From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
Blood First Edition Paper, prepublished online December 7, 2006; DOI 10.1182/blood-2006-09-046672
Penumbra encodes a novel tetraspanin that is highly expressed in
erythroid progenitors and promotes effective erythropoiesis
Marc J. Heikens, Thai M. Cao, Chikako Morita, Sarah L. DeHart and Schickwann Tsai1
Division of Hematology, Department of Medicine, University of Utah,
Salt Lake City, UT 84132
1
Corresponding author
Wintrobe Bldg., Rm. 621
University of Utah School of Medicine
26 North 1900 East
Salt Lake City, UT 84132-4601
Tel: 801-585-0495
Fax: 801-585-0496
E-mail: [email protected]
Word count: 4999
Scientific heading: Hematopoiesis
Running title: Penumbra promotes effective erythropoiesis
Key words: erythropoiesis, erythroblast, tetraspanin, transmembrane 4 superfamily
Author contribution: Designed research (ST, TMC); performed research (all); analyzed
data and wrote the paper (ST, TMC, MJH).
Copyright © 2006 American Society of Hematology
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
ABSTRACT
In a search for new genes involved in the regulation of erythropoiesis, we identified
murine Penumbra cDNA from a multipotent hematopoietic cell line based on its
predominant expression in erythroblasts. Subsequently, we identified the human
Penumbra from a bone marrow cDNA library. Penumbra is a new member of the
tetraspanin superfamily of membrane proteins, many of which are thought to function as
organizers of supramolecular signaling complexes. Human and murine Penumbras
contain 283 amino acids and are 97% identical. The human Penumbra gene is mapped to
chromosome 7q32, a hotspot for deletions in myelodysplatic syndromes and acute
myelogenous leukemias. Penumbra is targeted to the cell surface and forms disulfidebonded homodimers. To study the effects of Penumbra deletions, we created a knockout
mouse model by gene targeting. Penumbra-/- mice develop massive splenomegaly,
basophilic macrocytic red blood cells and anemia as they age. A multipotent
hematopoietic cell line, EMX, was established from the bone marrow of a Penumbra-/mouse. EMX exhibits ineffective erythropoiesis in the presence of erythropoietin, a
defect that is reversed by re-expression of Penumbra. These findings indicate that
Penumbra has a positive function in erythropoiesis and its deletion or mutation may
result in anemia.
2
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
Introduction
Many signaling events occur in specialized membrane microdomains such as the “tetraspanin
microdomain” and the “lipid raft”1-9. Tetraspanin microdomains are supramolecular complexes
of tetraspanins, cell surface receptors and signal transducers10, 11. Members of the tetraspanin
family, also known as the “transmembrane 4 superfamily”, are transmembrane proteins that are
conserved from Dictyostelium to humans and characterized by four transmembrane domains, a
small extracellular domain (ECD1) between the first and second transmembrane (TM) domains,
and a large ECD2 between the third and fourth TM domains12. Most tetraspanins also contain
CCG and PXSCC motifs in ECD2. The cysteines in these motifs are thought to form
intramolecular disulfide bonds12.
The second microdomain, the lipid raft, contains high concentrations of sphingolipid and
cholesterol and is resistant to mild detergents1, 5, 6. Lipid rafts play important roles in organizing
the B cell receptor (BCR) complex, which also contains cell membrane proteins CD (cluster of
differentiation) 19, CD21 and CD81 (ref.13-16). CD81 is also a tetraspanin17. Evidence suggests
that CD81 facilitates the partitioning of co-ligated BCR and CD19/CD21 complexes into lipid
rafts and stabilizes the BCR signaling complexes, thereby reducing the threshold for signaling1820
.
The fact that tetraspanins are found in both microdomains suggests that they may have a
fundamental role in the functional organization of cell membranes. Emerging evidence indicates
that some tetraspanins serve as the organizers of supramolecular receptor complexes11. A wellcharacterized association between tetraspanins and cell surface receptors is that between CD151
3
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
and β1 integrins21,
22
. Similar associations have been described between CD81 and α4β1 and
between CD82 and α4β1 & αLβ 111. Interactions between tetraspanins and intracellular signal
transduction molecules have been described for CD81 and γ-glutamyl transpeptidase, protein
kinase C and phosphatidylinositol 4-kinase11.
Some tetraspanins were initially identified as leukocyte differentiation antigens such as CD9,
CD37, CD53, CD81, and CD151. CD63 was first identified as a protein associated with
melanoma progression while CD82 was originally cloned as a suppressor of prostate cancer
metastasis23-25. A specialized tetraspanin is Peripherin26, which is expressed exclusively in the
disc rim of the outer segment of rod photoreceptors and plays a crucial role in the morphogenesis
of lamellar discs27,
28
. Spontaneous mutations of Peripherin cause retinal degeneration and
blindness29.
Here, we describe the cloning and characterization of a new tetraspanin, Penumbra (Pen), with
predominant expression in erythroblasts. Many Pen knockout (KO) mice develop marked
splenomegaly and severe anemia as they age, indicating that Pen has an important role in normal
erythropoiesis.
4
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
Materials and methods
cDNA representational difference analysis (RDA)
cDNA RDA was performed as previously described30, 31. Briefly, both EML C.1 (ref. 32) and
MPRO33 cDNAs were synthesized from poly (A)+ RNAs using oligo-d(T) as primers. Doublestranded cDNAs were digested with DpnII and ligated with R-Bgl-12 and R-Bgl-24
linker/primers and amplified by polymerase chain reaction (PCR) to generate a representation of
cDNAs. The MPRO cDNA representation (the “driver”) was digested with DpnII to remove
linker/primers. The EML C.1 cDNA representation (the “tester”) was digested with DpnII to
remove linker/primers, gel-purified, and re-ligated with a second set of linker/primers (J-Bgl-12
and J-Bgl-24). The J-Bgl-12/24-ligated EML C.1 cDNA representation was mixed with a 100fold excess of melted MPRO cDNA representation and hybridized at 67˚C for 24 hr. Common
sequences formed tester:driver duplexes that contained the linker/primer at only one end and
could be amplified only in a linear fashion by PCR. Unique sequences formed tester:tester
duplexes that contained linker/primer at both ends and were amplified exponentially. The
resultant DNAs were used to start the next round of RDA. The ratios of tester to driver DNAs
were 1:8000 and 1:40,000 for the 2nd and 3rd rounds of RDA, respectively. The final products
were gel purified and cloned into pBluescript SK(+) (Stratagene, La Jolla, CA). To obtain fulllength cDNAs, oligo (dT)-primed cDNA libraries of EML C.1 and human bone marrow (BM)
were screened with P32-labeled probes.
Northern and Western analyses
5
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
Total RNAs (5-10 µg) were resolved on 1% formaldehyde agarose gels, blotted onto Hybond-N
(Amersham, Piscataway, NJ) and hybridized with P32-labeled probes at 65˚C in Rapid-hyb
(Amersham). Final washing was done in 0.1X standard sodium citrate (SSC)/0.1% sodium
dodecyl sulfate (SDS) at 65˚C. The multi-tissue Northern blot (Clontech, Palo Alto, CA)
contains 1 µg of poly(A)+ RNA per lane. For Western analyses, protein lysates (5-10 µg) were
separated by denaturing SDS-polyacrylamide gel electrophoresis (SDS-PAGE), blotted onto
Immobilon-P PVDF (Millipore, Bedford, MA) and visualized by enhanced chemiluminescence.
Cell purification and quantitative real-time reverse transcription (RT) PCR
Phycoerythrin (PE)- or fluorescein isothiocyanate (FITC)-conjugated monoclonal antibodies
(MAb) against TER119, CD3 (clone 145-2C11), B220 (clone RA3-6B2), Gr1(clone RB6-8C5)
and NK1.1 (clone PK136) were purchased from Becton Dickinson (San Jose, CA). For BM or
splenocyte subset isolation, mononuclear cells depleted of red blood cells (RBC) were labeled
with MAb and purified by fluorescence-activated cell sorting (FACS) using a FACS Vantage
(Becton Dickinson). Total RNAs were isolated using an RNeasy Kit (Qiagen, Valencia, CA) and
reverse transcribed with oligo-d(T) and Superscript III (Invitrogen, Carlsbad, CA). Real-time
PCR assays were performed using SYBR Green PCR Master Mix (Applied Biosystems, Foster
City, CA) and the MyiQ Real-Time PCR Detection System (Bio-Rad, Hercules, CA). Each
amplification mixture contained 2 µl of cDNA and 0.25 µM of forward and reverse primers with
the exception of β-actin PCR, in which 0.5 µM of primers were used. Cycling parameters were
50 °C for 10 min., 40 cycles of 95 °C for 1 sec. and 60 °C for 1 min., and 72 °C for 5 min. PCR
was performed in triplicate and normalized using β-actin as internal control. Relative levels of
gene expression were calculated by the comparative cT method34. Primer sequences: β-actin, 5’6
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
TGGGTCAGAAGGACTCCTATG (sense) and 5’-CAGGCAGCTCATAGCTCTTCT (antisense);
β Major-globin,
5’-GCTTCTGACATAGTTGTGTTG
GTGGTACTTGTGAGCCAAGGC
(anti-sense);
EPO
(sense)
receptor
and
5’-
(EPO-R),
5’-
GCAGGAGGGACACAAAGG (sense) and 5’-AGGTTGCTCAGAACACACTCAG (antisense).
Expression vectors and immunofluorescence microscopy
The entire coding region of mPen except the stop codon was cloned in frame into pcDNA3.1
containing the Myc-His tag (Invitrogen, Carlsbad, CA) or into pEGFP N1 (Clontech) that
expresses proteins as fusion proteins with enhanced green fluorescent protein (EGFP) in the Ctermini. The sequence preceding the start codon was modified to create a Kozak consensus
sequence (5’GCCGCCACC). The resultant vectors were designated as pcDNA3.1/Pen-Myc and
pEGFP N1/Pen-EGFP, respectively. Cells were transfected with 4-8 µg of DNA per 2.5 x 106
cells or per 100-mm dish by electroporation using Gene Pulser Xcell (BioRad, Hercules, CA) or
by the calcium phosphate precipitate method. For detection of Myc-tagged proteins, methanolfixed cells were stained with rhodamine-conjugated anti-Myc MAb, 9E10 (Santa Cruz
Biotechnology, Santa Cruz, CA) and embedded in Vectashield containing 4,6-diamidino-2phenylindole (DAPI) (Vector Laboratories, Burlingame, CA).
The retroviral vector MSCV-Pen-PGK-EGFP was constructed by cloning the coding sequence of
mPen including the stop codon into the BglII/HpaI cloning sites of the parental vector, MSCVPGK-EGFP35, which expresses the transgene from the MSCV promoter and EGFP from the PGK
promoter. The recombinant plasmids were transfected into the retroviral packaging cell line,
7
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
PE501, along with pSV2Neo at 20:1 ratio and selected with G418 (0.8 mg/ml) for ten days.
Stable, EGFP-expressing cells were sorted by FACS and maintained with G418 (0.5 mg/ml).
Immunoprecipitation (IP)-Western
Cell lysates were prepared in RIPA buffer and pre-cleared with normal mouse IgG and Protein
G-Plus agarose (Santa Cruz Biotechnology). Cleared lysates were incubated with anti-Myc
MAb, 9E10 (Santa Cruz Biotechnology) for 2 hr. at 4°C and then with Protein G-Plus agarose
overnight at 4°C. Precipitates were washed 3 times with phosphate-buffered saline, once with
RIPA buffer and eluted by adding 2X Western sample loading dye with or without βmercaptoethanol (β-ME). Equal amounts of immunoprecipitates were run on SDS-PAGE,
blotted onto Immobilon-P PVDF, probed with anti-Myc or anti-EGFP antibodies, followed by
horse radish peroxidase-conjugated secondary goat antibodies (Pharmingen).
Establishment of Pen KO mice
The gene targeting vector was assembled in pBluescript and contained a 4.4-kb Not I/Xba I
fragment (5’ arm) and a 4.6-kb Bam HI/Xho I fragment (3’ arm) of mPen genomic DNA, a selfexcising Cre-Neo cassette flanked by two lox P sites36, and two thymidine kinase expression
cassettes in tandem (TK1-TK2). The transfection and selection of ES cells (R1), blastocyst
(C57Bl/6) injection and the generation of chimeras and F1 breeding pairs were performed as
described36. ES clones were screened by Southern blots. Genotyping of F1 x F1 offsprings was
done
by
PCR
using
GT1
GCTGCTCCACTCGTGATGCTGG)
(5’-GCAGATGTTCTCCCGAAGGGATC),
and
GT3
GT2
(5’-
(5’-CCCCAGAAGATGGAGCAAGTG)
primers. The specificity and accuracy of PCR genotyping were verified by Southern blots. Blood
8
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
samples were obtained by retro-orbital bleeding and complete blood counts were enumerated
using a Hemavet 850 analyzer (Drew Scientific, Inc., Oxford, CT).
Cell cultures
EML C.1 was maintained in Iscove’s Modified Dulbecco’s Medium (IMDM; Gibco, Grand
Island, NY) plus 20% horse serum (HS; Gibco) and 8% (vol./vol.) BHK/MKL conditioned
medium (CM) as a source of rat stem cell factor (SCF)31. To induce erythroid differentiation, the
medium was supplemented with human EPO (5 unit/ml; Amgen, Thousand Oaks, CA). To
obtain pure populations of erythroblasts, EML C.1 cells that had been treated with 8%
BHK/MKL CM plus EPO (4 unit/ml) for 7 days were washed with phosphate buffered saline and
re-cultured in IMDM supplemented with 20% HS and EPO (4 unit/ml).
Establishment and transduction of EMX C.1
EMX was established from a culture of Pen-/- BM initiated in IMDM supplemented with 30%
fetal bovine serum (FBS), 5 x10-5 M β-ME, murine SCF (50 ng/ml; R&D Systems, Minneapolis,
MN) and murine thrombopoietin (TPO; 50 ng/ml)(R&D Systems). The immortalization of EMX
was spontaneous and occurred within 4 weeks of the initiation of the BM culture. A clonal
derivative, EMX C.1, was isolated after two rounds of limiting dilution cloning. EMX C.1
depends on SCF (50 ng/ml) and TPO (50 ng/ml) but grows better if interleukin-3 (IL-3; 2 ng/ml)
is also present. EMX C.1 was infected by co-cultivation with 900 rad-irradiated retroviral
producers PE501/MSCV-PGK-EGFP or MSCV-Pen-PGK-EGFP for 48 hr. EGFP-expressing
cells (50,000-100,000 per group) were sorted by FACS.
EPO response and colony assay of EMX C.1
9
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
5 x 105 EMX C.1 transduced with MSCV-PGK-EGFP (“EMX/EGFP”) or MSCV-Pen-PGKEGFP (“EMX/Pen”) were stimulated with EPO (4 unit/ml) in addition to the standard
SCF+TPO+IL-3 cocktail for various periods and harvested for different assays. To determine
the numbers of EPO-reponsive erythroid progenitors, cells that had been stimulated with EPO (4
unit/ml) in addition to SCF+TPO+IL-3 for 8 days were washed with PBS three times and recultured in IMDM/30% FBS plus EPO alone (0-32 u/ml). Cells that survived 48 hr. after the
EPO-alone switch were counted and plated in 0.8% methylcellulose supplemented with 30%
FBS, 5 x 10-5 M β-ME, SCF (50 ng/ml), IL-3 (2 ng/ml) and EPO (4 unit/ml) for colony
formation.
Microscopy
Photomicrographs were taken with a Nikon Eclipse TE300 microscope (Nikon, Tokyo, Japan)
equipped with Plan Fluor (40 X/0.60) and Plan Apo (60 X/1.40) lenses and a SPOT RT Slider
digital camera (Diagnostic Instruments, Sterling Heights, MI) and SPOT RT software version 3.2
(Diagnostic Instruments). Image files were edited using Photoshop version 8.0 (Adobe Systems,
San Jose, CA).
Statistics
Differences in the means of RBC numbers and hematocrits were determined by two-tailed paired
or unpaired t-test. All blood counts were expressed as means ± standard deviations (S. D.).
10
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
Results
Cloning a new gene differentially expressed in proerythroblasts/erythroblasts
To identify new regulators of erythropoiesis, we performed cDNA RDA on a multipotent
hematopoietic cell line, EML C.1 (ref. 32), using a syngeneic myeloid cell line, MPRO33, as the
subtractor. This resulted in the enrichment of genes differentially expressed in erythroid
progenitors. One of the cDNAs thus identified was E6-3, which showed differential expression
in FLDS-19 murine erythroleukemia (MEL) cell line and EML C.1 in initial screening (Figure
1A).
To examine the temporal expression of E6-3 during erythropoiesis, we used EML C.1 as a
source of erythroid progenitors. In the presence of SCF and EPO, EML C.1-derived erythroid
progenitors proliferate and differentiate into hemoglobinized erythroblasts in 5-7 days32. Pure
populations of proerythroblasts/erythroblasts can be obtained by switching EML C.1 that has
been stimulated with SCF+EPO for 5-7 days to a medium containing EPO alone. Only
proerythroblasts/erythroblasts survive 24 hours after the switch. Northern analyses of EML C.1
that had been stimulated with SCF+EPO for 0-7 days (Figure 1B, lanes 1-8) as well as pure
populations of proerythroblasts/erythroblasts one and two days after the EPO-alone switch
(Figure 1B, lanes 9&10) showed that the expression of E6-3 correlated with the appearance of
βMajor-globin-expressing cells (Figure 1B).
E6-3 encodes a new tetraspanin
The E6-3 fragment contains 480 base pairs (bp). The full-length cDNA of E6-3 contains 2017
nucleotides (nt) and encodes a protein of 283 amino acids (aa) with an apparent molecular
11
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
weight of 26 kD (Figure 1C). We named this gene Penumbra, abbreviated as Pen, for
“Proerythroblast nu (new) membrane”.
Hydrophilicity analysis of murine Pen (mPen) revealed the presence of four hydrophobic
segments (Figure 1D). Further analysis indicated that mPen shares sequence homology with
several members of the tetraspanin superfamily. The nearest family member that has been
studied is CD63, which exhibits 26.5% identity with mPen in aa sequence (Fig. 1E)24. The TM
segments of mPen harbor polar amino acids such as asparagine and glutamine (Asn30 and Gln95,
108, 250, 258)
that are destabilizing in the hydrophobic phospholipid bilayer. It is possible that they
form intramolecular salt bridges with other aa to maintain the tertiary structure or they may
interact with the TM segments of adjacent membrane proteins. The ECD2 of mPen contains
several well-conserved cysteines that are also present in other tetraspanins (C156CG158,
P186XSCC190 and X222GC224)12(Figure 1C). Using mPen as the probe, we identified the cDNA of
hPen (GenBank accession no. AF276891) from a human BM cDNA library. hPen and mPen are
97% identical in aa sequence (Figure 1C).
Pen is predominantly expressed in erythroblasts
We compared the expression levels of Pen in various hematopoietic tissues or cells by
quantitative RT-PCR. Pen is highly expressed in BM and spleen (Figure 2A&B). Most of the
BM expression is found in the TER119+ fraction, which includes all erythroblasts37. Little
expression is found in nonerythroid tissues or cells such as thymus, Gr1+ neutrophils, CD3+ T
cells, B220+ B cells, CD11c+ monocytes or NK1.1+ natural killer cells (Figure 2A). The
expression in spleen is likely due to extramedullary hematopoiesis in this organ in mice since
12
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
human spleen (which normally contains no extramedullary hematopoiesis) expresses lower
levels of hPen (not shown). Northern analyses of poly(A)+ RNA detected some but lower levels
of expression in liver, brain and kidney (Figure 2B).
Pen is targeted to cell surface and forms disulfide-bonded homodimers
To map the subcellular location of Pen, we constructed an expression vector, pcDNA3.1/PenMyc, to express mPen as a fusion protein with the 11-aa Myc and 6-aa His tags in C-terminus. In
vitro translation of pcDNA3.1/Pen-Myc in the presence of canine pancreatic microsomal
membranes yielded a 29-kD fusion protein (not shown). pcDNA3.1/Pen-Myc was transfected
into the BaF3 and FLDS-19 cells, followed by staining with a rhodamine-conjugated, anti-Myc
MAb, 9E10. Most of the Pen-Myc fusion protein was found on the surface of cells. Some was
found in the membranes of cytoplasmic vesicles, especially if the level of expression was very
high (Figure 2C).
To determine if Pen can form disulfide-bonded homodimers, we co-transfected NIH3T3
fibroblasts with pcDNA3.1/Pen-Myc (abbreviated as “Pen-Myc” in Figure 2D) and pEGFP
N1/Pen. The latter expressed mPen as a fusion protein with enhanced green fluorescent protein
(EGFP) in its C-terminus (abbreviated as “Pen-EGFP” in Figure 2D). The Pen-Myc fusion
protein was first immunoprecipitated from cell lysates using anti-Myc MAb, Western blotted and
sequentially probed with anti-Myc and anti-EGFP antibodies. If Pen formed homodimers via
disulfide bonds, we expected to see both Pen-Myc/Pen-Myc and Pen-Myc/Pen-EGFP dimers in
the immunoprecipitates under non-reducing conditions. Furthermore, after reduction these
dimers would dissociate into monomers. This was indeed the case. Figure 2E&F demonstrate
13
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
that under reducing conditions, all Pen-Myc fusion proteins existed as 29-kD monomers (Figure
2E, lanes 1 and 4). Under non-reducing conditions, about half of Pen-Myc protein existed as 58kD homodimers (Figure 2E, lane 7, marked **), while the remaining Pen-Myc protein existed
either as 29-kDa monomers (Figure 2E, lane 7, marked *) or 89-kDa dimers with Pen-EGFP
(Figure 2E, lane 7, marked *◊). The same blot was stripped and reprobed with anti-EGFP
antibodies to reveal the ∼60-kD Pen-EGFP monomer (Figure 2F, lanes 2 and 4, marked ◊) and
the 89-kD Pen-Myc/Pen-EGFP dimer (Figure 2F, lane 7, marked *◊). The small mount of PenEGFP monomer in lane 7 of Figure 2F probably represented Pen-EGFP that was coimmunoprecipitated with Pen-Myc (by anti-Myc MAb) through non-covalent association. These
results indicate that nearly half of Pen-Myc protein exists as disulfide-bonded homodimers in
this assay.
Establishment of a Pen KO mouse model
To investigate the effects of Pen deletion, we created a KO mouse model by homologous
recombination. To avoid any pathology caused by Neo, we used a targeting vector containing a
self-excising Cre-Neo cassette flanked by two lox P sites (Figure 3A)36. Cre expression was
controlled by a testis-specific promoter. As the Pen+/- ES cells passed through the testes of male
chimeras, Cre was induced and mediated excision of the Cre-Neo cassette (Figure 3A).
Successful targeting resulted in the deletion of part of TM1, ECD1, TM2 and part of TM3 of Pen
and the production of a shortened, aberrantly spliced mRNA (confirmed by sequencing
corresponding cDNA). Genotyping of ES cells was done by Southern blots using diagnostic
restriction enzymes and DNA probes located outside the targeted segment. Genotyping of mice
was done by PCR using GT1, GT2 and GT3 primers (Figure 3A&B).
14
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
Pen-/- mice develop anemia and splenomegaly
Pen-/- mice are viable and fertile, although low fertility was observed in rare cases after
inbreeding. When examined at 3 months of age, Pen-/- mice had similar numbers of RBC (9.32 ±
1.05 vs. 9.51 ± 0.85 x 106/µl in WT)(Figure 3C), hematocrit (46.77 ± 3.92 vs. 47.11 ± 3.72% in
WT), WBC (8.60 ± 2.67 vs. 7.70 ± 2.54 x 103/µl in WT) and platelets (826.46 ± 168.57 vs.
919.78 ± 151.19 x 103/µl in WT) as WT littermates. However, the blood smears of ∼30% of
young Pen-/- mice contained RBC that were basophilic and larger. Many of these basophilic RBC
had the “target cell” appearance, reflecting a decreased cytoplasm-to-cell surface ratio. These
abnormal RBC are henceforth referred to as “basophilic macrocytes” (Figure 4A). The
percentages of basophilic macrocytes increased with age in the same mice. When examined at ∼1
year (range 6-17 months) of age, the Pen-/- mice as a group had lower RBC numbers (7.71 ± 0.88
vs. 8.88 ± 0.51 x 106/µl in WT; p = 0.004 by paired t-test)(Figure 3D) and hematocrits (38.95 ±
5.52 vs. 46.21 ± 3.62% in WT; p = 0.003). Many of the 1-year or older Pen-/- mice had very high
percentages of basophilic macrocytes in blood smears. In the most severe cases, ∼60% of the
RBC were basophilic macrocytes. Most Pen-/- mice with severe anemia also had mild-moderate
monocytosis and thrombocytopenia (not shown). When mice with increased percentages of
basophilic macrocytes were examined, they were found to have even lower numbers of RBC
(6.24 ± 1.87 vs. 8.88 ± 0.51 x 106/µl in WT; p = 0.0002 by unpaired t-test) and hematocrits
(36.63 ± 8.28 vs. 46.21 ± 3.62% in WT; p = 0.002). The ranges of RBC numbers are better
appreciated in scatter plots (Figure 3D). Many Pen-/- mice had hematocrits as low as 12-15% (not
included in the statistics above). All Pen-/- mice with high percentages of basophilic macrocytes
and anemia had markedly (∼10-fold) enlarged spleens on autopsy (1.023 ± 0.223 vs. 0.108 ±
15
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
0.029 gm in WT; p = 0.0032)(Figure 4D&G). Some Pen-/- mice had spleens weighing more than
5 gm (not included in the statistics above) and some Pen-/- spleens showed evidence of
infarctions (Figure 4G). Morphologic and flow cytometric examination of the spleens of anemic
mice revealed replacement of splenic T and B lymphocytes by intensely basophilic and
sometimes dysplastic erythroblasts and proerythroblasts (Figure 4E&J).
In two cases,
extrameduallary erythropoiesis in the liver resulted in the formation of pedunculated hepatic
tumors (Figure 4H-I). The abnormalities described above are also seen in some Pen+/- mice (not
shown). These findings indicate that Pen plays an important role in normal erythropoiesis.
Pen promotes effective erythropoiesis
A continuous multipotent hematopoietic cell line, EMX (for “Erythroid-Myeloid-andUnknown”), was established from the BM of a Pen-/- mouse. A clonal derivative, EMX C.1, was
used as the prototytpe and maintained with SCF, TPO and IL-3. In the presence of
SCF+TPO+IL-3 plus EPO, EMX C.1 differentiates into erythrocytes, monocytes, neutrophils,
mast cells and megakaryocytes (Figure 5A). Genotyping confirmed that EMX C.1 is Pen-/(Figure 5A). Although EMX C.1 was capable of differentiating into erythrocytes, the efficiency
was low as reflected in the low levels of GATA-1 and β major-globin mRNAs (Figure 5B, lane 3).
Similar findings were seen in EMX C.1 transduced with the negative control retroviral vector
MSCV-PGK-EGFP (“EMX/EGFP”) without or with EPO stimulation (Figure 5B, lanes 4&6). In
contrast, EMX C.1 transduced with MSCV-Pen-PGK-EGFP (“EMX/Pen”, expressing mPen)
exhibited robust erythropoiesis in response to EPO as evidenced by higher levels of GATA-1 and
β major-globin mRNAs (Figure 5B, lanes 5&7). These findings indicate that Pen enhanced
erythropoiesis in EMX C.1. Examination of Wright-Giemsa-stained cytospins of EMX/EGFP
16
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
and EMX/Pen confirmed that after 12 days’ stimulation with EPO (4 unit/ml), about 45% of the
EMX/Pen cells were erythroblasts compared with only 5% in the control EMX/EGFP cultures
(Figure 5F&G).
To compare the levels of erythropoiesis precisely, we performed quantitative RT-PCR of β majorglobin. Without added EPO, EMX/EGFP and EMX/Pen expressed similar levels of EPO-R
mRNA (Figure 5C). However, the expression of β major-globin mRNA in EMX/Pen was sevenfold higher than in EMX/EGFP (Figure 5D). The expression of β major-globin mRNA by
EMX/Pen in the absence of added EPO was likely stimulated by the trace EPO in FBS. Addition
of EPO (4 unit/ml) for 6-10 days greatly stimulated β major-globin expression in EMX/Pen but had
only modest effect on EMX/EGFP (Figure 5E). These results indicate that Pen plays an
important role in the differentiation of erythroid progenitors.
To identify the developmental stage(s) affected by Pen KO, EMX/EGFP or EMX/Pen that had
been stimulated with EPO (4 unit/ml) in addition to SCF+TPO+IL-3 for 14 days were washed
free of cytokines and re-cultured in a medium containing EPO alone at various concentrations.
All non-erythroid cells died due to cytokine withdrawal. Only EPO-responsive progenitors
survived the switch. Cells surviving the EPO switch were counted and subjected to colony assays
in the presence of SCF+IL-3+EPO (Figure 6A). While very few EMX C.1 or EMX/EGFP cells
survived the EPO switch, many EMX/Pen cells did (Figure 6B). These EPO-rescued EMX/Pen
cells consisted of erythroblasts at all stages of differentiation as well as less differentiated blasts.
Colony assays of EPO-rescued cells from the EMX/Pen cultures revealed many large, medium
and small burst-forming unit-erythroid (BFU-E)-derived colonies (Figure 6C). In contrast, very
17
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
few BFU-E-derived colonies were found in the EMX/EGFP cultures (Figure 6C). Similar
differences were seen in colony-forming unit-erythroid (CFU-E)-derived colonies, which
degenerated quickly (not shown).
18
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
Discussion
Pen is a new member of the tetraspanin family of membrane proteins that often serve as the
organizers of signaling complexes in cell membranes11. In mice, the highest level of Pen
expression is seen in the BM. Most of the Pen expression in BM is restricted to the TER119+
erythroblasts (Figure 2A), suggesting that Pen may have a particular function in erythroblasts.
Indeed, our KO study demonstrates that homozygous deletion of Pen frequently results in the
development of basophilic macrocytic RBC (Fig. 4A&B), splenomegaly (Figure 4D&G) and
anemia (Figure 3D).
One of the most consistent abnormalities in the Pen-/- mice is splenomegaly. It occurs not only in
mice with anemia but also in some mice without anemia. Some Pen-/- spleens weigh more than 5
gm, the equivalent of 17% of body weight (normal spleens weigh about 0.3% of body weight).
Anemia may occur when there is decreased production of erythroblasts/RBC or increased
destruction of erythroblasts/RBC that is not compensated by increased erythropoiesis, or both.
The frequent occurrence of splenomegaly in Pen-/- mice raises the possibility that increased
erythroblasts/RBC destruction may be a contributing factor in the development of anemia in
these mice. Given the known roles of prototypical tetraspanins in cell membranes9-11, it is
possible that Pen-/- erythroblasts/RBC have accumulated intrinsic defects in their cell membranes
or cytoskeletons or cytoplasm as a result of abnormal differentiation in the absence of Pen. The
frequent finding of target cells (Figure 4A) may be an indication of this problem. These intrinsic
defects may increase the rate of destruction of erythroblasts/RBC in the spleen, leading to
splenomegaly and compensatory expansion of the erythroid compartment. As the mice age, these
abnormalities cause progressive splenomegaly, which in turn increases the rate of destruction of
19
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
erythroblasts/RBC in a vicious cycle. Beyond a critical point, the destruction of
erythroblasts/RBC cannot be compensated by expanded erythropoiesis and anemia becomes
apparent.
Another recurring abnormality in the Pen-/- mice is the basophilic macrocyte (Figure 4A&B).
The basophilic macrocytes of Pen-/- mice resemble the so-called “shift reticulocytes”, which are
immature reticulocytes released into the circulation prematurely during severe hypoxic stress.
Supravital staining with new methylene blue confirmed that the basophilic macrocytes of Pen-/mice stained intensely with this dye. While the reticulocyte counts of normal mice average < 1%,
those of the anemic Pen KO mice range from 5–60%. Judging from the intense basophilia and
the larger cell size, the basophilic macrocytes of Pen-/- mice may be even more immature than
“shift reticulocytes”. This is supported by the observation that it takes longer for the basophilic
macrocytes of Pen-/- mice to mature in culture than the typical shift reticulocytes. The marked
immaturity of basophilic macrocytes in the Pen-/- mice may reflect the severity of anemia but
may also be the result of abnormal differentiation.
Studies in the multipotent EMX C.1 cell line revealed a differentiation defect in Pen-/- erythroid
progenitors. As shown in Figures 5&6, EMX C.1-derived erythroid progenitors differentiate
poorly in the presence of EPO as evidenced by the low levels of β Major-globin expression and
survival in response to EPO alone. These defects are corrected to a certain extent by Pen (Figure
5B-E and 6B&C). These findings are summarized in Figure 6D. It should be pointed out that the
expression of Pen in EMX/Pen cells is driven by the constitutively active long-terminal repeat of
MSCV. Normal BFU-E, which have been shown to express EPO-R in at least a subset38, may or
20
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
may not express Pen. Regardless, the ability of ectopic Pen to rescue EMX-derived BFU-E in the
presence of EPO suggests that Pen may directly or indirectly influence the survival or
differentiation of erythroid progenitors in the presence of EPO. Several a priori mechanisms
may explain the possible effect of Pen on EMX-derived erythroid progenitors, including direct or
indirect physical interaction between Pen and EPO-R leading to a conformational change of
EPO-R or the stability of EPO-R dimers, direct or indirect interaction between Pen and another
cell surface receptor(s) (e.g. c-kit, c-mpl, platelet-derived growth factor receptor, transferrin
receptor and β integrins) or molecules whose expression is contemporaneous, overlaps or
dovetails with that of EPO-R, and signal transduction by Pen per se. The impaired survival or
differentiation of Pen-/- erythroid progenitors in the presence of high concentrations of EPO
suggests that they may have a reduced capacity to expand in response to hypoxia, thus hastening
the development of anemia.
While older Pen-/- mice develop anemia, most young Pen-/- mice do not. The delayed onset of
anemia may be related to the progressive nature of splenomegaly or it may be linked to agerelated differences in certain hormones, oxygen consumption, expression of other tetraspanins
that may provide functional redundancy (such as CD151)39, phagocytic activity of macrophages,
the proliferative vigor of hematopoietic stem cells or progenitors, and the number of somatic
mutations. As indicated, only ∼ 30% of the Pen-/- mice develop anemia. The cause of this
phenotypic variability may lie in the outbred nature of the Pen-/- mice. Like many KO models,
our Pen-/- mice have both C57Bl/6 and 129 parentage and are random recombinants with respect
to these two genetic backgrounds. Depending on the genetic composition and the relative
strengths of allele-specific genetic modifiers, the phenotype may vary. Finally, we have shown
21
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
that hPen maps to 7q32 (ref. 40), one of the “minimally deleted regions” in myelodysplastic
syndrome (MDS) and acute myelogenous leukemia (AML)41-45. Given the erythroblast-restricted
expression of Pen in BM, it is unlikely that hPen deletion can account for all cytologic
abnormalities of MDS such as nuclear hyposegmentation and hypogranularity. However, the
findings in Pen-/- mice and EMX C.1 so far suggest that Pen provides a positive function in
erythropoiesis. Thus, further investigation is warranted to determine if Pen deletion contributes
to the anemia of some MDS or AML.
Acknowledgments
The authors thank Suzzane Mansour, Kirk Thomas and Mario Capecchi for the Cre-Neo and
TK1-TK2 cassettes, and AnneMarie Y-J. Yang and Christopher Leukel for technical assistance.
This work was supported in part by a grant from the American Cancer Society to S.T (RSG-01165-01-LIB).
22
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
References
1. Simons K, Ikonen E. Functional rafts in cell membranes. Nature. 1997;387:569–572.
2. Anderson RGW. The caveolae membrane system. Annu. Rev. Biochem. 1998;67:199–
225.
3. Brown DA, London E. Functions of lipid rafts in biological membranes. Annu. Rev.
Cell Devel. Biol. 1998;14:111–136.
4. Horejsi V, Drbal K, Cebecauer M et al. GPI-microdomains: a role in signaling via
immunorecptors. Immunol. Today. 1999;20:356–361.
5. Simons K, Toomre D. Lipid rafts and signal transduction. Nat. Rev. Mol. Cell. Biol.
2000;1:31–39.
6. Simons K, van Meer G. Lipid sorting in epithelial cells. Biochem. 1988;27:6197–6202.
7. Hemler ME. Integrin-associated proteins. Curr. Opin. Cell Biol. 1998;10:578–585.
8. Boucheix C, Rubinstein E. Tetraspanins. Cell. Mol. Life Sci. 2001;58:1189–1205.
9. Hemler ME. Tetraspanin proteins mediate cellular penetration, invasion, and fusion
events and define a novel type of membrane microdomain. Annu. Rev. Cell Dev. Biol.
2003;19:397–422.
10. Hemler ME. Specific tetraspanin functions. J. Cell Biol. 2001;155:1103–1107.
11. Tarrant JM, Robb L, van Spriel AB, Wright MD. Tetraspanins: molecular organizers of
the leukocyte surface. Trends Immunol. 2003;24:610–617.
12. Stipp CS, Kolesnikova TV, Hemler ME. Functional domains in tetraspanin proteins.
Trends Biochem. Sci. 2003;28:106–112.
23
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
13. Tedder TF, Isaacs CM. Isolation of cDNAs encoding the CD19 antigen of human and
mouse B lymphocytes. A new member of the immunoglobulin superfamily. J. Immunol.
1989;143:712–717.
14. Bradbury LE, Kansas GS, Levy S, Evans RL, Tedder TF. The CD19/CD21 signal
transducing complex of human B lymphocytes includes the target of antiproliferative
antibody-1 and Leu-13 molecules. J. Immunol. 1992;149:2841–2850.
15. Matsumoto AK, Martin DR, Carter RH et al. Functional dissection of the
CD21/CD19/TAPA-1/Leu13 complex of B lymphocytes. J. Exp. Med. 1993;178:14071417.
16. Fearon DT, Carter RH. The CD19/CR2/TAPA-1 complex of B lymphocytes: linking
natural to acquired immunity. Annu. Rev. Immunol. 1995;13:127–149.
17. Oren R, Takahashi S, Doss C, Levy R, Levy S. TAPA-1, the target of an antiproliferative
antibody, defines a new family of transmembrane proteins. Mol. Cell Biol.
1990;10:4007–4015.
18. Fearon DT, Carroll MC. Regulation of B lymphocyte responses to foreign and selfantigens by the CD19/CD21 complex. Annu. Rev. Immunol. 2000;18:393–422.
19. Cherukuri A, Cheng PC, Sohn HW, Pierce SK. The CD19/CD21 complex functions to
prolong B cell antigen receptor signaling from lipid rafts. Immunity. 2001;14:169–179.
20. Cherukuri A, Shoham T, Sohn HW et al. The tetraspanin CD81 is necessary for
partitioning of coligated CD19/CD21-B cell antigen receptor complexes into signalingactive lipid rafts. J. Immunol. 2004;172:370–380.
24
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
21. Serru V, Le Naour F, Billard M et al. Selective tetraspanin-integrin complexes
(CD81/α4β1, CD151/α3β1, CD151/α6β1) under conditions disrupting tetraspan
interactions. Biochem. J. 1999;340:103–111.
22. Lammerding J, Kazarov AR, Huang H, Lee RT, Hemler ME. Tetraspanin CD151
regulates α6β1 integrin adhesion strengthening. Proc. Natl. Acad. Sci. USA.
2003;100:7616–7621.
23. Hotta H, Ross AH, Huebner K et al. Molecular cloning and characterization of an antigen
associated with early stages of melanoma tumor progression. Cancer Res. 1988;48:2955–
2962.
24. Azorsa DO, Hyman JA, Hildreth JE. CD63/Pltgp40: A platelet activation antigen
identical
to
the
stage-specific,
melanoma-associated
antigen
ME491.
Blood.
1991;78:280–284.
25. Dong JT, Lamb PW, Rinker-Schaeffer CW et al. KAI1, a metastasis suppressor gene for
prostate cancer on human chromosome 11p11.2. Science. 1995;268:884–886.
26. Molday RS, Hicks D, Molday L. Peripherin. A rim-specific membrane protein of rod
outer segment discs. Invest. Ophthalmol. Vis. Sci. 1987;28:50–61.
27. Wrigley JD, Ahmed T, Nevett CL, Findlay JB. Peripherin/rds influences membrane
vesicle morphology. J. Biol. Chem. 2000;275:13191–13194.
28. Tam BM, Moritz OL, Papermaster DS. The C terminus of peripherin/rds participates in
rod outer segment targeting and alignment of disk incisures. Mol. Biol. Cell.
2004;15:2027–2037.
29. Kohl S, Giddings I, Besch D et al. The role of the peripherin/RDS gene in retinal
dystrophies. Acta Anat. (Basel) 1998;162:75–84.
25
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
30. Hubank M, Schatz DG. Identifying differences in mRNA expression by representational
difference analysis of cDNA. Nucleic Acids Res. 1994;22:5640–5648.
31. Tsai S, Fero J, Bartelmez S. Mouse Jagged2 is differentially expressed in hematopoietic
progenitors and endothelial cells and promotes the survival and proliferation of
hematopoietic progenitors by direct cell-to-cell contact. Blood. 2000;96:950–957.
32. Tsai S, Bartelmez S, Sitnicka E, Collins S. Lymphohematopoietic progenitors
immortalized by a retroviral vector harboring a dominant-negative retinoic acid receptor
can recapitulate lymphoid, myeloid, and erythroid development. Genes Dev.
1994;8:2831–2841.
33. Tsai S, Collins SJ. A dominant negative retinoic acid receptor blocks neutrophil
differentiation at the promyelocyte stage. Proc. Natl. Acad. Sci. USA. 1993;90:7153–
7157.
34. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time
quantitative PCR and the 2-∆∆CT method. Methods. 2001;25:402–408.
35. DeKoter RP, Singh H. Regulation of B lymphocyte and macrophage development by
graded expression of PU.1. Science. 2000;288:1439–1441.
36. Bunting M, Bernstein KE, Greer JM, Cepecchi MR, Thomas KR. Targeting genes for
self-excision in the germ line. Genes Dev. 1999;13:1524–1528.
37. Ikuta K, Kina T, MacNeil I et al. A developmental switch in thymic lymphocyte
maturation potential occurs at the level of hematopoietic stem cells. Cell. 1990;62:863–
874.
26
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
38. Sawada K, Krantz SB, Dai CH et al. Purification of human blood burst-forming unitserythroid and demonstration of the evolution of erythropoietin receptors. J. Cell. Physiol.
1990;142:219–230.
39. Crew VK, Burton N, Kagan A et al. CD151, the first member of the tetraspanin (TM4)
superfamily detected on erythrocytes, is essential for the correct assembly of human
basement membranes in kidneys and skin. Blood. 2004;104:2217–2223.
40. Chen Z, Pasquini M, Hong B, DeHart S, Heikens M, Tsai S. The human Penumbra gene
is mapped to a region on chromosome 7 frequently deleted in myeloid malignancies.
Cancer Genet. Cytogenet. 2005;162:95–98.
41. LeBeau MM, Albain KS, Larson RA et al. Clinical and cytogenetic correlations in 63
patients with therapy-related myelodysplastic syndromes and acute nonlymphocytic
leukemia: further evidence for characteristic abnormalities of chromosomes no. 5 and 7.
J. Clin. Oncol. 1986;4:325–345.
42. Neuman WL, Rubin CM, Rios RB et al. Chromosomal loss and deletion are the most
common mechanisms for loss of heterozygosity from chromosomes 5 and 7 in malignant
myeloid disorders. Blood. 1992;79:1501–1510.
43. Luna-Fineman S, Shannon K, Lange BL. Childhood monosomy 7: epidemiology,
biology, and mechanistic implications. Blood. 1995;85:1985–1999.
44. Fischer K, Frohling S, Scherer SW et al. Molecular cytogenetic delineation of deletions
and translocations involving chromosome band 7q22 in myeloid leukemias. Blood.
1997;89:2036–2041.
27
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
45. Liang H, Fairman J, Claxton DF et al. Molecular anatomy of chromosome 7q deletions in
myeloid neoplasms: evidence for multiple critical loci. Proc. Natl. Acad. Sci. USA.
1998;95:3781–3785.
GenBank accession no.: mPen (AF276890); hPen (AF276891 and AY236849).
28
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
Figure legends
Figure 1. Expression and sequence of Penumbra (E6-3).
(A) Expression of E6-3 in a panel of cell lines used in the initial screening: NIH3T3
(fibroblasts), J774 (macrophage), MPRO (promyelocyte), EML C.1 (multipotent), MC/9
(mast cell), FLDS-19 MEL (erythroblast/proerythroblast), BaF3 (B cell-like), EL4 (T
cell-like). Expression in uninduced EML C.1 is due to spontaneously generated
proerythroblasts and erythroblasts. The ethidium bromide-stained gel is shown at the
bottom.
(B) Expression of E6-3 during erythroid differentiation. Lanes 1-8: EML C.1 stimulated with
SCF+EPO for 0-7 days; Lanes 9-10: EML C.1 stimulated with SCF+EPO for 7 days then
EPO alone for 1 and 2 days, respectively; Lane 11: Un-induced FLDS-19 MEL. The blot
was sequentially hybridized with the E6-3 and mouse β major globin probes.
(C) Amino acid sequences of mPen and hPen. Only differing aa are shown for hPen. The four
hydrophobic segments are underlined. Polar amino acids within the transmembrane
segments are in bold. Asterices denote conserved cysteine-containing motifs.
(D) A hydrophilicity plot of mPen.
(E) Amino acid sequence alignment between mPen and mCD63 by CLUSTAL W. “+”
denotes identical aa; “:” denotes conserved substitution; “.” denotes semi-conserved
substitution.
Figure 2. Tissue expression, subcellular localization and dimer formation of Pen.
(A) Relative expression of Pen in various murine hematopoietic tissues and lineages. BM and
spleen cell subsets were purified by FACS. Quantitative real-time RT-PCR was
29
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
performed in triplicate and normalized using β-actin as the internal control. The level of
Pen expression in FLDS-19 is taken as 1.0. Means ± S. D.
(B) A multi-tissue (murine) Northern blot of Pen expression. Each lane contained 1 µg of
poly(A)+ RNA.
(C) Subcellular localization of Pen. BaF3 was transfected with pcDNA3.1/Pen-Myc. PenMyc fusion protein was detected using rhodamine-conjugated anti-Myc MAb (left panel).
Right panel: double-staining with DAPI to reveal nuclei. Bar = 20 µM.
(D) A schematic representation of Pen, Pen-Myc and Pen-EGFP fusion proteins.
(E) Pen forms disulfide-bonded homodimers. NIH3T3 cells were transfected with expression
vectors pcDNA3.1/Pen-Myc (labeled as “Pen-Myc”), pEGFP N1/Pen (labeled as “PenEGFP”) and pcDNA3.1 (negative control) alone or in combination. Cell lysates were
prepared 24 hr. after transfection and immunoprecipitated with anti-Myc antibodies. The
immunoprecipitates were electrophoresed after reduction with β-mercaptoethanol (βME)(lanes 1-4) or without reduction (lanes 6&7), transferred to a PVDF membrane and
probed with anti-Myc antibodies. Under non-reducing conditions, about half of Pen-Myc
proteins existed as dimers (lane 7, marked ∗∗) and about half as monomers (lane 7,
marked ∗). Some Pen-Myc/Pen-EGFP dimers can also be detected (lane 7, marked ∗◊).
After reduction, all Pen-Myc proteins became monomers (lane 4). The two faint bands at
~50 and ~25-kDa positions in lanes 3&4 are reduced heavy- and light-chains of
immunoglobulins, respectively.
(F) The blot in (E) was stripped and reprobed with anti-EGFP antibodies to reveal Pen-EGFP
monomers (lanes 2, 4 and 7, marked ◊) and Pen-Myc/Pen-EGFP dimers (lane 7, marked
∗◊). The Pen-EGFP monomer in lane 7 represented protein that was non-covalently
30
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
associated with Pen-Myc and therefore co-immunoprecipitated during anti-Myc
immunoprecipitation. The lower, 29-kDa band in lane 4 is the unstripped Pen-Myc
monomer signal.
Figure 3. Establishment of Pen KO mice and comparison of RBC numbers.
(A) Creation of a KO allele by homologous recombination. The exon/intron structure of
mPen is shown at the top. The targeting vector employs a self-excising Cre-Neo cassette,
in which the expression of Cre is under the control of a testis-specific promoter. The
locations of the genotyping primers are also shown.
(B) Genotyping of the KO littermates. GT1/GT3 amplify the KO but not the WT allele due
the long distance between the primer sites in the WT allele.
(C) A scatter plot of RBC numbers of young mice matched in age (3 months) and sex. No
significant difference is noted between Pen+/+ and Pen-/- mice at this age. Bars = means.
(D) A scatter plot of RBC numbers of older mice matched in age (6-17 months) and sex.
Significant difference exists between Pen+/+ (filled circles) and randomly selected Pen-/(filled triangles) groups (p = 0.004 by paired t test). Mice with increased (> 4%)
basophilic macrocytes (open triangles) in pre-screening were plotted separately.
Significant difference is again noted between Pen+/+ (filled circles) and the pre-screened
Pen-/- mice (open triangles)(p = 0.0002 by unpaired t test). Note: Pen-/- mice with very
severe anemia (Hct <20%) are not included in this analysis. Bars = means.
Figure 4. Basophilic macrocyte, splenomegaly and extramedullary hematopoiesis in Pen
KO mice.
31
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
(A&B) Wright-Giemsa-stained blood smears of two representative Pen-/- mice. Note the
basophilic macrocytes, target cells, overall larger RBC and the absence of
microspherocytes.
(C) A Wright-Giemsa-stained blood smear of a Pen WT mouse. Note the smaller RBC size,
the absence of basophilic macrocytes and a pale blue “shift cell” in the right lower corner.
(D) The spleen of the Pen-/- mouse in (A). A WT spleen is included for comparison. Bar = 1
cm.
(E) A Wright-Giemsa-stained cytospin preparation of the spleen cells of the Pen-/- mouse in
(D). Most cells are intensely basophilic proerythroblasts or erythroblasts (arrowheads) or
enucleated, basophilic RBC (arrows).
(F) A Wright-Giemsa-stained cytospin preparation of the spleen cells of a Pen WT mouse.
Most cells are lymphocytes. Panels A, B, C, E and F have the same magnification.
(G) The spleen of a Pen-/- mouse with multiple infarcts (pale scars). Bar = 1 cm.
(H) The hepatic tumor of the same Pen-/- mouse in (G). Bar = 1 cm.
(I) A hematoxylin-eosin-stained thin section of (H). The ∗ denotes extramedullary
hematopoiesis. Arrowheads: hepatocytes.
(J) Flow cytometric analyses of the spleen cells in (D-F). RBC were removed by hypotonic
lysis before staining with MAb. The percentage of cells in each quadrant/gate is shown.
CD3 is a marker for T cells while CD19 is a marker for B cells. The frequency of
TER119+ erythroblasts in Pen-/- spleen is increased by 150-fold.
Figure 5. Pen enhances erythropoiesis in EMX C.1.
32
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
(A) A Wright-Giemsa-stained cytospin preparation of EMX C.1. The ∗ denote
megakaryocytes. Arrows point to two basophilic erythroblasts. Also visible in this panel
are neutrophils with donut-shaped nuclei, monocytes and mast cells. The genotyping
result is at the top.
(B) Northern analyses of the expression of Pen, GATA-1, βMajor-globin, and β-actin in EMX
C.1, EMX/EGFP and EMX/Pen without and with EPO stimulation. FLDS-19 serves as a
positive control and MPRO as a negative control for GATA-1 and β Major-globin. The same
blot was sequentially hybridized to different probes. EMX C. 1 (lane 3) and EMX/EGFP
(lane 4) did not express the 4.0-kb retroviral message harboring the mPen coding
sequence (labeled as “Transgene”) while EMX/Pen did (lane 5; top panel). The 2.1-kb
endogenous mPen message in FLDS-19 (lane 1) is indicated. ∆Pen: Shortened Pen
message transcribed from the KO allele. The level of β Major-globin message roughly
correlated with the numbers of erythroblasts.
(C) Relative EPO-R expression in EMX/EGFP vs. EMX/Pen without exogenous EPO.
Quantitative real-time RT-PCR was performed in triplicate as described in Methods and
the data were normalized according to the levels of β-actin expression. The level of EPOR expression in EMX/EGFP was taken as 1.0. Means ± S.D.
(D) Relative β Major-globin expression in EMX/EGFP vs. EMX/Pen without exogenous EPO.
The data were normalized according to the levels of β-actin expression. The level of
βMajor-globin expression in EMX/EGFP was taken as 1.0. The expression of β Major-globin
was likely stimulated by the small amount of EPO present in FBS. Means ± S.D.
(E) Relative β Major-globin expression in EMX/EGFP vs. EMX/Pen stimulated with EPO (4
unit/ml) for 0, 6 and 10 days. The data were normalized according to the levels of β-actin
33
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
expression. The level of β Major-globin expression in EMX/EGFP on day 0 was taken as
1.0. Means ± S.D.
(F) A representative field of Wright-Giemsa-stained cytospin preparation of EMX/EGFP
stimulated with EPO (4 unit/ml) for 8 days. Arrowheads: two large erythroid progenitors.
The rest are myeloid cells. Bar = 40 µM.
(G) A representative field of Wright-Giemsa-stained cytospin preparation of EMX/Pen
stimulated with EPO (4 unit/ml) for 8 days. Arrowheads: A large cluster of basophilic
erythroblasts. Arrow: an enucleated RBC.
Figure 6. The survival or development of Pen-/- erythroid progenitors is rescued by Pen.
(A) An outline of the experimental design.
(B) Effect of Pen on the survival of EPO-responsive cells at different concentrations of EPO.
5 x 105 EMX/EGFP or EMX/Pen were stimulated with SCF+TPO+IL3 plus EPO (4
unit/ml) for 8 days. Cell numbers after 8 days were 1.27 x 107 for EMX/GFP and 1.81 x
107 for EMX/Pen. 3 x 105 EMX/GFP or EMX/Pen cells that had been stimulated with
SCF+TPO+IL-3 plus EPO for 8 days were washed with PBS and re-stimulated with EPO
alone (0-32 unit/ml) for 2 days. Most surviving cells were erythroblasts. Some were
undifferentiated blasts. Cells rescued with EPO alone were counted. Data represent the
means of triplicates. For reference, 6.1 % of EMX/Pen cells were rescued by EPO at 4
unit/ml.
(C) Effect of Pen on the numbers of BFU-E rescued by EPO. 3 x 105 EMX/EGFP or
EMX/Pen that had been stimulated with SCF+TPO+IL3 plus EPO (4 unit/ml) for 8 days
were washed with PBS and re-stimulated with EPO alone (4 unit/ml) for 2 days and then
34
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
plated in methylcellulose culture medium supplemented with SCF, IL-3 and EPO (4
unit/ml). Each 35-mm dish contained the equivalent of 2 x 104 starting cells (or 1,224
EPO-rescued cells in the case of EMX/Pen). The graph shows the numbers of erythroid
progenitors per 3 x 105 starting cells. Means ± S.D, n = 3. For reference, the frequencies
of large, medium and small BFU-E among EPO-rescued cells were 1.0, 5.0 and 7.7%,
respectively.
(D) A schematic summary of the differentiation of Pen-/- EMX C.1. The TER119 MAb
recognizes erythroblasts37, which exhibit the highest level of Pen expression in BM. The
survival or development of EMX-derived BFU-E, CFU-E/proerythroblasts and
erythroblasts is rescued by Pen in the presence of EPO.
35
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
36
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
37
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
38
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
39
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
40
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
41
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
Prepublished online December 7, 2006;
doi:10.1182/blood-2006-09-046672
Penumbra encodes a novel tetraspanin that is highly expressed in
erythroid progenitors and promotes effective erythropoiesis
Marc J. Heikens, Thai M Cao, Chikako Morita, Sarah L DeHart and Schickwann Tsai
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Advance online articles have been peer reviewed and accepted for publication but have not yet
appeared in the paper journal (edited, typeset versions may be posted when available prior to
final publication). Advance online articles are citable and establish publication priority; they are
indexed by PubMed from initial publication. Citations to Advance online articles must include
digital object identifier (DOIs) and date of initial publication.
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.