we showed that this eGFP variant was copackaged with GH
in SVs and coreleased on stimulation.
It was possible to culture hypothalamic neurons from neo-
Balthasar et al. • GHRH-eGFP Transgenic Mice
natal GHRH-eGFP mice. Only few eGFP-positive cells were
detected, but these formed projections and maintained eGFP
expression for up to 3 d. The use of homozygous litters or
fluorescence-activated cell sorting of cells before culture may
improve the efficiency, but yields are likely to remain low
because only a small proportion of neonatal hypothalamic
neurons express GHRH and at levels much lower than in
adults (46). It may be more useful to combine this eGFP
approach with suspension or explant culture techniques
(47, 48).
We present here the first electrophysiological recordings
from preidentified GHRH cells in hypothalamic slices. All
GHRH neurons showed spontaneous action potential firing,
similar to what was reported from other GFP-tagged neuroendocrine neurons (20), although GHRH neurons might be
distinguished from proopiomelanocortin neurons (20) and
cholecystokinin-sensitive neurons (49) by their lower resting
membrane potential. GHRH neurons also showed clusters of
spike activity in bursts. We believe the bursting behavior is
physiologically relevant because GH release induced by electrical stimulation of the ARC is markedly potentiated with
increases in the duration of bursts of firing (50). The GHRH
neurons exhibited high input resistance, and internal dialysis
with Alexa 350 always stained the single neuron under
study, so the soma of GHRH neurons are unlikely to be
tightly coupled via gap junctions. In these isolated slices, the
clustering of bursts was apparently randomly distributed
within and between recordings in individual neurons. However, when held at hyperpolarized potentials, GHRH
neurons exhibited frequent and robust inward currents,
reflecting intense synaptic activity, and spontaneous depolarizations were routinely observed, triggering action potentials. Further experiments are in progress to elucidate the
ionic nature and pharmacological properties of these synaptic events.
Although this provided new information about the electrophysiological properties of individual GHRH neurons,
relating this to global GHRH episodic secretion requires
monitoring of populations of GHRH cells. Because so many
of the GHRH cells lie close to the ventral surface of the
hypothalamus and send their projections superficially to the
outer zone of the ME, we attempted to image a large ventral
population of GHRH-eGFP cells in situ simply by external
observation of the exposed hypothalamic surface of an intact
brain, using an epifluorescence stereomicroscope. A population of individually identifiable eGFP-tagged GHRH cell
bodies could readily be imaged in this way, and their fluorescent fibers followed as they coursed to their terminal
projection fields in the ME. This should make it possible to
perform optically guided recordings of multiunit activity
and seek direct evidence for functional connections between
identified GHRH neurons in known positions in this
network.
This imaging approach showed the existence of clusters of
GHRH cells with closely apposed cell bodies and that many
other more separated GHRH cells seemed to be locally interconnected with visible projections containing GHRHeGFP coursing between them. This suggests that this ventral
population of GHRH neurons may form a directly connected
homotypic network. Axosomatic contacts between GHRH
Balthasar et al. • GHRH-eGFP Transgenic Mice
cells have been described previously (45), and there is ultrastructural evidence for direct connections between GHRH
cells (51), suggesting that network activity could be regulated
by GHRH itself (52) or a related product of these cells (53).
Other morphological, stimulation, and receptor colocalization studies suggest other candidate neurotransmitters and
neuropeptides that could directly affect GHRH cell activity
(15, 48, 54 –58). Because it is possible to expose and record
from the ventral ARC surface in anesthetized animals, we can
now realistically contemplate measuring functional activity
in networks of identified GHRH cells in vivo for the first time
in the intact brain to gain an understanding of the mechanisms generating episodic GH secretion.
Acknowledgments
We are extremely grateful to Drs. Jean-Marc Israel, Stéphane Oliet,
Michel Desarmenien, David Robbe, Robert Gardette, Jacques Epelbaum,
Chris Magnus, and Nigel Emptage for considerable help and advice.
Received January 3, 2003. Accepted February 21, 2003.
Address all correspondence and requests for reprints to: Professor
Iain C. A. F. Robinson, Division of Molecular Neuroendocrinology,
National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, United Kingdom. E-mail: [email protected].
Current address for C.B.M.: Department of Neurosurgery, Barts, and
The London School of Medicine and Dentistry, Queen Mary, University
of London, United Kingdom.
Current address for N.B.: Beth Israel Deaconess Medical Center, Harvard Medical School Division of Endocrinology, Boston, Massachusetts.
This work was supported by the United Kingdom MRC (to N.B.,
C.B.M., K.E.M., I.C.A.F.R.), Institut National de la Santé et de la Recherche Medicale, and Fondation pour la Recherche Médicale (to P.F.M.,
A.M., P.M.).
References
1. Rivier J, Spiess J, Thorner M, Vale W 1982 Characterization of a growth
hormone-releasing factor from a human pancreatic islet tumour. Nature 300:
276 –278
2. Brazeau P, Vale W, Burgus R, Ling N, Butcher M, Rivier J, Guillemin R 1973
Hypothalamic polypeptide that inhibits the secretion of immunoreactive pituitary growth hormone. Science 179:77–79
3. Rodier PM, Kates B, White WA, Phelps CJ 1990 Birth dates of the growth
hormone releasing factor cells of the rat hypothalamus—an autoradiographic
study of immunocytochemically identified neurons. J Comp Neurol 291:363–
372
4. Niimi M, Takahara J, Sato M, Kawanishi K 1989 Sites of origin of growth
hormone-releasing factor-containing neurons projecting to the stalk-median
eminence of the rat. Peptides 10:605– 608
5. Frohman L, Downs T, Clark I, Thomas GB T 1990 Measurement of growth
hormone-releasing hormone and somatostatin in hypophysial portal plasma
of unanaesthetized sheep: spontaneous secretion and response to insulininduced hypoglycaemia. J Clin Invest 86:17–24
6. Mayo KE, Miller T, DeAlmeida V, Godfrey P, Zheng J, Cunha SR 2000
Regulation of the pituitary somatotroph cell by GHRH and its receptor. Recent
Prog Horm Res 55:237–266
7. Tannenbaum GS, Ling N 1984 The interrelationship of growth hormone (GH)releasing factor and somatostatin in the generation of the ultradian rhythm of
GH secretion Endocrinology 115:1952–1957
8. Jansson JO, Albertsson-Wikland K, Eden S, Thorngren KG, Isaksson OGP
1982 Effect of frequency of growth hormone administration on longitudinal
bone growth and body weight in hypophysectomised rats. Acta Physiol Scand
114:261–265
9. Gevers EF, Wit JM, Robinson ICAF 1996 Growth, growth hormone (GH)binding protein, and GH receptors are differentially regulated by peak and
trough components of the GH secretory pattern in the rat. Endocrinology
137:1013–1018
10. Robinson ICAF, Hindmarsh PC 1998 Importance of the GH secretory pattern
for statural growth. In: Kostyo JL, ed. Hormonal control of growth. New York:
Oxford University Press; 329 –395
11. Choi HK, Waxman DJ 2000 Plasma growth hormone pulse activation of
hepatic JAK-STAT5 signaling: developmental regulation and role in malespecific liver gene expression. Endocrinology 141:3245–3255
Endocrinology, June 2003, 144(6):2728 –2740 2739
12. Davey HW, Xie T, McLachlan MJ, Wilkins RJ, Waxman DJ, Grattan DR 2001
STAT5b is required for GH-induced liver IGF-I gene expression. Endocrinology 142:3836 –3841
13. Mode A, Norstedt G, Simic B, Eneroth P, Gustafsson JA 1981 Continuous
infusion of growth hormone feminizes hepatic steroid metabolism in the rat.
Endocrinology 108:2103–2108
14. Robinson ICAF 2000 Control of growth hormone (GH) release by GH secretagogues. Novartis Found Symp 227:206 –220
15. Dickson SL, Leng G, Robinson ICAF 1993 Systemic administration of growth
hormone-releasing peptide activates hypothalamic arcuate neurons. Neuroscience 53:303–306
16. Poulain DA, Wakerley JB 1982 Electrophysiology of hypothalamic magnocellular neurones secreting oxytocin and vasopressin. Neuroscience 7:773– 808
17. Jourdain P, Israel JM, Dupouy B, Oliet SH, Allard M, Vitiello S, Theodosis
DT, Poulain DA 1998 Evidence for a hypothalamic oxytocin-sensitive patterngenerating network governing oxytocin neurons in vitro. J Neurosci 18:6641–
6649
18. Bicknell RJ, Leng G 1982 Endogenous opiates regulate oxytocin but not
vasopressin secretion from the neurohypophysis. Nature 298:161–162
19. Spergel DJ, Kruth U, Hanley DF, Sprengel R, Seeburg PH 1999 GABA- and
glutamate-activated channels in green fluorescent protein-tagged gonadotropin-releasing hormone neurons in transgenic mice. J Neurosci 19:2037–2050
20. Suter KJ, Song WJ, Sampson TL, Wuarin JP, Saunders JT, Dudek FE, Moenter SM 2000 Genetic targeting of green fluorescent protein to gonadotropinreleasing hormone neurons: characterization of whole-cell electrophysiological properties and morphology. Endocrinology 141:412– 419
21. Cowley MA, Smart JL, Rubinstein M, Cerdan MG, Diano S, Horvath TL,
Cone RD, Low MJ 2001 Leptin activates anorexigenic POMC neurons through
a neural network in the arcuate nucleus. Nature 411:480 – 484
22. Zhang BJ, Kusano K, Zerfas P, Iacangelo A, Young 3rd WS, Gainer H 2002
Targeting of green fluorescent protein to secretory granules in oxytocin magnocellular neurons and its secretion from neurohypophysial nerve terminals
in transgenic mice. Endocrinology 143:1036 –1046
23. Flavell DM, Wells T, Wells SE, Carmignac DF, Thomas GB, Robinson ICAF
1996 Dominant dwarfism in transgenic rats by targeting human growth hormone (GH) expression to hypothalamic GH-releasing factor neurons. EMBO
J 15:3871–3879
24. Magoulas C, McGuinness L, Balthasar N, Carmignac DF, Sesay AK, Mathers
KE, Christian H, Candeil L, Bonnefont X, Mollard P, Robinson IC 2000 A
secreted fluorescent reporter targeted to pituitary growth hormone cells in
transgenic mice. Endocrinology 141:4681– 4689
25. McGuinness L, Magoulas C, Sesay AK, Mathers K, Carmignac D, Manneville J-B, Christian H, Phillips JA, Robinson ICAF 2003 Autosomal dominant
growth hormone deficiency disrupts secretory vesicles in vitro and in vivo in
transgenic mice. Endocrinology 144:720 –731
26. Bennett PA, Levy A, Sophokleous S, Robinson IC, Lightman SL 1995 Hypothalamic GH receptor gene expression in the rat: effects of altered GH status.
J Endocrinol 147:225–234
27. Komminoth P 1992 Digoxigenin as an alternative probe labelling for in situ
hybridization. Diagn Mol Pathol 1:142–150
28. Hewson A, Viltart O, McKenzie D, Dyball R, Dickson S 1999 GHRP-6induced changes in electrical activity of single cells in the arcuate, ventromedial and periventricular nucleus neurones of a hypothalamic slice preparation
in vitro. Neuroendocrinology 11:919 –923
29. Panchuk-Voloshina N, Haugland R, Bishop-Stewart J, Bhalgat MK, Millard
PJ, Mao F, Leung WY, Haugland RP 1999 Alexa dyes, a series of new fluorescent dyes that yield exceptionally bright, photostable conjugates. J Histochem Cytochem 47:1179 –1188
30. Neher E 1992 Correction for liquid junction potentials in patch clamp experiments. Methods Enzymol 207:123–131
31. Fauquier T, Lacampagne A, Travo P, Bauer K, Mollard P 2002 Hidden face
of the anterior pituitary. Trends Endocrinol Metab 13:304 –309
32. Spergel DJ, Kruth U, Shimshek DR, Sprengel R, Seeburg PH 2001 Using
reporter genes to label selected neuronal populations in transgenic mice for
gene promoter, anatomical, and physiological studies. Prog Neurobiol 63:
673– 686
33. Heim R, Tsien RY 1996 Engineering green fluorescent protein for improved
brightness, longer wavelengths and fluorescence resonance energy transfer.
Curr Biol 6:178 –182
34. Tsien RY 1998 The green fluorescent protein. Annu Rev Biochem 67:509 –544
35. Giraldi FP, Mizobuchi M, Horowitz ZD, Downs TR, Aleppo G, Kier A,
Wagner T, Yun JS, Kopchick JJ, Frohman LA 1994 Development of neuroepithelial tumors of the adrenal medulla in transgenic mice expressing a mouse
hypothalamic growth hormone-releasing hormone promoter-simian virus-40
T-antigen fusion gene. Endocrinology 134:1219 –1224
36. Nogues N, Del Rio JA, Perez-Riba M, Soriano E, Flavell RA, Boronat A 1997
Placenta-specific expression of the rat growth hormone-releasing hormone
gene promoter in transgenic mice. Endocrinology 138:3222–3227
37. Suhr ST, Rahal JO, Mayo KE 1989 Mouse growth hormone-releasing hormone
precursor structure and expression in brain and placenta. Mol Endocrinol
3:1693–1700
38. Balthasar N, Carmignac DF, Mathers K, Bennett PA, Le Tissier PR, Magoulas
2740
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
Endocrinology, June 2003, 144(6):2728 –2740
C, Robinson ICAF, Growth hormone responses and ghrelin expression in
growth hormone secretagogue receptor (GHS-R) transgenic mice. Program of
the 82nd Annual Meeting of The Endocrine Society, Toronto, Canada, 2000, p
160 (Abstract 645)
Le Tissier P, Magoulas B, Mathers K, McGuinness L, Sesay AK, Carmignac
DF, Robinson ICAF, Ablating GRF neurones in transgenic mice using a novel
viral ion channel transgene. Program of the 84th Annual Meeting of The
Endocrine Society, San Francisco, CA, 2002, p 106 (Abstract OR31-1)
Matsubara S, Sato M, Mizobuchi M, Niimi M, Takahara J 1995 Differential
gene expression of growth hormone (GH)-releasing hormone (GRH) and GRH
receptor in various rat tissues. Endocrinology 136:4147– 4150
Fang S, Steinmetz R, Walker King D, Zeng P, Vogelweid C, Cooper S,
Hangcoc G, Broxmeyer HE, Pescovitz OH 2000 Development of a transgenic
mouse that overexpresses a novel product of the growth hormone-releasing
hormone gene. Endocrinology 141:1377–1383
Phelps CJ, Dalcik H, Endo H, Talamantes F, Hurley DL 1993 Growth hormone-releasing hormone peptide and mRNA are overexpressed in GH-deficient Ames dwarf mice. Endocrinology 133:3034 –3037
Romero MI, Phelps CJ 1997 Identification of growth hormone-releasing
hormone and somatostatin neurons projecting to the median eminence in
normal and growth hormone-deficient Ames dwarf mice. Neuroendocrinology 65:107–116
Festenstein R, Kioussis D 2000 Locus control regions and epigenetic chromatin modifiers. Curr Opin Genet Dev 10:199 –203
Ibata Y, Okamura H, Makino S, Kawakami F, Morimoto N, Chihara K 1986
Light and electron microscopic immunocytochemistry of GRF-like immunoreactive neurons and terminals in the rat hypothalamic arcuate nucleus and
median eminence. Brain Res 370:136 –143
Hurley DL, Wee BE, Phelps CJ 1998 Growth hormone releasing hormone
expression during postnatal development in growth hormone-deficient Ames
dwarf mice: mRNA in situ hybridization. Neuroendocrinology 68:201–209
Gyevai A, Makara GB, Stark E, Palkovits M 1985 Long-term suspension
culture of isolated hypothalamic nuclei of the rat: morphological differentiation and release of substances influencing corticotropin and growth hormone
secretion. Neuroscience 14:519 –533
Lanneau C, Peineau S, Petit F, Epelbaum J, Gardette R 2000 Somatostatin
Balthasar et al. • GHRH-eGFP Transgenic Mice
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
modulation of excitatory synaptic transmission between periventricular and
arcuate hypothalamic nuclei in vitro. J Neurophysiol 84:1464 –1474
Burdakov D, Ashcroft FM 2002 Cholecystokinin tunes firing of an electrically
distinct subset of arcuate nucleus neurons by activating A-type potassium
channels. J Neurosci 22:6380 – 6387
Dickson SL, Leng G, Robinson ICAF 1993 Growth hormone release evoked
by electrical stimulation of the arcuate nucleus in anaesthetized male rats.
Brain Res 623:95–100
Horvath S, Palkovits M 1988 Synaptic interconnections among growth
hormone-releasing hormone (GHRH)-containing neurons in the arcuate nucleus of the rat hypothalamus. Neuroendocrinology 48:471– 476
Poulain P, Carette B 1986 Effects of GRF on paraventricular neurons in slices
of guinea-pig hypothalamus. Brain Res 371:355–359
Bloch B, Baird A, Ling N, Guillemin R 1986 Immunohistochemical evidence
that growth hormone-releasing factor (GRF) neurons contain an amidated
peptide derived from cleavage of the carboxyl-terminal end of the GRF precursor. Endocrinology 118:156 –162
Kiss J, Kocsis K, Csaki A, Gorcs TJ, Halasz B 1997 Metabotropic glutamate
receptor in GHRH and beta-endorphin neurones of the hypothalamic arcuate
nucleus. Neuroreport 8:3703–3707
Daikoku S, Hisano S, Kawano H, Chikamori-Aoyama M, Kagotani Y, Zhang
RJ, Chihara K 1988 Ultrastructural evidence for neuronal regulation of growth
hormone secretion. Neuroendocrinology 47:405– 415
Liposits Z, Merchenthaler I, Paull WK, Flerko B 1988 Synaptic communication between somatostatinergic axons and growth hormone-releasing factor
(GRF) synthesizing neurons in the arcuate nucleus of the rat. Histochemistry
89:247–252
Bertherat J, Dournaud P, Berod A, Normand E, Bloch B, Rostene W, Kordon
C, Epelbaum J 1992 Growth hormone-releasing hormone-synthesizing neurons are a subpopulation of somatostatin receptor-labelled cells in the rat
arcuate nucleus: a combined in situ hybridization and receptor light-microscopic radioautographic study. Neuroendocrinology 56:25–31
Delemarre-van de Waal HA, Burton KA, Kabigting EB, Steiner RA, Clifton
DK 1994 Expression and sexual dimorphism of galanin messenger ribonucleic
acid in growth hormone-releasing hormone neurons of the rat during development. Endocrinology 134:665– 671