Biochem. J. (2013) 454, 543–549 (Printed in Great Britain) doi:10.1042/BJ20121771 SUPPLEMENTARY ONLINE DATA *School of Chemistry and Molecular Biosciences, Australian Infectious Diseases Research Centre, University of Queensland, St Lucia 4072, QLD, Australia, and †Institute for Molecular Bioscience, St Lucia 4072, QLD, Australia Figure S3 Impact of SL1344 siderophore supplementation on the H2 O2 sensitivity of SL1344, SL1344 ESR , SL1344 ES and SL1344 ES ESR Bacteria plated were supplemented with either the siderophores produced by wild-type SL1344 (A) or the supernatant of a mutant SL1344 ES culture (B). H2 O2 (5 μl of 9.98 M) was added to the centre of each plate and pictures were taken after an overnight incubation at 37 ◦ C. The images presented are representative of results from three independent experiments. Figure S1 Impact of the catecholate siderophores and monomeric catechol supplementation on the H2 O2 sensitivity of SL1344, SL1344 ES and SL1344 ES* Bacteria plated were supplemented with salmochelin and enterobactin produced by SL1344. For supplementation with 2,3-DHB, the monomeric catechol was mixed with the agar medium prior to plating the bacteria. H2 O2 (5 μl of 9.98 M) was added to the centre of each plate and pictures were taken after an overnight incubation at 37 ◦ C. The images presented are representative of results from three independent experiments. Figure S2 H2 O2 sensitivity of strains with (A) or without (B) the ability to import siderophores The indicated bacteria were plated on to MM9 glycerol agar supplemented with 50 μM DIP. H2 O2 (5 μl of 9.98 M) was added to the centre of each plate and pictures were taken after an overnight incubation at 37 ◦ C. The images presented are representative of results from five independent experiments. 1 Figure S4 Impact of catecholate and non-catecholate siderophore supplementation on the H2 O2 sensitivity of SL1344 and SL1344 ES Bacteria plated were supplemented with the indicated siderophore(s) produced by the E. coli 83972 siderophore biosynthetic mutants mentioned in brackets. H2 O2 (5 μl of 9.98 M) was added to the centre of each plate and pictures were taken after an overnight incubation at 37 ◦ C. The images presented are representative of results from three independent experiments. Correspondence may be addressed to either of these authors (email [email protected] or [email protected]). c The Authors Journal compilation c 2013 Biochemical Society Biochemical Journal Maud E. S. ACHARD*, Kaiwen W. CHEN*, Matthew J. SWEET†, Rebecca E. WATTS*, Kate SCHRODER†, Mark A. SCHEMBRI*1 and Alastair G. MCEWAN*1 www.biochemj.org An antioxidant role for catecholate siderophores in Salmonella M. E. S. Achard and others Table S1 List of primers used in the present study Primer Gene deletion primers fepA5 F fepA5 R fepA3 F fepA3 R iroN5 * iroN3 F iroN3 R entC_Fwup entE_Rvup entE_Fwdn entE_Rvdn Screening primers fepAF fepAR iroNF iroNR entC_Fwsc entE_Rvsc Sequence (5 →3 ) cggaattctagggataacagggtaatcggtaggaataaaacagtagctg gaagcagctccagcctacacaggaatgaatcttcttgttcattg gaagcagctccagcctacacaggaatgaatcttcttgttcattg gaactaaggaggatattcatatggagcattaatacccatttctga atgagagttaagaagttcatctggttaataaccgtggtttctacaggggtgtg taggctggagctgcttc gaactaaggaggatattcatatggcttattatgccggtgtgac gcgaattctagggataacagggtaataaggaataaccatcaactccga gcctttgctacgtcgctc gaagcagctccagcctacacacaacgggtgaaaggtatacg gaactaaggaggatattcatatgctgaaggagaaagagagatgg acgtccggtatcttttaacatc cttcacgcagcacgttc ctctctttggcggagaaag ccccttcccggatttactg cagtgaaaataacccgcgt caaaatgagatccggcattt ccccgccacatagttcagc *The 5 end for iron::kan was only 50 bp Received 26 November 2012/17 June 2013; accepted 28 June 2013 Published as BJ Immediate Publication 28 June 2013, doi:10.1042/BJ20121771 c The Authors Journal compilation c 2013 Biochemical Society
© Copyright 2026 Paperzz