0013-7227/02/$15.00/0
Printed in U.S.A.
Endocrinology 143(7):2715–2721
Copyright © 2002 by The Endocrine Society
Fibroblast Growth Factor-9 Is an Endometrial Stromal
Growth Factor
SHAW-JENQ TSAI, MENG-HSING WU, HSIU-MEI CHEN, PEI-CHIN CHUANG,
LIH-YUH C. WING
AND
Departments of Physiology (S.-J.T., H.-M.C., P.-C.C., L.-Y.W.) and Obstetrics & Gynecology (M.-H.W.), National Cheng
Kung University Medical College, Tainan 70101, Taiwan, Republic of China
Fibroblast growth factor-9 (FGF-9) is an autocrine/paracrine
growth factor considered to be important for the growth and
survival of motorneurons and prostate. In this study, we found
that FGF-9 was expressed at high levels in normal uterine
endometrium, especially during the late proliferative phase,
which is coincident with the rise of estradiol and the time of
uterine endometrial proliferation. Using quantitative RTPCR analysis, we found that FGF-9 mRNA was expressed primarily by endometrial stromal cells. High affinity receptors of
FGF-9 were detected in both epithelial and stromal cells but
with distinct patterns. FGFR2IIIc and FGFR3IIIc are abundant in endometrial stromal cell. FGFR2IIIb is mostly ex-
F
pressed in endometrial epithelial cells, whereas FGFR3IIIb is
found in both epithelial and stromal cells. Treatment with
FGF-9 induces endometrial stromal proliferation in a dosedependent manner. Expression of FGF-9 in stromal cells was
induced by 17␤-estradiol but not by progesterone. Furthermore, the administration of 17␤-estradiol stimulates endometrial stromal cell proliferation and that can be inhibited by
cotreatment with anti-FGF-9 antibody. Herein we demonstrate, for the first time, that FGF-9 is an autocrine estromedin
endometrial stromal growth factor that plays roles in cyclic
proliferation of uterine endometrial stroma. (Endocrinology
143: 2715–2721, 2002)
IBROBLAST GROWTH FACTORS (FGFs) are multifunctional, heparin-binding polypeptides that are involved
in several biological processes such as neuroprotection, cell
proliferation and migration, embryogenesis, morphogenesis,
implantation, and tumorigenesis (see Ref. 1 for review). Currently, the FGFs comprise a family of at least 23 structurally
related proteins that are expressed in specific spatial and
temporal patterns (1, 2). FGFs bind and activate high affinity
tyrosine kinase receptors (FGFR1– 4) that consist of an intracellular tyrosine kinase domain, a single transmembrane
domain, and an extracellular portion containing three Ig-like
domains. FGFR1–3 undergoes alternative mRNA splicing
that generates three different isoforms for each FGFR (designated as IIIa, IIIb, and IIIc) (3– 6). The splicing variant IIIa
of FGFR is a secreted FGF-binding protein, whereas the other
two splicing variants (IIIb and IIIc) are both membranebound receptors containing mutually exclusive Ig-like domains. These alternatively spliced variants have distinct ligand binding properties and tissue-specific expression
patterns (3– 6). Previous studies suggest that IIIb isoform of
FGFRs is expressed in epithelial lineages, whereas the IIIc
variant is restricted to mesenchymal origin (7–9).
FGF-9, originally isolated from human glioma cells (10), is
widely expressed in rat central nervous system (11). The gene
encoding for human FGF-9 is mapped to chromosome
11q11–13 (12). FGF-9 is highly conserved across species with
greater than 93% identity among Xenopus, mouse, rat, and
human, suggesting that FGF-9 is of vital importance (10, 13).
In adult tissue, FGF-9 has been found to be a potent mitogen
and survival factor for numerous nerve cells (14, 15). Re-
cently, it was shown that mice lacking FGF-9 exhibit lung
hypoplasia with reduced amount of mesenchyme and die
shortly after birth (16). In addition, mice lacking FGF-9 result
in male-to-female sex reversal during embryogenesis, indicating the critical role of FGF-9 in fetal testicular development (17).
FGF-9 binds to FGFR2 and FGFR3, but not FGFR1 and
FGFR4, with high affinity and activates efficiently the “c”
splice forms (18 –20). Recently, FGF-9 was found to be expressed in the stroma of the prostate, an androgen-responsive organ, whose growth also requires epithelial-mesenchymal interaction. It has been shown that FGF-9 acts as an
autocrine and paracrine factor for prostatic cell proliferation
(21). In the uterus, endometrium undergoes cyclic changes in
cell proliferation, differentiation, and death under the influences of ovarian steroids. The growth of endometrium includes glands and stroma. Several growth factors have been
shown to involve in ovarian steroid regulation of uterine
functions (22, 23). For example, FGF-2, FGF-7, and their receptors, FGFR1 and FGFR2IIIb, have been detected in and
regulate the function of epithelial cells (24, 25). In contrast,
the expression pattern and functional role of FGF-9 and its
receptor in female reproductive tract has not been investigated. This study was designed to test the hypothesis that
FGF-9 is expressed in human uterus and is a mitogen of
uterine endometrial cells. The regulation of FGF-9 expression
by ovarian steroid hormones was also investigated.
Abbreviations: FBS, Fetal bovine serum; FGF, fibroblast growth factor; FGFR1– 4, high affinity tyrosine kinase receptors; QC, quantitative
competitive.
Eutopic endometrial tissues from disease-free patients of reproductive age undergoing hysterectomy for leiomyoma or ovarian pathology
(n ⫽ 25) were collected at the time of laparoscopy or laparotomy at the
Materials and Methods
Tissue collection
2715
2716
Endocrinology, July 2002, 143(7):2715–2721
Tsai et al. • FGF-9 Is an Endometrial Stromal Growth Factor
Department of Obstetrics & Gynecology of The National Cheng Kung
University Hospital. None of the patients were receiving any hormone
therapy, such as GnRH analog, or pseudopregnancy therapy. The following cases were preexcluded from the study including malignant
neoplasms other than cervical carcinoma in situ, ovarian neoplasms,
pelvic inflammation, and pregnancy. Tissues were immersed in Hanks’
solution supplemented with HEPES and antibiotics and transported to
the laboratory for further processing. For Western blotting and mRNA
analysis, tissues were snap frozen in liquid nitrogen and stored at ⫺80
C. For immunohistostaining, tissues were fixed in formaldehyde followed by paraffin embedding. The other parts of tissues were minced
and subjected to the isolation of stromal cells. Human ethics approval
was obtained from the Clinical Research Ethics Committee at The National Cheng Kung University Medical Center and informed consents
were obtained from the patients.
Escherichia coli, R&D Research) were added to serum-starved stromal
cells in the presence or absence of anti-FGF-9 monoclonal antibody
(mouse against recombinant FGF-9, R&D Research) for 48 h and subjected to 3H-thymidine incorporation assay as previously described (28).
In brief, cells were incubated with 3H-thymidine (1 ␮Ci/ml) for 24 h and
then washed twice with PBS. After the addition of 10% ice-cold trichloroacetic acid for 20 min, trichloroacetic acid was removed and cells were
washed with PBS. The acid-insoluble fractions were dissolved by the
addition of 1 n NaOH. The contents were then neutralized with an equal
volume of 1 n HCl to a final concentration of 0.5 n. Five-hundredmicroliter aliquots were transferred to a scintillation vial containing 3.5
ml counting fluid (Ready safe, Beckman Coulter, Inc., Fullterton, CA).
The radioactivity was measured by a liquid scintillation counter.
Quantification of mRNA concentrations using standard
curve quantitative competitive (QC)-RT-PCR methodology
Cell cultures
Eutopic endometrial stromal and epithelial cells (predominantly
glandular epithelium) were dissociated and purified as previously described (26). Cells were cultured in DMEM/F12 supplemented with 10%
fetal bovine serum (FBS) and antibiotics in a humidified atmosphere
with 5% CO2 at 37 C. The medium was changed every other day. When
the cells reached confluence, they were subcultured in 24-well culture
plates using 1 ml phenol red-free DMEM/F12. Purity of the cell was
immunostained with vimentin (stromal cell-specific) and cytokeratin
(epithelial cell-specific) specific antibodies as previously described (26).
The stromal cell population was free of epithelial cell contamination,
whereas greater than 95% of epithelial cells were vimentin negative.
Regulation of FGF-9 gene expression in stromal cells
Subcultured stromal cells were maintained in 24 well plates (2 ⫻ 104
cells/well) until 70% confluence was reached. After serum starvation for
12 h, the cells were then incubated in phenol red-free DMEM/F12
supplemented with 1% charcoal-stripped FBS and were stimulated with
vehicle, 17␤-estradiol (10⫺11–10⫺7 m), progesterone (10⫺11–10⫺7 m), or
estradiol (10⫺9 m) plus progesterone (10⫺9 m) for 24 h. Cells were directly
lysed in the well using lysis buffer [4 m guanidinium isothiocyanate, 10
mm Tris-HCl (pH 8.0), 0.5% sodium dodecyl sulfate, and 1% dithiothreitol] and subjected to mRNA isolation as described (26, 27). For
protein analysis, stromal cells (n ⫽ 5 batches of cells) were cultured in
10-cm Petri dish (5 ⫻ 105 cells/dish), serum starved and then treated
with vehicle or 17␤-estradiol (10⫺9 m) for 4 or 24 h.
Effect of FGF-9 on stromal and epithelial cell proliferation
Subcultured stromal cells or epithelial cells were deprived of serum
for 12 h and then treated with different doses of recombinant human
FGF-9 (0.1 ng/ml to 200 ng/ml, from Sf21 cell, R&D Research, San Diego,
CA) for 48 h in the presence or absence of 1% charcoal-stripped FBS. In
a separated experiment, 50 ng/ml of recombinant FGF-9 or FGF-2 (from
Procedures for preparation of native and competitive plasmids for in
vitro transcription of native and competitive RNA had been described
previously (26, 27, 29). Specific primer pairs for FGF-9, FGFR2IIIb,
FGFR2IIIc, FGFR3IIIb, and FGFR3IIIc were designed according to sequences deposited in GenBank (Table 1). All the plasmids containing
native or competitors were sequenced by automated sequencing for
verification of the sequences (ABI model 377, Perkin-Elmer Corp., Foster
City, CA). Specific RNA was in vitro transcribed by procedures routinely
used in our laboratory (26, 27, 29). Each RNA aliquot was used only one
time to reduce variation due to potential degradation of RNA after
repeated freezing and thawing. The detailed procedure of standard
curve QC-RT-PCR was described previously (30, 31). In brief, 1 attomole/reaction of competitor RNA was added into RT master mix [50 mm
Tris-HCl, 75 mm KCl, 3 mm MgCl2 (pH 8.3), 10 mm dithiothreitol, 100
pmol random primer, 4 mm deoxy-NTPs and 50 U Moloney murine
leukemia virus reverse transcriptase]. Fifteen microliters of this mix was
then dispensed into PCR tubes and serial diluted native RNA (12.8 – 0.1
attomole/reaction) in 5 ␮l of diethylpyrocarbonate-treated water or 5 ␮l
of RNA samples were added individually to each tube. RT was carried
out at 42 C (90 min) followed by heating to 95 C for 10 min and quick
chilled to 4 C in a thermocycler (PTC-100, MJ Research, Inc., Watertown,
MA). Two microliters of RT products were added to 18 ␮l of PCR mix
[final concentration: 20 mm Tris-HCl (pH 8.4 at 25 C), 50 mm KCl, 1.5
mm MgCl2, 0.2 mm deoxy-NTPs, 0.5 U Taq polymerase, and 0.4 ␮m of
primers]. This was subjected to 30 cycles of amplification (30 sec denaturation at 95 C, 30 sec annealing at 57 C, and 30 sec elongation at 72 C)
followed by final elongation at 72 C for 5 min. The PCR products were
directly separated on a 5% acrylamide gel and then stained with
ethidium bromide and placed on UV illuminator equipped with a camera connected to a computer. The gel image was analyzed using AlphaImager software (Alpha Innotech Corp., San Leandro, CA). Figure
1 demonstrates production of standard curve and calculation of amounts
of RNA transcripts in the sample using FGF-9 as an example.
TABLE 1. Sequences of primers used and sizes of PCR product of natives and competitors for FGF-9, FGFR2IIIb, FGFR2IIIc, FGFR3IIIb,
and FGFR3IIIc
Gene
Primer
FGF-9
Native
Competitor
FGFR2IIIb
Native
Competitor
FGFR2IIIc
Native
Competitor
FGFR3IIIb
Native
Competitor
FGFR3IIIc
Native
Competitor
hFGF9-F
hFGF9-R
hFGF9-IR
R2IIIb-F
R2IIIb-R
R2IIIb-IF
R2IIIc-F
R2IIIc-R
R2IIIc-IF
R3IIIb-F
R3IIIb-R
R3IIIb-IF
R3IIIc-F
R3IIIc-R
R3IIIc-IF
Sequence
5⬘ AGCCCGGTTTTGTTAAGTG 3⬘
5 AGTATCGCCTTCCAGTGTC 3⬘
5⬘ AGTATCGCCTTCCAGTGTCTGTCCACGCCTCGAAT 3⬘
5⬘ TGGTCGGAGGAGACGTAGAG 3⬘
5⬘ CTTGCTGTTTTGGCAGGAC 3⬘
5⬘ TGGTCGGAGGAGACGTAGAGCGGGCTGCCCTACCT 3⬘
5⬘ TGGTCGGAGGAGACGTAGAG 3⬘
5⬘ CTGGCAGAACTGTCAACCAT 3⬘
5⬘ TGGTCGGAGGAGACGTAGAGCGGGCTGCCCTACCT 3⬘
5⬘ GGAGTTCCACTGCAAGGTGT 3⬘
5⬘ GTGAACGCTCAGCCAAAAG 3⬘
5⬘ GGAGTTCCACTGCAAGGTGTCGGACGGCACACCCTA 3⬘
5⬘ GGAGTTCCACTGCAAGGTGT 3⬘
5⬘ CAGCCACGCAGAGTGATG 3⬘
5⬘ GGAGTTCCACTGCAAGGTGTCGGACGGCACACCCTA 3⬘
PCR length
GenBank no.
NM_002010
401 bp
269 bp
HSFGFR2A08
292 bp
205 bp
HSFGFR2A09
275 bp
190 bp
HUMFGFRT
256 bp
190 bp
NM_000142
250 bp
184 bp
Tsai et al. • FGF-9 Is an Endometrial Stromal Growth Factor
Endocrinology, July 2002, 143(7):2715–2721 2717
each) in PBS and then incubated with a biotinylated sheep antirabbit
immunoglobulin (1:500, Sigma) for 60 min at room temperature. The
sections were then quenched of endogenous peroxidase activity (3%
H2O2 in PBS at room temperature for 10 min) and rinsed briefly in PBS.
Amplification of the antigen-antibody complex was achieved by using
avidin-biotin-peroxidase (ABC kit, Vector Laboratories, Inc., Burlingame, CA) for 60 min at room temperature. The color reaction was
precipitated using 3-amino-9-ethylcarbazole (Vector Laboratories, Inc.)
for 10 min at room temperature. The tissue sections were counterstained
with hematoxylin and coverslips were mounted using an aqueous
mounting medium (DAKO Corp., Carpinteria, CA). Nonspecific staining was assessed by omission of the primary antibody as well as replacing primary antibody with nonimmunized rabbit serum and was
undetectable in all instances.
Statistical analysis
FIG. 1. Standard curve QC-RT-PCR using FGF-9 as an example. A,
Ethidium bromide-stained PCR products for FGF-9; B, standard
curve produced from analyzing the intensity of bands shown in A. A
2-fold serial dilution of native RNA (12.8 to 0.1 attomoles) was reverse
transcribed and PCR amplified in the presence of 1 attomole competitor. The band intensity was quantified by AlphaImager computer
software and used to construct the standard curve shown in B. The
inset in B shows two samples that were RT-PCR amplified in the
presence of same amount of competitor. The ratios of band intensity
in lanes 1 and 2 were logarithmically transformed and compared with
standard curve (solid line for lane 1, and dashed line for lane 2) to
calculate the amount of transcripts (vertical lines cross x-axis). M,
DNA molecular weight marker; NC, negative control by omission of
reverse transcriptase.
Detection of FGF-9 protein by Western blotting
and immunoprecipitation
Expression of FGF-9 in endometria during different phases of menstrual cycle was detected by Western blot using standard procedure (26).
Goat anti-FGF-9 polyclonal antibody (200 ␮g/ml, R&D Research) and
HRP-conjugated rabbit antigoat immunoglobulin (1:2000 dilution,
Sigma, St. Louis, MO) were used as primary and secondary antibodies,
respectively. Effect of estrogen on FGF-9 expression in cultured stromal
cells was determined by immunoprecipitation followed by Western
blotting. Whole cell lysate was precleaned using Sepharose-conjugated
protein A (Amersham Pharmacia Biotech, Little Chalfont, UK) at 4 C for
1 h and then mouse anti-FGF-9 monoclonal antibody (4 ␮g/ml) was
incubated with the lysate for 16 –18 h at 4 C with rotation. Protein
A-Sepharose was then added to the lysate to capture the FGF-9-antibody
complex. After extensive washed with washing buffer (0.5% sodium
deoxycholate, 1% Nonidet P-40, 0.1% sodium dodecyl sulfate, and 0.2
mm phenylmethylsulfonyl fluoride in 1⫻ PBS), the protein A-Sepharose
slurry was brought down by centrifugation and then subjected to Western blotting. Goat anti-FGF-9 polyclonal antibody was used to detect
FGF-9 as described above.
Immunohistochemical staining
Paraffin-embedded tissues were sectioned at 5-␮m thickness and
mounted onto poly-lysine-coated slides, deparaffinized and rehydrated.
Tissue sections were incubated with 0.1% trypsin at room temperature
for 10 min followed by incubating with 0.1 ␮g/ml trypsin inhibitor
(Sigma) for 5 min. The sections were then rinsed three times (5 min each)
in PBS before blocking with 10% normal goat serum (15 min at room
temperature). The sections were again rinsed in PBS solution and incubated with primary antibody, rabbit-antihuman FGFR2 (amino acid
362–374, Sigma) or rabbit-antihuman FGFR3 (amino acid 359 –372,
Sigma) at 1:2000 dilution (overnight at 4 C). Following incubation with
primary antibody, the tissue sections were rinsed three times (5 min
The data were expressed as mean ⫾ sem. Differences in a given
mRNA among groups were analyzed with the one-way ANOVA
through use of general linear model of the Statistical Analysis System
(32). Differences in FGF-9 expression in endometria of different phases
of menstrual cycle were performed using Tukey’s multiple comparison
procedure once significance was found by F test. Dunnett’s procedure
was used to test difference between individual treatment group and
control in 3H-thymidine incorporation and FGF-9 mRNA expression
levels.
Results
Expression of FGF-9 in uterine endometrium
The steady-state concentrations of mRNA encoding for
FGF-9 were markedly expressed in normal uterine endometrium (Fig. 2A). Using standard curve QC-RT-PCR, expression of FGF-9 transcript was the greatest at late proliferative
phase (d 8 –14 of menstrual cycle). There was no difference
in FGF-9 mRNA concentration between early proliferative
phase and entire secretory phase. Western blot analysis also
showed similar pattern of FGF-9 expression in cell extracts
obtained from uterine endometrium (Fig. 2B). Using purified
stromal and epithelial cells, we have identified that FGF-9
was expressed primarily in the stromal cells (Fig. 2C).
Cell-specific expression of FGF receptors in
uterine endometrium
The high affinity FGF receptors (FGFR2 and FGFR3) were
detected in the uterine endometrium (Fig. 3). Both of them
have been stained positive in both glandular epithelial cells
and stromal cells. Control experiments conducted on serial
sections of endometrium using normal rabbit serum instead
of specific primary antibody showed no immunostaining
confirmed the specificity of the immunoreaction (Fig. 3,
B and D). Because the antibodies used in this study were
not able to distinguish the alternatively spicing variants,
we have designed primers to specifically amplify FGFR2IIIb,
FGFR2IIIc, FGFR3IIIb, and FGFR3IIIc, respectively. Figure 4
shows that FGFR2IIIc and FGFR3IIIc are primarily expressed in
stromal cells, whereas FGFR2IIIb is present mainly in the
epithelial cells. FGFR3IIIb is expressed in both epithelial and
stromal cells. The amplified FGFR3IIIb PCR product was further subjected to sequence analysis because this is the first
report demonstrating the presence of FGFR3IIIb in uterine endometrium. Alignment result showed the 3⬘ end of amplified
product is 100% identical with the first 118 bases of exon 8,
indicating that it is indeed the IIIb splicing variant of FGFR3
(data not shown).
2718
Endocrinology, July 2002, 143(7):2715–2721
FIG. 2. Expression of FGF-9 transcript and protein in uterine endometrium. A, Amounts of FGF-9 transcripts express in uterine endometria of early proliferative phase (EP, n ⫽ 8), late proliferative phase
(LP, n ⫽ 6), and secretory phase (S, n ⫽ 11). Concentrations of FGF-9
in early (ES) and late secretory (LS) phases were not different and
were therefore combined as secretory phase. B, A representative
Western blot showing the presence of FGF-9 and ␤-actin (blotted by
mouse-anti ␤-actin, Oncogene Research Products, Boston, MA) protein in endometrial tissue extracts. C, positive control of 4 ng recombinant human FGF-9. Similar patterns were found in four samples
per stage of menstrual cycle. C, Expression of FGF-9 transcripts in
purified stromal (n ⫽ 9) and epithelial (n ⫽ 9) cells.
Tsai et al. • FGF-9 Is an Endometrial Stromal Growth Factor
FIG. 3. Immunohistostaining of FGF receptors in normal endometrium. Proteins of FGFR2 (A) and FGFR3 (C) were positively stained
in both epithelial glands and stromal cells. Negative control of serial
sections using nonspecific rabbit Ig instead of primary antibody was
shown in B and D, respectively. Similar staining patterns were seen
in four more sets of samples/group. Insets in A and C are enlarged
image showing the positive staining of stromal cells. Scale bar, 15 ␮m
in insets of A and C; 30 ␮m in other panels.
FGF-9 stimulates endometrial stromal cells proliferation
Proliferation of endometrial stromal cells is induced by
FGF-9 in a dose-dependent manner either in the presence of
1% charcoal-stripped FBS (data not shown) or in serum-free
condition (Fig. 5A). The effective dose of FGF-9 is less than
10 ng/ml. At the dose of 100 ng/ml, FGF-9 stimulated more
stromal cells proliferation than 10% serum indicating the
strong mitogenic effect of FGF-9 on endometrial stromal cells
(Fig. 5A). The mitogenic effect of FGF-9, but not FGF-2, can
be blocked by addition of anti-FGF-9 antibody provided the
evidence for the specificity of growth effect (Fig. 5B). In
contrast to its potent growth effect on stromal cells, FGF-9
exerts no effect on stimulation of epithelial cell proliferation
even at the concentration of 100 ng/ml (Fig. 6).
Regulation of FGF-9 expression by estrogen
and progesterone
The expression of FGF-9 is induced by estrogen as demonstrated by the increase in FGF-9 transcripts after treatment
with various doses (10⫺11–10⫺7 m) of 17␤-estradiol (Fig. 7A).
On the other hand, progesterone failed to stimulate FGF-9
expression at any concentration tested (10⫺11–10⫺7 m). Coadministration of 17␤-estradiol (10⫺9 m) and progesterone
(10⫺9 m) did not induce more FGF-9 compared with 17␤estradiol treated alone (Fig. 7A). Treatment of endometrial
FIG. 4. Expression of specific splicing variants of FGF receptors in
endometrial stromal and epithelial cells. Quantitative RT-PCR analysis of FGFR2IIIb, FGFR2IIIc, FGFR3IIIb, and FGFR3IIIc from
paired stromal (S) and epithelial cells (E) isolated from disease-free
uterine endometrium (n ⫽ 9).
stromal cells with 17␤-estradiol (10⫺9 m) induced timedependent increase in FGF-9 protein as indicated by immunoprecipitation of cell lysate with monoclonal antibody
specific to FGF-9 (Fig. 7B).
Tsai et al. • FGF-9 Is an Endometrial Stromal Growth Factor
FIG. 5. Proliferation of primary endometrial stromal cells in response
to FGF-9 or FGF-2. A, Representative figure showing 3H-thymidine
incorporation of stromal cells treated with various doses of FGF-9 in
the absence of serum or with 10% FBS alone. B, Representative figure
showing 3H-thymidine incorporation of stromal cells treated with 50
ng/ml of FGF-9 or FGF-2 in the presence or absence of 10 ng/ml
anti-FGF-9 antibody. Data were expressed as mean ⫾ SEM from an
experiment performed in triplicate. A total of five independent experiments were conducted and the results were identical. Asterisk
indicates significant difference between FGF-9 treated and FGF-9
plus antibody treated groups.
Endocrinology, July 2002, 143(7):2715–2721 2719
FIG. 7. Expression of FGF-9 transcripts in primary stromal cells
treated with various doses of 17␤-estradiol (E2) or progesterone (P4)
or the combination of E2 (10⫺9 M) and P4 (10⫺9 M). A, Combinatory
data of six independent experiments. Asterisks indicate significant
difference from hormone-free group using ANOVA followed by Dunnett’s test (P ⬍ 0.05). B, Representative picture of FGF-9 immunoprecipitated from cultured stromal cells followed by Western blotting
shows the time- and treatment-dependent increase of FGF-9. A total
of five independent experiments were conducted, and the results were
similar. C4 and C24, Cells were treated with vehicle for 4 or 24 h,
respectively; E4 and E24, cells were treated with E2 for 4 or 24 h.
thymidine incorporation was used to evaluate the proliferation of estrogen-treated endometrial stromal cells under
serum-free condition. Figure 8 shows that administration of
1 nm 17␤-estradiol induces endometrial stromal cell proliferation. The mitogenic effect of estradiol was blocked by
cotreatment with anti FGF-9 antibody. Addition of anti
FGF-9 antibody to cultured stromal cell, on the other hand,
did not cause significant adverse effect (Fig. 8).
Discussion
FIG. 6. Proliferation of primary endometrial epithelial cells in response to FGF-9. A representative figure showing 3H-thymidine incorporation of epithelial cells treated with various doses of FGF-9 in
the absence of serum or with 10% FBS alone. A total of four independent experiments were conducted and the results were identical.
Estradiol-induced endometrial stromal cells proliferation is
mediated by FGF-9
To further elucidate the biological significance of estrogeninduced FGF-9 mRNA expression in stromal cells, 3H-
The current report constitutes the premier attempt to unveil the expression pattern and physiological function of
FGF-9 in human uterine endometrium. In this study, we
found that FGF-9 was expressed abundantly in human endometrial stromal cells, especially during the late proliferative phase. The expression of FGF-9 was induced by 17␤estradiol and markedly stimulated endometrial stromal cell
proliferation. Herein we present evidence linking the rise of
estrogen during late proliferative phase to the rapid proliferation of uterine endometrium via estrogen-induced upregulation of FGF-9.
FGF-9 was first identified as a neuro-protecting and survival growth factor and was widely expressed in the brain
(11). It has been shown that FGF-9 is associated with lung and
testis development in the fetus and is a prostatic stromalderived autocrine/paracrine growth factor in adult prostate
gland (16, 17, 21). In this study, we demonstrated that FGF-9
was expressed in normal uterine endometrium, especially in
stromal cells. Due to its affinity for cell surface and extra-
2720
Endocrinology, July 2002, 143(7):2715–2721
FIG. 8. Proliferation of primary endometrial stromal cells in response
to 17␤-estradiol (E2) was blocked by anti-FGF-9 antibody (Ab). A
representative figure showing 3H-thymidine incorporation of stromal
cells treated with vehicle (Con) or E2 (10⫺9 M) in the presence or
absence of 10 ng/ml anti-FGF-9 antibody. Four independent experiments were performed, and results were identical. Asterisk indicates
significant difference from control using ANOVA followed by Dunnett’s test (P ⬍ 0.05).
cellular matrix heparan sulfate, diffusion of FGF-9 from the
site of synthesis is limited. Thus, it is unlikely that FGF-9 of
uterine origin will exert systematic effect via circulation. In
contrast, the most possible target for uterine FGF-9 will be the
uterus per se via an autocrine/paracrine mechanism. In addition, expression of FGF-9 was the greatest in late proliferative phase, which is coincident with rapid proliferation of
uterine endometrium, suggesting that FGF-9 may play roles
in regulation of endometrial cell growth. Indeed, FGF-9 stimulated endometrial stromal cell proliferation in a dosedependent manner and its effect was blocked by addition of
anti-FGF-9 antibody. Our result is in concordance with report
by Giri et al. (21) showing that FGF-9 promotes prostatic
stromal cell growth and extended the action of FGF-9 to the
uterus.
The result that FGF-9 failed to stimulate uterine epithelial
cell proliferation is in contrast to the report that FGF-9 is also
a mitogen for prostatic epithelial cells (21). The underlying
mechanism responsible for this discrepancy is not clear but
may be due to tissue-specific expression of different isoforms
of FGF receptors. The prostate study did not evaluate the
expression of particular splicing variants in epithelial cells,
whereas we found that high affinity receptors of FGF-9,
namely FGFR2IIIc and FGFR3IIIc, were absence or expressed
in very low level in uterine epithelial cells. Although our
immunohistochemistry study demonstrated that FGFR2 and
FGFR3 were both expressed in endometrial epithelium and
stroma, the antibodies used in this study were not able to
distinguish the “b” from “c” splicing variants. Using specific
primers to identify splicing variants of “b” or “c”, we found
that FGFR2IIIc and FGFR3IIIc are mainly expressed in stromal cells, whereas FGFR2IIIb is primarily expressed in epithelial cells. The detection of FGFR3IIIb transcript in epithelial and stroma cells is interesting. To the best of our
knowledge, there was no information regarding the expression and function of FGFR3IIIb in uterine endometrium in
the literature. Our current result represents the first report to
document the presence of FGFR3IIIb in both epithelial and
stromal cells. It is known that FGF-9 binds to FGFR2 and
Tsai et al. • FGF-9 Is an Endometrial Stromal Growth Factor
FGFR3 with high affinity, whereas FGFR1 is not receptors for
FGF-9 (18). Activation of FGFR2IIIc or FGFR3IIIc by FGF-9
results in great mitogenic effect, whereas activation of
FGFR2IIIb and FGFR3IIIb only leads to weak response (19,
20). Our studies show that both epithelial and stromal cells
proliferate well in the presence of serum, however, only
stromal cells respond to FGF-9. It seems that some growth
factors other than FGF-9 may be involved in epithelial cell
proliferation. Epidermal growth factor, IGF-I, and IGF-II
were shown to have mitogenic effect on cultured uterine
epithelial cells (33, 34). Animal study also showed that the
injection of FGF-7 into mice elicited an increased cell proliferation in uterine epithelial cells but not in the stroma. This
is probably due to the presence of FGFR2IIIb, the high affinity receptor for FGF-7 in the epithelium but not in the
stroma (35). Thus, the presence of FGFR2IIIb and FGFR3IIIb
in epithelial cells may respond to other members of FGFs
rather than to FGF-9.
Estrogen is known for its mitogenic effect in the uterus.
However, estrogen normally does not directly stimulate cell
proliferation. The mitogenic effect of estrogen on uterine
epithelial cells is elicited via paracrine growth promoting
influence from stromal cells (23, 36). It has been shown that
the injection of FGF-7, a stroma-derived growth factor, into
neonatal mouse stimulated uterine epithelial growth (35).
Furthermore, FGF-7, FGF-10 and their receptors FGFR2IIIb
are identified in the neonatal ovine uterus (25, 37). Consistent
with their findings, we also demonstrate the existence of
FGFR2IIIb in human endometrial epithelial cells. In the
present study, we further demonstrate the specific expression of FGF-9 and its receptors FGFR2IIIc and FGF3IIIc in
endometrial stroma. In association with systemic hormonal
profile, the elevated expression of FGF-9 during late proliferative phase suggests that expression of FGF-9 may be regulated by estradiol. Indeed, administration of various doses
of estradiol induced marked FGF-9 production by endometrial stromal cells. The results that FGF-9 is induced by estrogen and is able to stimulate uterine stromal cell proliferation make it an excellent candidate for endometrial
estromedin growth factor. This hypothesis was substantiated
by the finding that anti-FGF-9 antibody, when added to
cultured stromal cells along with estrogen, completely inhibited estrogen mediated stromal cell proliferation. This
result demonstrates that FGF-9 is, at least one of, the major
peptidic growth factors downstream of estrogen-mediated
uterine stromal cell proliferation.
To the contrary of estrogen stimulation of FGF-9, progesterone failed to stimulate FGF-9 expression either alone or in
combination with estradiol, which echoes the in vivo data
showing that FGF-9 concentration was not different between
early proliferative phase and entire secretory phase. During
the menstrual cycle, both epithelial and stromal cells proliferate during mid to late proliferative phase; however, stromal cells also proliferate during secretory phase (38, 39).
Progesterone, which is secreted during secretory phase, stimulates stromal cell proliferation and differentiation. FGF-2
has been reported to control the growth of rat uterine stromal
cells, and its effect is dependent on progesterone, not estrogen (40, 41). Taken together, different growth factors may be
Tsai et al. • FGF-9 Is an Endometrial Stromal Growth Factor
involved in estrogen and progesterone stimulated uterine
stromal cell proliferation.
In conclusion, we have demonstrated that FGF-9 is a potent uterine stromal cells growth factor that was markedly
expressed in stromal cell during late proliferative phase.
Expression of FGF-9 is regulated by estrogen but not progesterone. Cell-type specific expression of high affinity FGF
receptors may determine the target of FGF-9-mediated
growth effect in human uterus.
Acknowledgments
Received December 31, 2001. Accepted March 25, 2002.
Address all correspondence and requests for reprints to: Lih-Yuh C.
Wing, Ph.D., Department of Physiology, National Cheng Kung University Medical College, Tainan, Taiwan, Republic of China. E-mail:
[email protected].
This work was supported by Grants NSC89-2320-B-006-094 (to
L.-Y.C.W.) and NSC89-2320-B-006-119 (to S.-J.T.) from the National Science Council, Republic of China.
References
1. Ornitz DM, Itoh N 2001 Fibroblast growth factors. Genome Biol 2:S3005.1–
S3005.12
2. Shimada T, Mizutani S, Muto T, Yoneya T, Hino R, Takeda S, Takeuchi Y,
Fujita T, Fukumoto S, Yamashita T 2001 Cloning and characterization of
FGF23 as a causative factor of tumor-induced osteomalacia. Proc Natl Acad Sci
USA 98:6500 – 6505
3. Werner S, Duan DS, de Vries C, Peters KG, Johnson DE, Williams LT 1992
Differential splicing in the extracellular region of fibroblast growth factor
receptor 1 generates receptor variants with different ligand-binding specificities. Mol Cell Biol 12:82– 88
4. Chellaiah AT, McEwen DG, Werner S, Xu J, Ornitz DM 1994 Fibroblast
growth factor receptor (FGFR) 3. Alternative splicing in immunoglobulin-like
domain III creates a receptor highly specific for acidic FGF/FGF-1. J Biol Chem
269:11620 –11627
5. Johnson DE, Lu J, Chen H, Werner S, Williams LT 1991 The human fibroblast
growth factor receptor genes: a common structural arrangement underlies the
mechanisms for generating receptor forms that differ in their third immunoglobulin domain. Mol Cell Biol 11:4627– 4634
6. Duan DS, Werner S, Williams LT 1992 A naturally occurring secreted form
of fibroblast growth factor (FGF) receptor 1 binds basic FGF in preference over
acidic FGF. J Biol Chem 267:16076 –16080
7. Avivi A, Yayon A, Givol D 1993 A novel form of FGF receptor-3 using an
alternative exon in the immunoglobulin domain III. FEBS Lett 330:249 –252
8. Yan G, Fukabori Y, McBride G, Nikolaropolous S, McKeehan WL 1993 Exon
switching and activation of stromal and embryonic fibroblast growth factor
(FGF)-FGF receptor genes in prostate epithelial cells accompany stromal independence and malignancy. Mol Cell Biol 13:4513– 4522
9. Orr-Urtreger A, Bedford MT, Burakova T, Arman E, Zimmer Y, Yayon A,
Givol D, Lonai P 1993 Developmental localization of the splicing alternatives
of fibroblast growth factor receptor-2 (FGFR2). Dev Biol 158:475– 486
10. Miyamoto M, Naruo K, Seko C, Matsumoto S, Kondo T, Kurokawa T 1993
Molecular cloning of a novel cytokine cDNA encoding the ninth member of
the fibroblast growth factor family, which has a unique secretion property. Mol
Cell Biol 13:4251– 4259
11. Tagashira S, Ozaki K, Ohta M, Itoh N 1995 Localization of fibroblast growth
factor-9 mRNA in the rat brain. Brain Res Mol Brain Res 30:233–241
12. Mattei MG, Penault-Llorca F, Coulier F, Birnbaum D 1995 The human FGF9
gene maps to chromosomal region 13q11– q12. Genomics 29:811– 812
13. Song J, Slack JM 1996 XFGF-9: a new fibroblast growth factor from Xenopus
embryos. Dev Dyn 206:427– 436
14. Kanda T, Iwasaki T, Nakamura S, Kurokawa T, Ikeda K, Mizusawa H 2000
Self-secretion of fibroblast growth factor-9 supports basal forebrain cholinergic
neurons in an autocrine/paracrine manner. Brain Res 876:22–30
15. Garces A, Nishimune H, Philippe JM, Pettmann B, deLapeyriere O 2000
FGF9: a motoneuron survival factor expressed by medial thoracic and sacral
motoneurons. J Neurosci Res 60:1–9
16. Colvin JS, White AC, Pratt SJ, Ornitz DM 2001 Lung hypoplasia and neonatal
death in Fgf9-null mice identify this gene as an essential regulator of lung
mesenchyme. Development 128:2095–2106
Endocrinology, July 2002, 143(7):2715–2721 2721
17. Colvin JS, Green RP, Schmahl J, Capel B, Ornitz DM 2001 Male-to-female sex
reversal in mice lacking fibroblast growth factor 9. Cell 104:875– 889
18. Hecht D, Zimmerman N, Bedford M, Avivi A, Yayon A 1995 Identification
of fibroblast growth factor 9 (FGF9) as a high affinity, heparin dependent
ligand for FGF receptors 3 and 2 but not for FGF receptors 1 and 4. Growth
Factors 12:223–233
19. Santos-Ocampo S, Colvin JS, Chellaiah A, Ornitz DM 1996 Expression and
biological activity of mouse fibroblast growth factor-9. J Biol Chem 271:1726 –
1731
20. Ornitz DM, Xu J, Colvin JS, McEwen DG, MacArthur CA, Coulier F, Gao G,
Goldfarb M 1996 Receptor specificity of the fibroblast growth factor family.
J Biol Chem 271:15292–15297
21. Giri D, Ropiquet F, Ittmann M 1999 FGF9 is an autocrine and paracrine
prostatic growth factor expressed by prostatic stromal cells. J Cell Physiol
180:53– 60
22. Koji T, Chedid M, Rubin JS, Slayden OD, Csaky KG, Aaronson SA, Brenner
RM 1994 Progesterone-dependent expression of keratinocyte growth factor
mRNA in stromal cells of the primate endometrium: keratinocyte growth
factor as a progestomedin. J Cell Biol 125:393– 401
23. Pierro E, Minici F, Alesiani O, Miceli F, Proto C, Screpanti I, Mancuso S,
Lanzone A 2001 Stromal-epithelial interactions modulate estrogen responsiveness in normal human endometrium. Biol Reprod 64:831– 838
24. Moller B, Rasmussen C, Lindblom B, Olovsson M 2001 Expression of the
angiogenic growth factors VEGF, FGF-2, EGF and their receptors in normal
human endometrium during the menstrual cycle. Mol Hum Reprod 7:65–72
25. Taylor KM, Chen C, Gray CA, Bazer FW, Spencer TE 2001 Expression of
messenger ribonucleic acids for fibroblast growth factors 7 and 10, hepatocyte
growth factor, and insulin-like growth factors and their receptors in the neonatal ovine uterus. Biol Reprod 64:1236 –1246
26. Tsai SJ, Wu MH, Lin CC, Sun HS, Chen HM 2001 Regulation of steroidogenic
acute regulatory protein expression and progesterone production in endometriotic stromal cells. J Clin Endocrinol Metab 86:5765–5773
27. Tsai SJ, Wiltbank MC 2001 Differential effects of prostaglandin F2␣ on in vitro
luteinized bovine granulosa cells. Reproduction 122:245–253
28. Wing LY, Hsieh WJ, Yang MR 1998 Ovarian steroids reduced apoptotic death
in SV40 temperature-sensitive mutant virus transformed uterine epithelial
cells. Life Sciences 62:981–987
29. Tsai SJ, Wu MH, Chuang PC, Chen HM 2001 Distinct regulation of gene
expression by prostaglandin F2␣ (PGF2␣) is associated with PGF2␣ resistance
or susceptibility in human granulosa-luteal cells. Mol Hum Reprod 7:415– 423
30. Tsai S-J, Wiltbank MC 1996 Quantification of mRNA using competitive RTPCR with standard-curve methodology. BioTechniques 21:862– 866
31. Tsai SJ, Wiltbank MC 1998 Standard curve quantitative competitive RT-PCR
(SC-QC-RT-PCR): a simple method to quantify absolute concentration of
mRNA from limited amounts of sample. In: Siebert PD, Larrick JW, eds. Gene
cloning and analysis by RT-PCR. Palo Alto, CA: Eaton; 91–101
32. SAS 1987 SAS/STAT User’s Guide, version 6.4. Cary, NC: SAS Institute, Inc.
33. Zhang L, Rees MC, Bicknell R 1995 The isolation and long-term culture of
normal human endometrial epithelium and stroma. Expression of mRNAs for
angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci 108 (Part 1):323–331
34. Badinga L, Song S, Simmen RC, Clarke JB, Clemmons DR, Simmen FA 1999
Complex mediation of uterine endometrial epithelial cell growth by insulinlike growth factor-II (IGF-II) and IGF-binding protein-2. J Mol Endocrinol
23:277–285
35. Hom YK, Young P, Thomson AA, Cunha GR 1998 Keratinocyte growth factor
injected into female mouse neonates stimulates uterine and vaginal epithelial
growth. Endocrinology 139:3772–3779
36. Cooke PS, Buchanan DL, Lubahn DB, Cunha GR 1998 Mechanism of estrogen
action: lessons from the estradiol receptor-␣ knockout mouse. Biol Reprod
59:470 – 475
37. Chen C, Spencer TE, Bazer FW 2000 Fibroblast growth factor-10: a stromal
mediator of epithelial function in the ovine uterus. Biol Reprod 63:959 –966
38. Bonatz G, Klapper W, Barthe A, Heidorn K, Jonat W, Krupp G, Parwaresch
R 1998 Analysis of telomerase expression and proliferative activity in the
different layers of cyclic endometrium. Biochem Biophys Res Commun 253:
214 –221
39. Salmi A, Heikkila P, Lintula S, Rutanen EM 1998 Cellular localization of c-jun
messenger ribonucleic acid and protein and their relation to the proliferation
marker Ki-67 in the human endometrium. J Clin Endocrinol Metab 83:1788 –
1796
40. Piva M, Flieger O, Rider V 1996 Growth factor control of cultured rat uterine
stromal cell proliferation is progesterone dependent. Biol Reprod 55:1333–1342
41. Jones SR, Kimler BF, Justice WM, Rider V 2000 Transit of normal rat uterine
stromal cells through G1 phase of the cell cycle requires progesterone-growth
factor interactions. Endocrinology 141:637– 648