Epub: No 2016_1335
Vol. 63, 2016
https://doi.org/10.18388/abp.2016_1335
Review
Overview of the RNA G-quadruplex structures
Magdalena Malgowska, Karolina Czajczynska, Dorota Gudanis, Aleksander Tworak and
Zofia Gdaniec*
Institute of Bioorganic Chemistry, Polish Academy of Sciences, Poznań, Poland
G-quadruplexes are non-canonical secondary structures
which may be formed by guanine rich sequences, both
in vitro and in living cells. The number of biological functions assigned to these structural motifs has grown rapidly since the discovery of their involvement in the telomere maintenance. Knowledge of the G-quadruplexes’
three-dimensional structures plays an important role in
understanding of their conformational diversity, physiological functions, and in the design of novel drugs targeting the G-quadruplexes. In the last decades, structural studies have been mainly focused on the DNA
G-quadruplexes. Their RNA counterparts gained an increased interest along with a still-emerging recognition
of the central role of RNA in multiple cellular processes.
In this review we focus on structural properties of the
RNA G-quadruplexes, based on high-resolution structures available in the RCSB PDB data base and on structural models. In addition, we point out the current challenges in this field of research.
Key words: G-tetrad, U-tetrad, RNA G-quadruplex, NMR, crystallography, nucleic acids structure
Received: 30 May, 2016; revised: 28 June, 2016; accepted: 07 July,
2016; available on-line: 02 November, 2016
INTRODUCTION
G-quadruplex is a structural motif formed by guanosine-rich DNA and RNA molecules or nucleic acids
analogues, such as LNA or PNA (Krishnan-Ghosh et
al., 2004; Randazzo et al., 2004; Burge et al., 2006; Ji et
al., 2011; Russo Krauss et al., 2014). Most of the studied G-quadruplex structures are formed by a single type
of the nucleic acid, however nucleic acids of a different
type (e.g. DNA and RNA) may also interact to adopt a
G-quadruplex fold (Xu et al., 2009; Shrestha et al., 2014).
The expansion of our knowledge on the G-quadruplex structures has become a priority in the last two decades in the medical, biological and chemical research for
a number of reasons. Structures of this type were identified in multiple regions of various viral, prokaryotic and
eukaryotic genomes (Schaffitzel et al., 2001; Cahoon &
Seifert 2009; Shen et al., 2011), as well as multiple cellular RNAs (Kumari et al., 2007; Millevoi et al., 2012; Agarwala et al., 2015). Recently, an in vivo existence of the
DNA and RNA G-quadruplexes has been unequivocally
proven (Biffi et al., 2013; Biffi et al., 2014). The observed
abundance of those structural motifs and their retention
over a long evolutionary period suggest their involvement in multiple biological processes.
One of the first functional studies in which the formation of an RNA G-quadruplex was coupled with a particular biological function concerned the 127-nt fragment
derived from the 5′ end of the HIV gag gene (Sundquist
& Heaphy 1993). Multiple lines of evidence available to
date suggest that the dimerization of the two copies of
HIV-1 genomic RNA is mediated by the formation of
an intermolecular G-quadruplex structure (Awang & Sen
1993; Marquet et al., 1994; Shen et al., 2011). This dimerization process is known to influence multiple stages
of the viral life cycle. Additional studies have revealed
that the G-quadruplex structures are present in both, the
HIV-1 genomic RNA and its DNA copy, and may therefore represent attractive targets for antiviral interventions
(Metifiot et al., 2014). In 2007 Azzalin and co-workers
have demonstrated that the mammalian telomeric DNA
is transcribed into long non-coding RNAs (known as
TERRA RNAs) composed of tandem repeats of the
UUAGGG motif (Azzalin et al., 2007). At that time, the
corresponding short DNA motif was already known to
form a G-quadruplex structure (Wang & Patel 1993; Parkinson et al., 2002; Gavathiotis & Searle 2003; Zhang et
al., 2005; Ambrus et al., 2006). Thus, the discovery of
TERRA RNAs gained a broad interest in the occurrence of the RNA G-quadruplex structures in living cells
and their possible biological roles. Indeed, shortly after,
RNAs composed of the tandem UUAGGG repeats were
shown to adopt a stable G-quadruplex structure (Xu et
al., 2008a; Xu et al., 2008b; Kimura et al., 2009).
Subsequently, numerous studies have shown that the
RNA G-quadruplexes are involved in various biological
processes, including translation regulation, mRNA processing, transcription termination, mRNA localization, as
well as alternative splicing. Most commonly, presence of
a G-quadruplex structure within the transcript results in
either up- or down-regulation of the gene from which
it originates. Although expression of a number of genes
was shown to be altered by the presence of this structural motif within the mRNA molecule, at present little
is known about the mechanisms underlying these processes. The G-quadruplex structure itself may impede
the movement of the pre-initiation complex or the ribosome along the mRNA molecule. Alternatively, a Gquadruplex may recruit protein factors which influence
the transcript in different ways. For a detailed review of
known biological roles of the RNA G-quadruplexes see
(Agarwala et al., 2015). Owing to their broad distribution
and function, the RNA G-quadruplexes quickly became
*
e-mail: [email protected]
Abbreviations: BrG, 8-bromoguanosine; BrU, 5-bromouridine; CD,
Circular Dichroism; d(BrG), 8-bromo-2’-deoxyguanosine; d(BrU),
5-bromo-2’-deoxyuridine; DLS, Dynamic Light Scattering; HIV, Human Immunodeficiency Virus; LNA, Locked Nucleic Acids; NMR, Nuclear Magnetic Resonance; PNA, Peptide Nucleic Acids; RCSB PDB,
Research Collaboratory for Structural Bioinformatics, Protein Data
Bank; SAXS, Small-angle X-ray scattering; TERRA, Telomeric Repeatcontaining RNAs.
2
M. Malgowska and others
Figure 1. Schematic representation of a G-tetrad.
an interesting target for novel drug development strategies, including new antiviral, anticancer and neurological
disease therapies (Collie & Parkinson 2011; Ji et al., 2011;
Xu & Komiyama 2012; Murat et al., 2014). For example, various small molecules have been successfully employed to regulate the translation process via trapping or
disrupting of the G-quadruplex motifs found in multiple
cellular mRNAs (Bugaut et al., 2010; Gomez et al., 2010;
Halder et al., 2011; Faudale et al., 2012; Morris et al.,
2012). The challenge in this field is to find the ligands
which will exhibit high specificity towards the RNA
G-quadruplex targets with minimal or none off-target effects. Recently, an RNA G-quadruplex database,
G4RNA, was created by Garant and co-workers to facilitate systematic research and comparative analyses (Garant et al., 2015).
The fundamental structural unit of the G-quadruplex
is a guanosine-tetrad (G-tetrad, Fig. 1). In a G-tetrad,
each of the four guanine bases is a donor of two hydrogen bonds at the Watson-Crick edge and an acceptor of two hydrogen bonds at the Hoogsteen edge.
Four carbonyl oxygen atoms, directed to the center of
the G-tetrad, form a negatively charged central core of
a G-quadruplex. In order to compensate for the negative charge and to stabilize the G-quadruplex structure,
the presence of monovalent cations, in particular K+ and
to a lesser extent NH4+ and Na+, is required. When the
ionic radius of the cation is relatively small (e.g. in the
case of Na+), the ions can be located in the middle of
a single G-tetrad and coordinate four oxygen atoms. Alternatively, the ion may be embedded between two Gtetrads and coordinate eight oxygen atoms, which is the
case for some larger cations, like K+ or NH4+.
Depending on the nucleic acid strand orientation, a
G-quadruplex can be described as parallel or anti-parallel
(Fig. 2). A parallel G-quadruplex is formed when all four
strands are oriented in the same direction. As a consequence, all residues found in each individual G-tetrad
have the same glycosidic bond conformation (anti-anti-
2016
anti-anti or syn-syn-syn-syn). Antiparallel G-quadruplexes
are formed when at least one DNA/RNA strand runs
in an orientation opposite to the other strands. They
can be further divided into two different types, depending on the number of oppositely oriented strands. The
first type of antiparallel G-quadruplexes is formed when
two strands run in the opposite orientation to the other
two, and the G-tetrads comprise two guanosines in the
syn and two in the anti conformations (syn-syn-anti-anti
and syn-anti-syn-anti). The second type of antiparallel Gquadruplex structures is known as a hybrid-type (3+1)
and occurs when three strands are parallel to each other,
while the fourth strand runs in the opposite direction
(Fig. 2). In the (3+1) G-quadruplex, three guanosines
adopt the same, and the fourth residue exhibits an opposite conformation (syn-anti-anti-anti and anti-syn-syn-syn).
In general, G-quadruplexes may be comprised of one
strand with at least four G-rich fragments, folded to
adopt an intramolecular structure. Alternatively, they may
be formed by two or four separate strands. It should be
emphasized that, to date, all known naturally occurring
RNA G-quadruplexes are parallel stranded, with only one
exception: an unusual G-quadruplex motif found in a 97nt RNA fluorogenic aptamer named Spinach (Huang et
al., 2014; Warner et al., 2014). The strong preference of
the RNA G-quadruplexes to adopt the parallel fold is a
consequence of the strong propensity of the riboguanosine for the anti conformation. The partially locked conformation around the glycosidic bond is due to the steric
hindrance caused by the presence of a C2′ hydroxyl group
which forces the C3′-endo ribose conformation.
Within the G-quadruplex structure, the G-tetrads may
be connected by loops of variable size and sequence.
Based on their arrangement within the structure, three
major loop types may be distinguished: (i) a double
chain reversal loop (also known as a propeller) which
connects the adjacent parallel strands, (ii) a diagonal loop
connecting two opposite antiparallel strands, and (iii) an
edgewise loop (also known as a lateral loop) which connects two adjacent antiparallel strands (Fig. 3). All Gquadruplex structures have four grooves, whose dimensions (either narrow, medium or wide) are defined by
the glycosidic conformation of the adjacent bases in the
tetrad. A more detailed insight into the fundamentals of
the G-quadruplex structure can be found in an excellent
review by Burge and co-workers (Burge et al., 2006).
In contrast to the functional studies, the structural
studies of the RNA G-quadruplexes were performed
less intensively, focusing mainly on the DNA molecules. In consequence, only 18 RNA G-quadruplex
Figure 2. Strand polarities in parallel, antiparallel and hybrid-type antiparallel G-quadruplexes together with a corresponding
syn-anti orientation of guanosine residues.
Strand polarities are indicated as the arrows.
Vol. 63 Overview of the RNA G-quadruplex structures
3
of the molecules, causing further problems in
the spectrum interpretation. Details concerning the peaks assignment strategy, fold determination and calculation of the G-quadruplex
structures can be found in two great review
articles (Webba da Silva 2007; Adrian et al.,
2012).
It should be kept in mind that even a simple 1D 1H NMR spectrum may provide useful
information on the G-quadruplex conformation in the solution. This is due to the fact
that imino proton resonances of the G-tetrads
appear in a characteristic spectral region: between 10–12 ppm. This spectral region, typical
for Hoogsteen-type interactions, is separated
from the imino region, where imino protons
from the Watson-Crick base pairs resonate
(13–14 ppm). Typically, the number of imiFigure 3. Examples of the loop arrangements in inter- and intramolecular
no proton resonances observed in the 10–12
G-quadruplexes.
ppm region corresponds to the number of
The loops are marked in green.
guanosine residues involved in the G-tetrad
formation, unless the structure is symmetric.
structures are currently available in the RCSB PDB
database, including 12 X-ray structures and 6 NMR- Another characteristic feature of the imino proton resoderived structures (Table 1). Although knowledge on nances originating from the hydrogen atoms involved in
existing topologies of the DNA and RNA G-quadru- the G-tetrad formation, especially those originating from
plexes has been growing constantly, a recent analysis by the G-tetrads hidden inside a G-quadruplex structure, is
Sket and Plavec (Sket & Plavec 2015) suggests that it that they can be detected even if the spectra are recordis impossible to predict the G-quadruplex folding to- ed at high temperatures, sometimes over 90ºC. Some of
pology based solely on the oligonucleotide sequence. those resonances do not exchange for deuterium when
This is because the final fold of a given G-quadruplex the solvent is changed from H2O to D2O and can be
depends on multiple factors, such as the number of detected after many hours, days, or even months.
X-ray crystallography is the second method which alguanosine residues in the sequence, the length and the
composition of the nucleic acid sequences connecting lows to determine the 3D G-quadruplex structures with
the G-rich fragments, the syn/anti conformation around the highest resolution. X-ray crystallography has proven
the glycosidic bonds, the presence of chemically modi- to be uniquely informative, since it can provide not only
fied nucleotides, the DNA/RNA concentration and the three-dimensional arrangement of atoms but also inthe nature of the ions stabilizing the structure. Moreo- formation on cation binding sites and hydration patterns.
ver, analysis of the already determined high resolution The biggest challenge of this method is to obtain well
structures of the DNA and RNA G-quadruplexes re- diffracting single crystals. For this reason, various modivealed their great diversity and conformational poly- fications within the G-quadruplex forming DNA/RNA
morphism. For example, it was shown that the same molecules are often introduced, and multiple crystallizad(AGGGTTAGGGTTAGGGTTAGGG)
molecule tion conditions are screened. High purity and homogemay adopt two different G-quadruplex folds depend- neity of the sample are crucial for the crystallization to
ing on the environmental conditions. Its NMR solution be successful. Similarly to the NMR study, high concenstructure obtained in the presence of Na+ ions is an trations of nucleic acids are required for crystallization
antiparallel G-quadruplex with one diagonal and two experiments (e.g., 1 to 2 mM of single-stranded DNA/
lateral loops (Wang & Patel 1993), while in the crystal, RNA). A detailed report on the crystallization methoda parallel G-quadruplex structure with three propeller ology for G-quadruplexes and their complexes with liloops was determined in the presence of K+ ions (Par- gands has been provided by Campbell and co-workers
(Campbell & Parkinson 2007; Campbell et al., 2012).
kinson et al., 2002).
SAXS and DLS are low resolution methods used to
study the size and overall shape of the G-quadruplexes
METHODS FOR STUDYING A 3D G-QUADRUPLEX
in solution. It was shown, using both techniques, that
STRUCTURE
the 5′ guanosine monophosphate in a solution containing potassium ions tends to self-assemble into aggregates
Many experimental methods are used for structural composed of stacking G-tetrad layers (Spindler et al.,
studies of the G-quadruplexes. Among them, NMR 2004; Mariani et al., 2009; Mariani et al., 2010). In fact,
spectroscopy and X-ray crystallography are the only NMR structural data can be supplemented by experimethods which enable determination of the three-dimen- mental information from SAXS, to validate the proposed
sional structures at atomic resolution.
structural models (Gudanis et al., 2016).
The unique feature of the NMR spectroscopy is a
possibility of carrying out experiments under close to
physiological conditions. There are, however, certain lim- RNA G-QUADRUPLEX STRUCTURES
itations of this method. The major one is a requirement
The first structure of an RNA G-quadruplex at the
for the presence of a single conformation in solution,
which gives sharp and well resolved resonances. Another atomic resolution was published in 1992 (Cheong and
limitation is that the samples need to be very pure and Moore 1992). Based on the analysis of the NMR specrelatively highly concentrated (preferably over 1 mM). tra recorded in the presence of 50 mM potassium ions,
Yet, the increased concentration may lead to aggregation it was shown that four strands of r(UGGGGU) form
4
M. Malgowska and others
a helical, parallel-stranded G-quadruplex (PDB ID:
1RAU). In this structure, four G-tetrads (all guanosine residues in the anti conformation) were flanked by
two uridine-tetrads (U-tetrads), one on each end of the
structure (Fig. 4a). U-tetrads were formed by four uracil
residues connected through a cyclic hydrogen-bond pattern, which comes from the interaction between N3H
imino hydrogen atoms of one uridine and O4 carbonyl oxygen atoms of the adjacent bases (Fig. 5a). In the
r(UGGGGU) structure, the U-tetrad formed by the four
3′ uridines appeared to be very stable, its imino proton
resonance (U6 N3H) were observed even at 65°C. The
presence of a U-tetrad at the 5´ end has been proposed
based on the observation of the additional uridine imino
resonance at a temperature below 25°C that was shifted
downfield in relation to a free imino proton resonance.
Additional insight into the structural diversity of the
RNA G-quadruplexes emerged from the crystal structure
of the same r(UGGGGU) molecules, solved at subatomic resolution (0.61 Å) for crystals grown in the presence of Sr2+ ions (PDB ID: 1J8G) (Deng et al., 2001).
Similarly to the previously described solution structure,
r(UGGGGU) in the crystalline state forms a parallel
four-stranded G-quadruplex with all guanines exhibiting
anti conformation, and Sr2+ sandwiched between every
G-tetrad plane. In this structure, two G-quadruplexes
form 5′-5′ intertwined dimers. The dimer structure includes six G-tetrads and two U-tetrads (one at each end
of the dimer, both composed of the 3′ uridines). In turn,
all 5′ uridines stack out, rotate around the backbone of
G2, and form G:U:G:U:G:U:G:U octad motifs (Fig. 5b)
with the neighboring G-quadruplexes (Fig. 4b).
Recently, Fyfe and co-workers (Fyfe et al., 2015) further examined the r(UGGGGU) structure stabilized
by Sr2+ ions, using X-ray crystallography and solution
SAXS analysis. The aim of this study was to elucidate factors that contribute to the high stability of the
RNA G-quadruplexes, much higher than their relative DNA counterparts. It was shown that networks
of water-mediated contacts within the helical grooves
of RNA G-quadruplexes greatly enhance their overall
stability. Comparison of atomic coordinates of the four
r(UGGGGU) G-quadruplex crystal structures coming
from this study (PDB IDs: 1J8G, 4RKV, 4RJ1, 4RNE)
revealed a considerable conformational variability of
the 3′ U-tetrad. In addition, the SAXS-derived solution
structure of r(UGGGGU) was in a good agreement
with the dimeric assembly observed in the crystal structure, however, differing from the conformation observed by NMR spectroscopy (Cheong & Moore 1992).
This difference was likely related to the type of coordinated cation, Sr2+ versus K+.
2016
The LNAs are nucleotide analogues that are locked in
a C3′-endo sugar conformation by a methylene bridge between 2′-O and 4′-C atoms in the ribose, which leads to
an anti conformation of the glycosidic torsion angle and
reduces the overall conformational flexibility. This locked
conformation resembles the conformation of RNA residues, thus it was not surprising that the l(TGGGT), in
a solution containing potassium ions, folds into a Gquadruplex structure (NMR study, PDB ID: 1S9L; Randazzo et al., 2004) very similar to the one determined
by Cheong and Moore for r(UGGGGU) (Cheong &
Moore 1992), as shown in Fig. 4a and c. The main difference between these two solution structures concerns
the presence or absence of the terminal tetrads. In contrast to the NMR spectrum of r(UGGGGU), no thymine imino resonances were observed in the l(TGGGT)
spectrum. On the other hand, the presence of the Ttetrad (Fig. 5c) was observed in the crystal structure
of l(TGGGT) G-quadruplex (Fig. 4d). This 3′ T-tetrad
is stabilized by cyclic N3H – O4 hydrogen bonds and
by a perfect stacking of the bases on the six-membered
rings of the preceding G-tetrad (PDB ID: 4L0A; Russo
Krauss et al., 2014). Interestingly, two such parallel Gquadruplexes interact via stacking of the two terminal 3′
T-tetrads to form an elongated dimer. By this observation, a novel, opposite polarity (tail-to-tail) arrangement
was reported, as only head-to-head and head-to-tail interfaces had been shown previously in the crystal structures of G-quadruplexes (Russo Krauss et al., 2014).
A comparative analysis of the described helical, parallel-stranded tetramolecular RNA G-quadruplexes allows
to draw several conclusions on their general structural
properties. Typically, in a solution containing potassium
ions, G-quadruplexes of this type occur in a monomeric
form, while crystallization probably enhances formation
of dimers and other highly ordered arrangements. The
terminal uridine residues can form U-tetrads which are
always more stable when formed by 3′ uridines, than 5′
Us. In the RNA G-quadruplex crystal structure, the Utetrad plane seems quite distorted, and the four uridines
are tilted. In contrast, the T-tetrad, if present in the
LNA G-quadruplex structure, is very regular and perfectly stacks on the six-membered rings of the preceding
G-tetrad.
Another group of RNA G-quadruplexes, extensively
studied because of their great functional potential, originates from the human telomeric repeats. As mentioned
before, the possibility of a G-quadruplex formation by
the TERRA molecules was first demonstrated by Xu and
co-workers (Xu et al., 2008b). Based on the analysis of
the NMR spectra recorded for r(UAGGGUUAGGGU),
i.e. two repeats of the telomeric motif, in the pres-
Figure 4. Comparison of the structures of: a) r(UGGGGU), 1 RAU; b) r(UGGGGU), 1J8G; c) l(TGGGT), 1S9L and d) l(TGGGT), 4L0A.
The residues are marked as follow: guanosines are green, uridines – magenta, and LNA tymidines – dark purple.
Vol. 63 Overview of the RNA G-quadruplex structures
5
Figure 5. Schematic representation of: a) U-tetrad, b) G:U:G:U:G:U:G:U octad and c) T-tetrad.
ence of sodium ions, the authors proposed a bimolecular, parallel stranded G-quadruplex structural model.
The model was composed of three G-tetrads with two
double-chain-reversal UUA loops. Almost at the same
time, a high resolution NMR structure in potassium solution was published for the same TERRA molecule,
r(UAGGGUUAGGGU), by Martadinata & Phan (PDB
ID: 2KBP; Martadinata & Phan 2009). This structure
showed good agreement with the previously described
model (Fig. 6a). The observed propeller-type parallelstranded RNA G-quadruplex involved all guanosine residues in the anti conformation. Two double-chain-reversal
UUA loops were located at the medium-size grooves,
linking two adjacent parallel strands and bridging three
G-tetrad layers. The apparent similarity between the two
RNA structures stays in high contrast to the results reported for human telomeric DNA sequences for which
various G-quadruplex topologies were observed in the
presence of potassium and sodium ions (Martadinata &
Phan 2009). This structural conservation of the RNA Gquadruplex structures was attributed to the preference of
the riboguanosine to adopt the anti conformation.
Martadinata and Phan complemented their study with
structural analysis of two truncated variants of the previously described 12-nt TERRA RNA. They analyzed 10nt r(GGGUUAGGGU) and 9-nt r(GGGUUAGGG) using gel electrophoresis, CD and NMR spectroscopy, and
observed dimerization of bimolecular G-quadruplexes
in both cases. Additionally, 9-nt RNA seemed to adopt
some higher-order structures. These results suggested
that the presence of the 5′ UA and 3′ U flanking residues
prevented aggregation of the r(UAGGGUUAGGGU)
G-quadruplexes (Martadinata & Phan 2009).
High-resolution structure of the 10-nt TERRA was
determined a few years later by the same researchers
(PDB ID: 2M18) (Martadinata & Phan 2013). The solution structure in the presence of potassium ions revealed
many structural details of the stacking interface and loop
conformations. Two G-quadruplex units were stacked on
their 5′ ends (Fig. 6b). The stacking induced considerable loop rearrangements in comparison with the previously reported 12-nt TERRA structure. Adenine bases
in each UUA loop were positioned coplanar with the
5′ G-tetrad. The N1 nitrogen atoms of two adenosines
were hydrogen-bonded to 2′-OH groups of the adjacent
guanosine residues forming a specific A∙(G∙G∙G∙G)∙A
hexad (Fig. 7a). The presence of this hexad led to increased stacking contacts between the two G-quadruplex
units and contributed to the enhanced stabilization of
the stacking conformation. The same stacking interaction
and loop conformation was reported in 2011 by Collie
and co-workers for a unique high-resolution structure
of TERRA in a complex with a small-molecule ligand
(PDB ID: 3MIJ), which will be described in the next
section (Collie et al., 2011).
One year earlier, the same group managed to
solve the crystal structure of a modified variant of
the previously described 12-nt TERRA sequence,
r(BrUAGGGUUAGGGU) (PDB ID: 3IBK; Collie et al.,
2010). It was in good agreement with the previously described NMR structure of the unmodified RNA (Martadinata and Phan 2009). Both G-quadruplex structures are
Figure 6. The comparison of two TERRA repeats structures: a) r(UAGGGUUAGGGU), 2KBP; b) r(GGGUUAGGGU), 2M18; c)
r(UBrAGGGUUAGGGU), 3IBK.
The residues are marked as follow: guanosines are green, uridines – magenta, and adenosines – blue.
6
M. Malgowska and others
2016
Figure 7. Schematic representation of: a) A∙(G∙G∙G∙G)∙A hexad and b) BrU:A:BrU:A tetrad occuring in TERRA G-quadruplexes
bimolecular, parallel-stranded, and possess two doublechain-reversal UUA loops. However, in the crystal structure, the two G-quadruplex units were interlocked with
each other at their 5′ ends. This interaction included a
formation of two stacked BrU:A:BrU:A tetrads between
the two G-quadruplex units, involving the first two residues of each RNA strand (Fig. 6c and 7b).
It was shown that RNA composed of only one telomeric repeat, r(UAGGGU), is also capable of forming
a G-quadruplex structure (Xu et al., 2010). The detailed
analysis of NMR spectra recorded in the presence of
sodium and potassium ions revealed that r(UAGGGU)
forms a tetramolecular, parallel-stranded G-quadruplex,
which is capped and highly stabilized by a 3′ U-tetrad
(Fig. 8). In addition, presence of the adenosine residue
seemed to hinder the 5′ U-tetrad formation.
Figure 8. The model of tetramolecular parallel r(UAGGGU) Gquadruplex (Xu et al., 2010).
G-tetrads are marked in green and the 3’ U-tetrad is shown in magenta.
Martadinata and co-workers investigated physiologically relevant long TERRA sequences (of up to 96-nt
in length) and addressed a question about the arrangement of the G-quadruplex blocks along these molecules (Martadinata et al., 2011). A molecular dynamics
simulations study on an eight-repeat sequence which
is long enough to form two consecutive G-quadruplex
blocks connected by the UUA linker, was performed
for the four possible stacking modes: head-to-head
(5′-5′), tail-to-tail (3′-3′), tail-to-head (3′-5′) and headto-tail (5′-3′), as shown in Fig. 9. Only the head-to-tail
arrangement was not stable throughout the simulations, while in the head-to-head interaction, the contiguous stacking of the loop bases and loop-loop interactions between two subunits were observed. Based
on these results, the authors have proposed a structural model for long human TERRA molecules, in
which the G-quadruplexes are arranged in a “beadson-a-string” fashion, i.e. they can move relatively independently of each other and are constrained only by
the connecting linkers (Fig. 10).
Another distinct group of RNA sequences known
to adopt a G-quadruplex fold contains the GGAGG
stretches. A common feature of these structures is the
presence of A∙(G∙G∙G∙G)∙A hexad and formation of dimers through the hexad-hexad stacking (Liu et al., 2002;
Lipay & Mihailescu 2009; Mashima et al., 2009; Medic
et al., 2014; Malgowska et al., 2014). The A∙(G∙G∙G∙G)∙A
hexad differs from the one formed by the 10-nt TERRA
sequence described above. In this hexad, two adenosine
residues interact with a canonical G-tetrad. Their N6H
amino hydrogens and N7 nitrogen atoms are hydrogenbonded to guanosine N3 nitrogen atom and N2H amino
hydrogen, respectively (Fig. 11).
Figure 9. Schemes of the possible stacking modes between two consecutive TERRA G-quadruplex units.
a) 5’-5’; b) 3’-3’; c) 3’-5’; d) 5’-3’. The UUA loops are colored in dark green.
Vol. 63 Overview of the RNA G-quadruplex structures
7
Figure 10. A schematic model of a long human TERRA arranged as “beads-on-a-string”.
The UUA loops and linkers are colored in dark green.
Figure 11. Schematic representation of an A∙(G∙G∙G∙G)∙A hexad.
Three sequence variants of RNA molecules containing a single GGAGG motif: UGGAGGU, GGAGGA
and AGGAGGA, are known to preferentially fold into
bimolecular G-quadruplexes with the characteristic
A∙(G∙G∙G∙G)∙A hexad motif. NMR studies conducted in
solutions containing potassium ions have shown that, indeed, all the structures associate by stacking through the
interface of two hexads (Lipay & Mihailescu 2009; Medic
et al., 2014; Malgowska et al., 2014). This structural model is schematically shown in Fig. 12.
In addition, two RNA G-quadruplex structures
formed by molecules comprising two GGAGG segments are available in the RSCB PDB database (PDB
entries: 1MY9, 2RQJ). In both cases the structure was
determined by NMR spectroscopy in the presence of
potassium ions. In the first structure (Liu et al., 2002),
RNA with two GGAGG stretches joined by a UUUU
segment, r(GGAGGUUUUGGAGG), folds into an intramolecular parallel G-quadruplex. Analysis revealed presence of a G-tetrad, UUUU double-chain reversal loop,
and A∙(G∙G∙G∙G)∙A hexad. Furthermore, two G-quad-
Figure 12. Dimerization of bimolecular G-quadruplexes formed
by short sequences comprising one r(GGAGG) motif.
G-tetrads are marked in green and the adenosine residues participating in the A∙(G∙G∙G∙G)∙A hexad formation are shown in blue.
ruplex units dimerize through the head-to-head stacking interactions, which occur between the interfaces of
the two hexads (Fig. 13a). A similar type of RNA dimer
is formed by r(GGAGGAGGAGGA) (PDB ID: 2RQJ;
Mashima et al., 2009), suggesting that even a single nucleotide linker between the two GGAGG motifs allows
the G-quadruplex structure formation (Fig. 13b).
Another interesting class of the RNA G-quadruplexes
is represented by a group of the crystal structures determined in the Sundaralingam laboratory (Pan et al., 2003;
Pan et al., 2003a; Pan et al., 2003b; Pan et al., 2006a; Pan
et al., 2006b). Analysis of these structures has revealed
a number of novel and unexpected features concerning the tetramolecular G-quadruplexes. In general, the
overall conformation of these RNAs with comparable sequences, rUd(BrG)r(AGGU), rUd(BrG)
r(UGGU), rUd(BrG)r(GUGU), d(BrU)r(GAGGU)
and d(BrU)r(GIGGU) is similar. All fold into tetramolecular, parallel stranded G-quadruplexes
which, with the exception of rUd(BrG)r(UGGU),
dimerize in a head-to-head alignment. All of the
guanosine residues form G-tetrads and all the 3′
terminal uridines form buckled U-tetrads stabilized by one cyclic N3H – O4 hydrogen bond.
The 5′ terminus of these structures shows a
variety of interaction patterns: stacking d(BrU)
r(GAGGU), d(BrU)r(GIGGU), groove binding
rUd(BrG)r(AGGU), or intercalation r(U)d(BrG)
r(GUGU). In d(BrU)r(GAGGU) structure (PDB
Figure 13. Comparison of G-quadruplex structures adopted by sequencID: 1J6S), the stacking interface involves a 5′
es comprising two r(GGAGG) motifs: a) r(GGAGGUUUUGGAGG), 1MY9;
d(BrU)-tetrad formed by one subunit of the diand b) r(GGAGGAGGAGGA), 2RQJ.
mer and a G:U:G:U:G:U:G:U octad coming from
Guanosine residues are shown in green, uridines in magenta, and adenthe second subunit, which contributes to the inosines in blue.
8
M. Malgowska and others
2016
Figure 14. Comparison of X-ray structures of: a) d(BrU)r(GAGGU), 1J6S; b) d(BrU)r(GIGGU), 2GRB; c) rUd(BrG)r(AGGU), 1MDG; d) r(U)
d(BrG)r(GUGU), 2AWE; e) rUd(BrG)r(UGGU), 1P79.
The guanosines residues are shown in green, uridines in magenta, adenosines in blue and inosines in orange.
Figure 15. Schematic representation of: a) U:(G:G:G:G) pentad, and b) A:U:A:U:A:U:A:U octad.
creased stacking surface between the two units (Fig. 14a).
The octad is formed by four 5′ d(BrU) that swing out of
the G-quadruplex core and interact with the preceding
G-tetrad by hydrogen bonding. Stacking of the symmetric G:U:G:U:G:U:G:U octad results in the co-axial packing of two G-quadruplex units (Pan et al., 2003). In contrast, a non-co-axial packing mode within a dimer of two
G-quadruplexes was observed in the crystal structure
of d(BrU)r(GIGGU) (PDB ID: 2GRB; Fig. 14b). Stacking of two asymmetric U:(G:G:G:G) pentads (Fig. 15a),
found at the 5′ ends of two G-quadruplex units, causes
the displacement of two G-quadruplex axes by about 7.4
Å (Pan et al., 2006b).
The groove binding pattern of interaction of the
two G-quadruplex subunits was observed in the crystal structure of rUd(BrG)r(AGGU) (PDB ID: 1MDG).
In this dimeric structure, the adenine residues form
Figure 16. The models of G-quadruplexes composed of two
UGG and CGG repeats: a) r(UGGUGGU) and b) r(GCGGCGGC).
G-tetrads are marked in green and the U-tetrads are shown in magenta and cytidine residues are colored in purple.
Vol. 63 Overview of the RNA G-quadruplex structures
9
Figure 17. Schematic representation of G:C:G:C tetrads from: a) r(GCGGCGGC), and b) r(GC(BrG)GCGGC) G-quadruplexes.
Figure 18. The structural model of r(GC(BrG)GCGGC).
The residues are marked as follow: guanosines are green and cytidines are dark purple.
two A-tetrads and further interact in the reverse Hoogsteen pairing scheme with the 5′ uridines to form two
A:U:A:U:A:U:A:U octads (Fig. 14c and 15b). In addition to the groove binding interaction, this dimer is
stabilized by intercalation of the G-tetrads immediately
adjacent to the 5′ uridines (Pan et al., 2003a). Another
example of the intercalation-type interaction resulting in
the dimerization process is represented by the structure
of r(U)d(BrG)r(GUGU) (PDB ID: 2AWE). In this case,
swapping of the 5′ U-tetrads was observed (Fig. 14d), as
well as a bulged-out conformation of the internal uridine
bases (Pan et al., 2006a). The rUd(BrG)r(UGGU) G-quadruplex (PDB ID: 1P79) was also shown to possess the
bulged-out U motif (Fig. 14e; Pan et al., 2003b), which
indicates that substitution of purine (A, G or I) with uridine may lead to a bulged-out conformation of the pyrimidine within a G-quadruplex structure.
The potential of RNAs composed of two and four
AGG, CGG or UGG trinucleotide repeats to form Gquadruplex structures is intensively studied in our laboratory (Malgowska et al., 2014; Gudanis et al., 2016). Expansion of those trinucleotide motifs was linked with
many neurological disorders. In general, we have shown
that all of these molecules can fold into the G-quadru-
Figure 19. The structure of the r(UAGGGUUAGGGU) – acridine
complex, 3MIJ.
Guanosine residues are indicated in green, uridines in magenta,
adenosines in blue and two acridine ligand molecules in grey.
plex structures. However, in case of the CGG-repeat
RNAs, the G-quadruplex formation competes with their
strong tendency to form duplex and hairpin structures.
We also demonstrated that in a solution containing potassium ions all oligoribonucleotides comprising two
trinucleotide repeats fold preferentially into bimolecular
G-quadruplexes with distinct structural motifs which are
characteristic of the type of repeats.
Our recent study has shown that RNA which contains
two AGG repeats, r(AGGAGGA), forms a dimer of bimolecular G-quadruplexes. The interaction between the
two subunits involves stacking of two A∙(G∙G∙G∙G)∙A
hexads. The observed structure appears to be similar to
the previously described RNA G-quadruplex containing
the GGAGG stretches (Fig. 12). All experimental data
indicated that r(UGGUGGU) adopts a symmetrical tetramolecular parallel G-quadruplex structure with four
G-tetrads and three U-tetrads (Fig. 5a, 16a), the 3′ U-tetrad being the most stable. Although there is no known
Figure 20. Chemical structure of the RNA G-quadruplex-binding ligands: a) carboxyPDS, b) NaphthoTASQ, c) CyT.
10
M. Malgowska and others
2016
Table 1. Summary of the published RNA G-quadruplex structures.
RNA G-quadruplex structure with an internal U-tetrad,
the presence of imino resonance assigned to the internal uridine residue, which was observed even at a high
temperature, indicated the formation of a stable U-tetrad
accommodated in the center of the G-quadruplex. The
5′ U-tetrad was less stable and its imino proton was observed only below 25°C (Malgowska et al., 2014).
Very interesting results were also obtained for molecules composed of two repeats of the CGG motif.
In case of r(GCGGCGGC), a tetramolecular, parallel,
highly symmetrical, interlocked G-quadruplex dimer was
found (Fig. 16b). It included four G-tetrads and two
mixed G:C:G:C tetrads (Fig. 17a). However, when one
of the guanosine residues was replaced by the 8-bromoguanosine, r(GC(BrG)GCGGC), a totally novel, tetramolecular, antiparallel architecture of the RNA G-quadruplexes was obtained (Fig. 18). In our study, we have
provided evidence that in solution, an antiparallel RNA
G-quadruplex is formed by the self-association of two
duplexes via the major groove. In this G-quadruplex,
two BrG3:G6:BrG3:G6 tetrads are sandwiched between
mixed G:C:G:C tetrads (Fig. 17b). The antiparallel fold
is facilitated by the presence of an 8-bromoguanosine
residue, which initially promotes formation of a stable
BrG:G mismatch and subsequently induces the formation
of BrG3:G6:BrG3:G6 tetrads (Gudanis et al., 2016).
CHEMICAL TARGETING OF RNA G-QUADRUPLEXES
Our expanding knowledge on the functional role of
the RNA G-quadruplexes in living cells raises the need
for highly selective molecular tools that bind to these
structures with high affinity. This is a goal of high importance especially in the field of medical research (Kerwin 2000; Le et al., 2012; Biffi et al., 2013; Biffi et al.,
2014; Xiong et al., 2015). So far, a wide range of smallmolecule ligands has been identified to exhibit selectivity for G-quadruplexes over single- or double stranded
nucleic acids (Zhang et al., 2014). Many of these small
molecules comprise heterocyclic ring systems, including
anthraquinones, pyridostatins, acridines, perylenes and
porphyrins (Vummidi et al., 2013), which are capable of
interacting with the terminal G-tetrads of RNA G-quadruplex structures. However, most of these compounds
have been discovered by targeted screening of smallmolecule libraries, rather than by rational design. This is
due to a very limited availability of structural data for
the G-quadruplex-ligand complexes. Moreover, the available structures are dominated by crystallographic studies
of complexes in which DNA molecules were used. Only
one high-resolution RNA G-quadruplex-ligand structure
has been reported to date. The ligand belongs to the
family of 3,6-disubstituted acridines and was shown to
bind the TERRA molecules (Collie et al., 2011). In the
crystal structure of this complex (PDB ID: 3MIJ), two
ligand molecules stack side-by-side on the 5′ G-tetrad
of a bimolecular, parallel-stranded G-quadruplex. Two
such G-quadruplex subunits interact in a head-to-head
manner, by this way sandwiching two layers of ligand
molecules (Fig. 19). Ligand binding induces a substantial reorganization of the G-quadruplex loop conformation. The adenine residues from the UUA reversal loops
and the incomplete 5′ UA loops align in the 5′ G-tetrad
plane and form a G:A:G:A:G:A:G:A octad. In consequence, the surface available for the π-π ligand stacking becomes markedly extended. The formation of this
platform is stabilized by multiple hydrogen bonds with
the 2′-OH groups of the UUA loops. The ligand itself
is hydrogen-bonded to the RNA molecules. A weak hydrogen bond between the amide carbonyl group of the
Vol. 63 Overview of the RNA G-quadruplex structures
ligand side chain and the N3 nitrogen of the 5′ U has
been determined.
In comparison to an analogous DNA complex, some
significant differences occur. The DNA G-quadruplex
complex with the acridine ligand (PDB ID: 3QCR) has a
1:1 stoichiometry with a single ligand molecule bound on
the 5′ G-tetrad plane. In contrast, the TERRA-acridine
ligand complex (PDB ID: 3MIJ) has a 2:1 stoichiometry
of acridine molecule recognition. Furthermore, there are
no loop-acridine contacts in the DNA complexes and no
G:A:G:A:G:A:G:A octad. Most importantly, the conformational change within the TERRA loops after ligand
binding suggests that rational design of ligands specific
towards certain G-quadruplexes cannot be solely based
on their native structures (Collie et al., 2011).
The structural similarity between scaffolds of the parallel DNA and RNA G-quadruplexes makes it challenging to design small molecules that provide recognition
selectivity only for the RNA. However, recently it was
shown that a small molecule, carboxypyridostatin (carboxyPDS) (Fig. 20a), selectively stabilizes the RNA over
the DNA G-quadruplexes (Di Antonio et al., 2012). This
unique property may allow for selective identification
and visualization of the RNA G-quadruplexes in vivo.
Indeed, it was shown that carboxyPDS can selectively
target and trap the RNA G-quadruplexes versus DNA
G-quadruplex structures within a cellular context (Biffi
et al., 2014). Other ligands, NaphthoTASQ and CyT
(Fig. 20b, c), were also proposed for detection and visualization of the RNA G-quadruplexes in vivo (Laguerre et
al., 2015; Xu et al., 2015). Although both showed a very
high selectivity for G-quadruplexes compared to other
structural motifs, they were not able to discriminate between the DNA and RNA G-quadruplex variants.
The RNA G-quadruplex structures appear to be involved in a much wider range of biological processes
than their DNA counterparts (Eddy & Maizels 2007;
Huppert et al., 2008; Millevoi et al., 2012). Thus, it is
possible that research efforts will soon focus mainly on rational design of small molecules targeting the
RNA G-quadruplexes (Balasubramanian & Neidle 2009;
Satyanarayana et al., 2010; Morris et al., 2012).
CONCLUSIONS
The number of known DNA and RNA G-quadruplex structures is still very limited when compared to
the large number of potential G-quadruplex-forming
sequences predicted by bioinformatic analyses (Huppert
& Balasubramanian 2005; Huppert et al., 2008; Huppert 2008). This observation strongly suggests that a
large number of diverse G-quadruplex topologies is still
unknown, waiting to be explored. In fact, a new RNA
G-quadruplex motif of unusual topology has been identified very recently in an in vitro selected RNA aptamer
(known as Spinach) that binds a GFP-like ligand and activates its green fluorescence (Huang et al., 2014; Warner
et al., 2014). In this structure, a three-tetrad G-quadruplex core is composed of two G-tetrads stacked above
a mixed-sequence tetrad. The tetrads are connected by
five loops of various length which are composed from
one up to 34-nt. The most unexpected feature of this
G-quadruplex motif is its antiparallel topology that is
unprecedented for RNA G-quadruplexes. We believe
that multiple areas of research will greatly benefit from
a growing number of high-resolution structures of the
RNA G-quadruplexes. Together with better understanding of the G-quadruplex topologies they will contribute
11
to the identification of new G-quadruplex ligands as
possible drug candidates for future clinical applications.
Acknowledgements
This work was supported by the Ministry of Science
and Higher Education of the Republic of Poland by the
KNOW program and National Science Center (NCN)
under Grant No. UMO-2014/13/B/ST5/04144.
REFERENCES
Adrian M, Heddi B, Phan AT (2012) NMR Spectroscopy of G-Quadruplexes. Methods 57: 11–24. doi:10.1016/j.ymeth.2012.05.003
Agarwala P, Pandey S, Maiti S (2015) The Tale of RNA G-Quadruplex. Org Biomol Chem 13: 5570–5585. doi:10.1039/C4OB02681K
Ambrus A, Chen D, Dai J, Bialis T, Jones R, Yang D (2006) Human
telomeric sequence forms a hybrid-type intramolecular g-quadruplex
structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res 34: 2723–2735. doi:10.1093/nar/gkl348
Awang G, Sen D (1993) Mode of Dimerization of HIV-1 Genomic
RNA. Biochemistry 32: 11453–11457. doi:10.1021/bi00093a024
Azzalin CM, Reichenbach P, Khoriauli L, Giulotto E, Lingner J (2007)
Telomeric repeat containing RNA and RNA surveillance factors at
mammalian chromosome ends. Science 318: 798–801. doi:10.1126/
science.1147182
Balasubramanian S, Neidle S (2009) G-Quadruplex nucleic acids as
therapeutic targets. Curr Opin Chem Biol 13: 345–353. doi:10.1016/j.
cbpa.2009.04.637
Biffi G, Tannahill D, McCafferty J, Balasubramanian S (2013) Quantitative visualization of DNA G-quadruplex structures in human cells.
Nature Chem 5: 182–186. doi:10.1038/nchem.1548
Biffi G, Di Antonio M, Tannahill D, Balasubramanian S (2014) Visualization and selective chemical targeting of RNA G-quadruplex
structures in the cytoplasm of human cells. Nature Chem 6: 75–80.
doi:10.1038/nchem.1805
Bugaut A, Rodriguez R, Kumari S, Hsu STD, Balasubramanian S
(2010) Small molecule-mediated inhibition of translation by targeting a native RNA G-quadruplex. Organic & Biomol Chem 8: 27712776. doi:10.1039/c002418j
Burge S, Parkinson GN, Hazel P, Todd AK, Neidle S (2006) Quadruplex DNA: sequence, topology and structure. Nucleic Acids Res 34:
5402–5415. doi:10.1093/nar/gkl655
Cahoon, LA, Seifert HS (2009) An alternative DNA structure is necessary for pilin antigenic variation in neisseria gonorrhoeae. Science
325: 764–767. doi:10.1126/science.1175653
Campbell NH, Parkinson GN (2007) Crystallographic studies of
quadruplex nucleic acids. Methods 43: 252–263. doi:10.1016/j.ymeth.2007.08.005
Campbell NH, Collie GW, Neidle S (2012) Crystallography of DNA
and RNA G-quadruplex nucleic acids and their ligand complexes. Curr Protocols in Nucleic Acid Chem. Chapter 17: Unit17.6.
doi:10.1002/0471142700.nc1706s50
Cheong C, Moore PB (1992) Solution structure of an unusually stable
RNA Tetraplex containing G- and U-quartet structures. Biochemistry
31: 8406–8414. doi:10.1021/bi00151a003
Collie GW, Parkinson GN (2011) The application of DNA and RNA
G-quadruplexes to therapeutic medicines. Chem Soc Rev 40: 5867–
5892. doi:10.1039/c1cs15067g
Collie GW, Sparapani S, Parkinson GN, Neidle S (2011) Structural basis of telomeric RNA quadruplex–acridine ligand recognition. J Am
Chem Soc 133: 2721–2728. doi:10.1021/ja109767y
Deng, J, Xiong Y, Sundaralingam M (2001) X-Ray analysis of an
RNA tetraplex (UGGGGU)4 with divalent Sr2+ ions at subatomic resolution (0.61 Å). Proc Natl Acad Sci USA 98: 13665–13670.
doi:10.1073/pnas.241374798
Deng Z, Norseen J, Wiedmer A, Riethman H, Lieberman PM (2009)
TERRA RNA binding to TRF2 facilitates heterochromatin formation and orc recruitment at telomeres. Molecular Cell 35: 403–413.
doi:10.1016/j.molcel.2009.06.025
Di Antonio M, Biffi G, Mariani A, Raiber EA, Rodriguez R, Balasubramanian S (2012) Selective RNA versus DNA G-quadruplex targeting by in situ click chemistry. Angewandte Chemie International Edition 51: 11073–11078. doi:10.1002/anie.201206281
Eddy J, Maizels N (2007) Conserved elements with potential to form
polymorphic G-quadruplex structures in the first intron of human
genes. Nucleic Acids Res 36: 1321–1333. doi:10.1093 /nar/gkm1138
Faudale M, Cogoi S, Xodo LE (2012) Photoactivated cationic alkyl-substituted porphyrin binding to g4-RNA in the 5′-UTR of
KRAS oncogene represses translation. Chem Commun 48: 874–876.
doi:10.1039/C1CC15850C
Fyfe AC, Dunten PW, Martick MM, Scott WG (2015) Structural variations and solvent structure of r(UGGGGU) quadruplexes
12
M. Malgowska and others
stabilized by Sr2+ Ions. J Mol Biol 427: 2205–2219. doi:10.1016/j.
jmb.2015.03.022
Garant JM, Luce MJ, Scott MS, Perreault JP (2015) G4RNA: An RNA
G-quadruplex database. Database 2015: 1–5. doi:10.1093/database/
bav059
Gavathiotis E, Searle MS (2003) Structure of the parallel-stranded
DNA quadruplex d(TTAGGGT)4 containing the human telomeric
repeat: evidence for A-Tetrad formation from NMR and molecular dynamics simulations. Organic & Biomol Chemi 1: 1650–1656.
doi:10.1039/b300845m
Gomez D, Guedin A, Mergny J-L, Salles B, Riou J-F, Teulade-Fichou
M-P, Calsou P (2010) A G-quadruplex structure within the 5′-UTR
of TRF2 mRNA represses translation in human cells. Nucleic Acids
Res 38: 7187–7198. doi:10.1093/nar/gkq563
Gudanis D, Popenda L, Szpotkowski K, Kierzek R, Gdaniec Z (2016)
Structural characterization of a dimer of RNA duplexes composed
of 8-bromoguanosine modified CGG trinucleotide repeats: a novel
architecture of RNA quadruplexes. Nucleic Acids Res 44: 2409–2416.
doi:10.1093/nar/gkv1534
Halder K, Largy E, Benzler M, Teulade-Fichou MP, Hartig JS (2011)
Efficient suppression of gene expression by targeting 5′-UTR-based
RNA quadruplexes with bisquinolinium compounds. Chem Bio Chem
12: 1663–1668. doi:10.1002/cbic.201100228
Huang H, Suslov NB, Li NS, Shelke SA, Evans ME, Koldobskaya Y,
Rice PA, Piccirilli JA (2014) A G-quadruplex-containing RNA activates fluorescence in a GFP-like fluorophore. Nature Chem Biol 10:
686–691. doi:10.1038/nchembio.1561
Huppert JL, Balasubramanian S (2005) Prevalence of quadruplexes in
the human genome. Nucleic Acids Res 33: 2908–2916. doi:10.1093/
nar/gki609
Huppert JL, Bugaut A, Kumari S, Balasubramanian S (2008) G-quadruplexes: the beginning and end of UTRs Nucleic Acids Res 36: 6260–
6268. doi:10.1093/nar/gkn511
Huppert JL (2008) Hunting G-quadruplexes. Biochimie 90: 1140–1148.
doi:10.1016/j.biochi.2008.01.014
Ji X, Sun H, Zhou H, Xiang J, Tang Y, Zhao C (2011) Research
progress of RNA quadruplex. Nucleic Acid Therapeutics 21: 185–200.
doi:10.1089/nat.2010.0272
Kerwin S. (2000) G-quadruplex DNA as a target for drug design. Curr
Pharmaceutical Design 6: 441–471. doi:10.2174/1381612003400849
Kimura T, Xu Y, Komiyama M (2009) Human Telomeric RNA
r(UAGGGU) Sequence forms parallel tetraplex structure with
U-quartet. Nucleic Acids Symposium Series 53: 239–240. doi:10.1093/
nass/nrp120
Krishnan-Ghosh Y, Stephens E, Balasubramanian S (2004) A PNA4
quadruplex. J Am Chem Soc 126: 5944–5945. doi:10.1021/ja031508f
Kumari S, Bugaut A, Huppert JL, Balasubramanian S (2007) An RNA
G-quadruplex in the 5′ UTR of the NRAS proto-oncogene modulates translation. Nature Chem Biol 3: 218–221. doi:10.1038/nchembio864
Laguerre A, Hukezalie K, Winckler P, Katranji F, Chanteloup G, Pirrotta M, Perrier-Cornet JM, Wong JMY, Monchaud D (2015) Visualization of RNA-quadruplexes in live cells. J Am Chem Soc 137:
8521–8525. doi:10.1021/jacs.5b03413
Le TVT, Han S, Chae J, Park HJ (2012) G-quadruplex binding ligands:
from naturally occurring to rationally designed molecules. Curr Pharmaceutical Design 18: 1948–1972. doi:10.2174/138161212799958431
Lipay JM, Mihailescu MR (2009) NMR spectroscopy and kinetic studies of the quadruplex forming RNA r(UGGAGGU). Mol Bio Systems
5: 1347–1355. doi:10.1039/b911555b
Liu H, Matsugami A, Katahira M, Uesugi S (2002) A dimeric RNA
quadruplex architecture comprised of two G:G(:A):G:G(:A) hexads, G:G:G:G tetrads and UUUU loops. J Mol Biol 322: 955–970.
doi:10.1016/S0022-2836(02)00876-8
Malgowska M, Gudanis D, Kierzek R, Wyszko E, Gabelica V, Gdaniec Z (2014) Distinctive structural motifs of RNA G-quadruplexes
composed of AGG, CGG and UGG trinucleotide repeats. Nucleic
Acids Res 42: 10196–10207. doi:10.1093/nar/gku710
Mariani P, Spinozzi F, Federiconi F, Amenitsch H, Spindler L,
Drevensek-Olenik I (2009) Small angle X-ray scattering analysis of
deoxyguanosine 5′-monophosphate self-assembing in solution: nucleation and growth of G-quadruplexes. J Phys Chem B 113: 7934–
44. doi:10.1021/jp809734p
Mariani P, Spinozzi F, Federiconi F, Ortore MG, Amenitsch H, Spindler L, Drevensek-Olenik I (2010) Guanosine quadruplexes in solution: a small-angle X-ray scattering analysis of temperature effects
on self-assembling of deoxyguanosine monophosphate. J Nucleic Acids 2010: 1–10. doi:10.4061/2010/472478
Marquet R, Paillart JC, Skripkin E, Ehresmann C, Ehresmann B (1994)
Dimerization of human immunodeficiency virus type 1 RNA involves sequences located upstream of the splice donor site. Nucleic
Acids Res 22: 145–151. doi:10.1093/nar/22.2.145
Martadinata H, Phan AT (2009) Structure of propeller-type parallel-stranded RNA G-quadruplexes, formed by human telomeric
RNA sequences in K+ solution. J Am Chem Soc 131: 2570–2578.
doi:10.1021/ja806592z
2016
Martadinata H, Heddi B, Lim KW, Phan AT (2011) Structure of long
human telomeric RNA (TERRA): G-quadruplexes formed by four
and eight UUAGGG repeats are stable building blocks. Biochemistry
50: 6455–6461. doi:10.1021/bi200569f
Martadinata H, Phan AT (2013) Structure of human telomeric RNA
(TERRA): stacking of two G-quadruplex blocks in K+ solution. Biochemistry 52: 2176–21783. doi:10.1021/bi301606u
Mashima T, Matsugami A, Nishikawa F, Nishikawa S, Katahira M
(2009) Unique quadruplex structure and interaction of an RNA aptamer against bovine prion protein. Nucleic Acids Res 37: 6249–6258.
doi:10.1093/nar/gkp647
Medic Š, Podbevšek P, Plavec J (2014) Solution structure of a prion protein aptamer analogue. Croatica Chemica Acta 87: 321–325.
doi:10.5562/cca2430
Metifiot M., Amrane S, Litvak S, Andreola ML (2014) G-quadruplexes
in viruses: function and potential therapeutic applications. Nucleic
Acids Res 42: 12352–12366. doi:10.1093/nar/gku999
Millevoi, Stefania, Hervé Moine, and Stéphan Vagner. (2012) G-quadruplexes in RNA biology. Wiley Interdisciplinary Reviews. RNA 3: 495–
507. doi:10.1002/wrna.1113
Morris MJ, Wingate KL, Silwal J, Leeper TC, Basu S (2012) The
porphyrin TmPyP4 unfolds the extremely stable G-quadruplex in
MT3-MMP mRNA and alleviates its repressive effect to enhance
translation in eukaryotic cells. Nucleic Acids Res 40: 4137–4145.
doi:10.1093/nar/gkr1308
Murat P, Zhong J, Lekieffre L, Cowieson NP, Clancy JL, Preiss T, Balasubramanian S, Khanna R, Tellam J (2014) G-quadruplexes regulate epstein-barr virus-encoded nuclear antigen 1 mRNA translation.
Nature Chem Biol 10: 358–364. doi:10.1038/nchembio.1479
Nandakumar J, Podell ER, Cech TR (2010) How telomeric protein
POT1 avoids RNA to achieve specificity for single-stranded DNA.
Proc Natl Acad Sci USA 107: 651–656. doi:10.1073/pnas.0911099107
Pan B, Xiong Y, Shi K, Deng J, Sundaralingam M (2003) Crystal structure of an RNA purine-rich tetraplex containing adenine tetrads.
Structure 11: 815–823. doi:10.1016/S0969-2126(03)00107-2
Pan B, Xiong Y, Shi K, Sundaralingam M (2003a) An eight-stranded
helical fragment in RNA crystal structure. Structure 11: 825–831.
doi:10.1016/S0969-2126(03)00108-4
Pan B, Xiong Y, Shi K, Sundaralingam M (2003b) Crystal structure of
a bulged RNA tetraplex at 1.1 Å resolution. Structure 11: 1423–1430.
doi:10.1016/j.str.2003.09.017
Pan B, Shi K, Sundaralingam M (2006a) Base-tetrad swapping results
in dimerization of RNA quadruplexes: implications for formation of
the I-motif RNA octaplex. Proc Natl Acad Sci USA 103: 3130–3134.
doi:10.1073/pnas.0507730103
Pan B, Shi K, Sundaralingam M (2006b) Crystal structure of an RNA
quadruplex containing inosine tetrad: implications for the roles of
NH2 group in purine tetrads. J Mol Biol 363: 451–459. doi:10.1016/j.
jmb.2006.08.022
Parkinson GN, Lee MP, Neidle S (2002) Crystal structure of parallel
quadruplexes from human telomeric DNA. Nature 417: 876–880.
doi:10.1038/nature755
Randazzo A, Esposito V, Ohlenschläger O, Ramachandran R, Mayola
L (2004) NMR solution structure of a parallel LNA quadruplex.
Nucleic Acids Res 32: 3083–3092. doi:10.1093/nar/gkh629
Redon S, Reichenbach P, Lingner J (2010) The non-coding RNA
TERRA is a natural ligand and direct inhibitor of human telomerase. Nucleic Acids Res 38: 5797–5806. doi:10.1093/nar/gkq296
Russo Krauss I, Parkinson GR, Merlino A, Mattia CA, Randazzo A,
Novellino E, Mazzarella L, Sica F (2014) A regular thymine tetrad
and a peculiar supramolecular assembly in the first crystal structure
of an All-LNA G-quadruplex. Acta Crystallographica. Section D, Biological Crystallography 70: 362–370. doi:10.1107/S1399004713028095
Satyanarayana M, Kim YA, Rzuczek SG, Pilch DS, Liu AA, Liu LF,
Rice JE, LaVoie EJ (2010) Macrocyclic hexaoxazoles: influence of
aminoalkyl substituents on RNA and DNA G-quadruplex stabilization and cytotoxicity. Bioorganic & Med Chem Lett 20: 3150–3154.
doi:10.1016/j.bmcl.2010.03.086
Schaffitzel C, Berger I, Postberg J, Hanes J, Lipps HJ, Plückthun A
(2001) In vitro generated antibodies specific for telomeric guaninequadruplex DNA react with stylonychia lemnae macronuclei. Proc
Natl Acad Scie USA 98: 8572–8577. doi:10.1073/pnas.141229498
Shen W, Gorelick RJ, Bambara RA (2011) HIV-1 nucleocapsid protein increases strand transfer recombination by promoting dimeric
G-quartet formation. J Biol Chemi 286: 29838–29847. doi:10.1074/
jbc.M111.262352
Shrestha P, Shan X, Dhakal S, Tan Z, Mao H (2014) Nascent RNA
transcripts facilitate the formation of G-quadruplexes. Nucleic Acids
Res 42: 7236–7246. doi:10.1093/nar/gku416
Sket P, Plavec J (2015) Diversity of DNA and RNA G-quadruplex structures. Future Science. Chapter 2: 22–36. doi:10.4155/
fseb12013.13.28.
Spindler L, Drevensek-Olenik I, Copic M, Cerar J, Skerjanc J, Mariani
P (2004) Dynamic light scattering and 31P NMR study of the selfassembly of deoxyguanosine 5′-monophosphate: the effect of added
Vol. 63 Overview of the RNA G-quadruplex structures
salt. Eur Phys J E, Soft Matter 13: 27–33. doi:10.1140/epje/e200400037-0
Sundquist WI, Heaphy S (1993) Evidence for interstrand quadruplex
formation in the dimerization of human immunodeficiency virus
1 genomic RNA. Proc Natl Acad Sci 90: 3393–3397. doi:10.1073/
pnas.90.8.3393
Vummidi BR, Alzeer J, Luedtke NW (2013) Fluorescent probes for
G-quadruplex structures. Chem Bio Chem 14: 540–558. doi:10.1002/
cbic.201200612
Wang Y, Patel DJ (1993) Solution structure of the human telomeric repeat d[AG3(T2AG3)3] G-tetraplex. Structure 1: 263–282.
doi:10.1016/0969-2126(93)90015-9
Warner KD, Chen MC, Song W, Strack RL, Thorn A, Jaffrey SR,
Ferré-D’Amaré AR (2014) Structural basis for activity of highly efficient RNA mimics of green fluorescent protein. Nature Struc & Mol
Biol 21: 658–663. doi:10.1038/nsmb.2865
Webba da Silva M (2007) NMR methods for studying quadruplex nucleic acids. Methods 43: 264–277. doi:10.1016/j.ymeth.2007.05.007
Xiong YX, Huang ZS, Tan JH (2015) Targeting G-quadruplex nucleic
acids with heterocyclic alkaloids and their derivatives. Eur J Med
Chem 97: 538–551. doi:10.1016/j.ejmech.2014.11.021
Xu S, Li Q, Xiang J, Yang Q, Sun H, Guan A, Wang L (2015) Directly
lighting up RNA G-quadruplexes from test tubes to living human
cells. Nucleic Acids Res 43: 9575–9586. doi:10.1093/nar/gkv1040
13
Xu Y, Kaminaga K, Komiyama M (2008a) Human telomeric RNA in
G-quadruplex structure. Nucleic Acids Symposium Series 52: 175–176.
doi:10.1093/nass/nrn089
Xu Y, Kaminaga K, Komiyama M (2008b) G-quadruplex formation
by human telomeric repeats-containing RNA in Na+ solution. J Am
Chem Soc 130: 11179–11184. doi:10.1021/ja8031532
Xu Y, Suzuki Y, Komiyama M (2009) Click chemistry for the identification of G-quadruplex structures: discovery of a DNA-RNA
G-quadruplex. Angewandte Chemie 48: 3281–3284. doi:10.1002/
anie.200806306
Xu Y, Ishizuka T, Kimura T, Komiyama M (2010) A U-tetrad stabilizes human telomeric RNA G-quadruplex structure. J Am Chem Soc
132: 7231–7233. doi:10.1021/ja909708a
Xu Y, Komiyama M (2012) Structure, function and targeting of human telomere RNA. Methods 57: 100–105. doi:10.1016/j.ymeth.2012.02.015
Zhang N, Phan AT, Patel DJ (2005) (3 + 1) Assembly of three human
telomeric repeats into an asymmetric dimeric G-quadruplex. J Am
Chem Soc 127: 17277–17285. doi:10.1021/ja0543090
Zhang S, Wu Y, Zhang W (2014) G-quadruplex structures and their
interaction diversity with ligands. Chem Med Chem 9: 899–911.
doi:10.1002/cmdc.201300566