articles
Visualization of gene activity in
living cells
Toshiro Tsukamoto*†, Noriyo Hashiguchi*†, Susan M. Janicki*, Tudorita Tumbar‡, Andrew S. Belmont‡ and
David L. Spector*§
*Cold Spring Harbor Laboratory, One Bungtown Road, Cold Spring Harbor, New York 11724, USA
† Department of Life Science, Himeji Institute of Technology, 3-2-1 Koto, Kamigori, Hyogo 678-1297, Japan
‡ Department of Cell and Structural Biology, University of Illinois, Urbana, Illinois 61801, USA
§ e-mail: [email protected]
Chromatin structure is thought to play a critical role in gene expression. Using the lac operator/repressor system
and two colour variants of green fluorescent protein (GFP), we developed a system to visualize a gene and its protein product directly in living cells, allowing us to examine the spatial organization and timing of gene expression in
vivo. Dynamic morphological changes in chromatin structure, from a condensed to an open structure, were
observed upon gene activation, and targeting of the gene product, cyan fluorescent protein (CFP) reporter to peroxisomes was visualized directly in living cells. We found that the integrated gene locus was surrounded by a promyelocytic leukaemia (PML) nuclear body. The association was transcription independent but was dependent upon the
direct in vivo binding of specific proteins (EYFP/lac repressor, tetracycline receptor/VP16 transactivator) to the
locus. The ability to visualize gene expression directly in living cells provides a powerful system with which to study
the dynamics of nuclear events such as transcription, RNA processing and DNA repair.
he nucleus was once thought of as a non-structured amorphous environment in which interactions occur in a rather
random manner, but a high degree of functional organization
has since been found within the nucleus (for reviews see refs 1,2).
The ability to tag specific proteins or nucleic-acid sequences directly
in living cells has greatly extended the ability of light microscopy to
address structure–function questions relating to many fundamental
T
a
pSV2-EYFP-lac
repressor
pTet-On
EYFP
lac
repressor
cellular processes. Most notable has been the revolutionary use of
green fluorescent protein and its spectral variants to assess the
dynamic aspects of cellular function (for reviews see refs 3–5).
Knowledge of the organization of chromatin in the interphase
nucleus, above the level of the folded 30-nm fibre, has substantially lagged behind our molecular and biochemical understanding of
chromatin structure and function. This has been due in part to
VP16
r tetR
Transcription
Dox
lac op
TRE
Pmin
x8
x6
x32
x16
p3216PCβ
Visualize gene
Inducible promoter
by doxycycline
CFP
Monitor
transcription
Translation
SKL
Peroxisome
β-globin Intron
Peroxisome
targeting
signal (SKL)
b
p3216PCβ
pTK-Hyg
pTet-On
pSV2-EYFP-lac repressor
Doxycycline
Hygromycin B
selection
BHK
Figure 1 Experimental design. a, Schematic representation of plasmid
p3216PCβ. An approximately 10-kb lac-operator repeat is present at the 5‘ end of
the plasmid, and is visualized in cells with EYFP/lac repressor expressed from the
pSV2-EYFP/lac repressor plasmid. Transcription of CFP–SKL is activated by binding
of the pTet-On transactivator in the presence of doxycycline. b, Transfection
scheme. BHK cells were stably transfected with p3216PCβ and pTK-Hyg and
NATURE CELL BIOLOGY VOL 2 DECEMBER 2000 http://cellbio.nature.com
clone 2, 22, 102
selected with hygromycin B. Isolated clones were subjected to a second transfection with pTet-On and pSV2-EYFP/lac repressor plasmids followed by induction with
doxycycline. The integrated plasmid was visualized as a YFP signal in the nucleus,
and the transcriptional state of the integrated locus was monitored by the appearance of the peroxisomal CFP signal in the cytoplasm (cyan).
871
articles
a
Copy number
b
Clone
100 101 10 2 10 3
2
22 102
Size (kb)
23.1
9.4
6.6
BHK
Dox – +
M r (K)
194
120
87
64
52
Clone 2 Clone 22 Clone 102
– +
– +
– +
39
4.4
26
21
2.3
2.0
c
M r (K)
0.56
1
2
3
4
5
6
7
1
2
3
4
5
6
7
8
0
Dox –
194
120
87
64
52
39
1
+
2
+
4
+
6
+
8
+
22
+
8
–
2
3
4
5
6
7
8
22 (h)
–
8
26
21
1
Figure 2 Characterization of isolated clones. a, Southern blotting of isolated
clones. Genomic DNA was isolated from parental BHK cells, and three isolated
clones (2, 22 and 102) were examined by Southern blotting to derive estimates of
plasmid copy number in each stable cell line. Lanes 1–4, BHK genomic DNA containing 6.2 pg, 62 pg, 620 pg or 6.2 ng of p3216PCβ corresponding to 1, 10,
100 and 1,000 copies per haploid genome; lane 5, Biotin-labelled λ-HindIII marker;
lanes 6–8, genomic DNA of clones 2, 22 and 102, respectively. Lower panel,
shorter exposure time. b, Induction of CFP–SKL protein by doxycycline. Cells were
transfected with pTet-On and examined for induction of the CFP–SKL fusion protein
9
by immunoblotting with an anti-GFP antibody. Lanes 1 and 2, parental BHK; lanes 3
and 4, clone 2; lanes 5 and 6, clone 22; lanes 7 and 8, clone 102. Lanes 1, 3, 5
and 7, doxycycline (–); lanes 2, 4, 6 and 8, doxycycline (+). c, Time course of
induction of clone-2 cells. Cells were transfected with pTet-On. Two independent
transfections were pooled and plated into ten dishes. Doxycycline was added 2 h
after transfection, as indicated. Cells were examined at 0 (lane 1), 1 (lane 2), 2
(lane 3), 4 (lane 4), 6 (lane 5), 8 (lane 6) and 22 h (lane 7), after addition of doxycycline; doxycycline-free samples were also prepared at 8 (lane 8) and 22 h (lane 9).
Table 1 Correlation between chromatin organization and CFP/SKL gene expression
Time (h)
DNA
Peroxisomes
0
1
2
4
6
8
22
8(–)
22(–)
Closed
–
100
98
96
82
Open
–
0
2
1
4
61
54
52
94
97
8
18
5
6
Closed
+
0
0
2
2
2
2
0
5
0
0
Open
+
0
0
1
12
29
28
38
0
1
Clone-2 cells were transfected with pTet-On and plated onto coverslips. Doxycycline was added 2 h after transfection. Cells were fixed at the times as indicated, and the gene locus was
visualized with recombinant EGFP/lac repressor protein. We counted 100 nuclear dots. Homogeneous and round signals were scored as closed; heterogeneous signals were counted as
open. According to our criteria, signals in Fig. 5a–c are closed and d–l are open (DNA was visualized by in vivo expression of EYFP/lac repressor). At early time points, the difference
between open and closed cells was not significant.
limitations in preserving chromatin structure after fixation and
antibody labelling. Belmont and colleagues have taken advantage of
the thermodynamic properties of the lac operator/repressor interaction to examine chromatin organization in vivo (for a review see
ref. 6). Using lac operator–repressor localization combined with
gene amplification, it was possible to visualize large-scale
chromatin fibres directly in living cells 7. Immunoelectron
microscopy showed that these fibres corresponded to previously
described chromonema fibres of ~100 nm. Using this system, a 90million-base-pair region of late-replicating DNA comprising a heterochromatic homogeneously staining region was examined; this
region was found to decondense just before DNA replication, and
4–6 hours into S phase it moves from a peripheral nuclear region to
the nuclear interior8.
872
In a subsequent study, a striking large-scale decondensation of
chromatin into extended chromonema fibres was observed9 by
specifically targeting the acidic activation domain of the herpes
simplex virus transcriptional activator VP16 to two heterochromatic amplified chromosome regions. These data led the authors to
suggest a functional link between recruitment of the transcriptional machinery and changes in large-scale chromatin structure.
Several other studies have made use of this system to examine the
separation of sister chromatids, and chromosome dynamics in living yeast cells10,11.
Here we have extended these studies by examining chromatin
organization and its relationship to transcriptional activity in the
context of the synthesis of an inducible pre-mRNA in a mammalian cell. We have managed to visualize gene expression directly
NATURE CELL BIOLOGY VOL 2 DECEMBER 2000 http://cellbio.nature.com
articles
No transfection
pTet-On, Dox(–)
pTet-On, Dox(+)
BHK
Repressor stain
a
b
c
d
e
f
g
h
i
j
k
l
m
n
o
Clone 2
Repressor stain
Clone 22
Repressor stain
Clone 102
Repressor stain
Clone 2
In vivo expression
Figure 3 Visualization of the genetic locus. Parental BHK cells and each clone
were examined for the localization of the genetic locus. Only cells expressing pTetOn and exposed to doxycycline exhibit a CFP–SKL signal (f, i, l, o). Overlay staining
with recombinant EGFP/lac repressor (a–l) or in vivo expression of EYFP/lac repres-
in living cells. Furthermore, we have demonstrated that the stably
integrated gene locus associates with a PML nuclear body.
sor signal (m–o, fixed with 4% formaldehyde) is represented as a yellow colour. The
CFP–SKL signal is shown in cyan (a–o). The enhancement of each signal was comparable among three panels of the same cell. The CFP signal in a–c was processed
as in j–l. Scale bar represents 10 µm.
Unfixed, Dox(–)
Unfixed, Dox(+)
4%PFA
Results
A system for visualizing gene expression. To examine the dynamics of gene expression in living cells, we developed several baby
hamster kidney (BHK) cell lines containing a stably integrated plasmid composed of 256 copies of the lac operator sequence.
Downstream of these repeats we inserted 96 copies of the tetracycline-responsive element controlling a minimal cytomegalovirus
(CMV) promoter regulating the expression of a cyan fluorescent
protein with a peroxisome targeting signal-1 (Ser-Lys-Leu (SKL)
tripeptide) at its carboxy terminus12 (Fig. 1a). The entire plasmid
(p3216PCβ) sequence encompassed 18.52 kilobases (kb) (Fig. 1a).
The system was designed such that when the stable cells were transiently transfected with an EYFP/lac repressor plasmid, the
expressed fusion protein would be able to localize to the stably integrated locus by association of the EYFP/lac repressor protein with
the lac operator sequences. Alternatively, the integrated locus could
be localized after fixation using a bacterially expressed EGFP/lac
repressor fusion protein. The repressor binds to the operator with
a Kd of 10–13 M (ref. 13). Co-transfection with the pTet-On plasmid
followed by addition of doxycycline to the culture medium activates the tetracycline-responsive element, stimulating transcription
of the CFP–SKL fusion protein. Localization of the fusion protein
to peroxisomes confirms that transcription has occurred (Fig. 1b).
Southern blot analysis was used to determine the relative copy
number of the plasmid sequences in several clonal cell lines. PstI,
which cuts p3216PCβ only once, gave unit size bands indicating
that p3216PCβ was tandemly integrated into the genome in each of
NATURE CELL BIOLOGY VOL 2 DECEMBER 2000 http://cellbio.nature.com
a
Saponin/4%PFA
b
Triton/1.6%PFA
d
Saponin/4%PFA
repressor stain
Methanol
e
Triton/1.6%PF
repressor stain
g
c
f
Methanol
h
i
Figure 4 Comparison of different methods of fixation and staining. The
EYFP/lac repressor was expressed in a–f and doxycycline was added to all except
a. The YFP signal was observed without fixation (a and b), after fixation with 4%
formaldehyde (PFA) for 1 h (c), with saponin pretreatment before fixation (d and g),
Triton X-100 pretreatment before fixation with 1.6% formaldehyde (e and h), or with
ice-cold methanol for 5 min (f and i). EGFP/lac repressor overlay staining was done
after different fixation methods (g–i) of cells transfected with pTet-On. Peroxisomal
CFP–SKL signal was lost during fixation in e, f, h and i. Formaldehyde and detergents were made up in PBS, pH 7.4. Scale bar represents 2 µm.
873
articles
0h
0.25 h
a
1h
0.5 h
b
e
g
j
Dox(–) 1
m
k
Dox(–) 3
n
Dox(+) 2
l
Dox(–) 6
p
o
Dox(+) 8
q
h
6h
5h
i
d
2.5 h
f
4h
Dox(–) 0
c
2h
1.5 h
3h
0.75 h
Dox(–) 8
r
s
Figure 5 Changes in chromatin organization during gene activation. Chromatin
organization was monitored in the same living cell for 6 h in the presence (a–l) or
absence (m–p) of doxycycline. Note the nuclear rotation over this time period. The
EYFP/lac repressor signal is strongly enhanced to show the position in the nucleus
(yellow) in the main panels. Appropriately enhanced images are shown in the insets.
CFP–SKL data were collected only in a, g, i, j, l, m and o–s. The enhancement conditions for CFP–SKL in a, g, i, m, o and p are the same; j and l are less enhanced.
Using fixed cells, CFP–SKL RNA in the nucleus was detectable 2 h (q) or 8 h (r) after
doxycyline induction, but no signal was observed in the absence of doxycycline (s).
The enhancement of the RNA FISH signal and the CFP–SKL signal are the same in q,
r and s. Images in the cyan channel were taken only at the time points indicated in
a, g, i, j, l, m and o–s. In q–s the RNA FISH signal is indicated in red, the EYFP/lac
repressor signal in green and the CFP-SKL signal in cyan. Scale bar represents
10 µm; insets, ×3 magnification.
the three clonal cell lines examined (Fig. 2a). For simplicity, we will
refer to the integration site as a genetic locus. Integrated copy numbers of the three clones were estimated as 1,000 (clone 2), 50 (clone
102) and 10 (clone 22) copies per haploid genome (Fig. 2a). We
then examined the response of the integrated locus to doxycycline.
All three clones that transiently expressed pTet-On showed a significant stimulation of transcription 24 hours after treatment of
cells with doxycycline, as determined by immunoblot analysis using
an anti-GFP antibody that recognized the CFP–SKL fusion protein
(Fig. 2b). Minimal leakiness of the promoter was observed in all
three clones. The parental BHK cell line showed no response to
doxycycline treatment (Fig. 2b, lanes 1, 2).
To investigate the temporal response of the cells to doxycycline
more precisely, cells from clone 2 were transfected with pTet-On
and doxycycline was added 2 hours after transfection. Cells were
collected at the indicated time points and examined by
immunoblot analysis for the presence of the CFP–SKL fusion protein. This was first detected 6 h after the addition of doxycycline
(Fig. 2c, lane 5), and increased over time (Fig. 2c, lanes 6, 7). The
number of peroxisome(+) cells also increased over time. The
increase in the number of cells with an open chromatin structure
and peroxisome labelling (open/peroxisome(+); Table 1) at 22 h
compared with the earlier time points may be the result of cells that
were open/peroxisome(–) at 6–8 h not having accumulated
detectable levels of CFP–SKL in their peroxisomes (Table 1). No
protein product was detected at 8 or 22 h post-transfection in the
absence of doxycycline (Fig. 2c, lanes 8, 9).
Chromatin organization and transcription. The stably integrated
genetic locus was examined in all three clonal cell lines in the presence or absence of transcription. Cells were either not transfected
or transfected with pTet-On, and were then allowed to grow for 8 h
in the absence or presence of doxycycline. Cells were subsequently
fixed and the lac operator sequences localized by incubation with
bacterially expressed EGFP/lac repressor. In all cases, the parental
BHK cell line showed no nuclear EGFP/lac repressor signal and no
CFP–SKL protein product in the cytoplasm (Fig. 3a–c). Cells from
clones 2, 22 and 102 each showed a single site of integration of the
genetic locus in the absence (Fig. 3d, g, j) or presence (Fig. 3e, h, k)
of the pTet-On plasmid. Activation of the gene with doxycycline for
8 h resulted in the chromatin decondensing (Fig. 3f, i, l). This change
in chromatin morphology was obvious in cells from clone 2 but was
not as easily observed in cells from clones 22 or 102, which contain
fewer integrated copies of the plasmid. In addition, the degree of
decondensation varied among clone-2 cells. The presence of the
874
NATURE CELL BIOLOGY VOL 2 DECEMBER 2000 http://cellbio.nature.com
articles
8h 0 min
+15 min
a
b
c
d
e
f
g
h
i
j
k
l
Figure 6 The open chromatin structure is static. At 8 h after addition of doxycycline, an actively transcribing locus was examined every 15 s for changes in chromatin organization. This cell expressed CFP–SKL. The nucleus moved about 10 µm
during observation because of cell movement, but the shape of the open chromatin
region did not change. Scale bar represents 10 µm; boxes in a and b indicate the
regions of interest shown in c–l.
CFP–SKL fusion protein in peroxisomes confirmed not only that
doxycycline-dependent transcription had occurred in these cells,
but also that the messenger RNA translation product correctly
localized to its appropriate intracellular destination. Next, we visualized gene expression directly in clone-2 cells that transiently
expressed the pSV2-EYFP/lac repressor under the pTet-On geneexpression system. As was observed above, activation of transcription resulted in chromatin decondensation and the appearance of
the CFP–SKL fusion protein in peroxisomes (Fig. 3m–o).
We then examined the effect of fixation conditions on the reorganization of chromatin structure after transcriptional activation.
All fixation conditions used resulted in an extended chromatin
structure similar to that seen in living cells (Fig. 4). However,
formaldehyde fixation with or without prior permeabilization with
detergent (Fig. 4c–e, g–h) provided images that most closely resembled those observed in living cells (Fig. 4b). Cells fixed in methanol
(Fig. 4f, i) resulted in a more tightly packed chromatin structure,
perhaps because of the dehydrating properties of this fixative.
Subsequent experiments with fixed cells therefore used 4%
formaldehyde in PBS. That the observed reorganization of chromatin was not simply caused by binding of the EYFP/lac repressor
to the locus in living cells is indicated by the finding of a similar
morphology when fixed cells were stained with EGFP/lac repressor
(Fig. 4g–i).
Spatial organization and timing of gene expression. The ability to
visualize a gene and its protein product directly in living cells
allowed us to examine the spatial organization and timing of gene
expression in vivo. Clone-2 cells were co-transfected with pTetOn and pSV2-EYFP/lac repressor and allowed to attach to coverslips fitted for an FCS2 live-cell chamber. Then, 1.5 h post-transfection, the coverslip was mounted into the chamber and an
image of the inactive gene locus was acquired 30 min later (Fig.
5a, 0 h). Doxycycline was then perfused into the chamber to activate transcription of the CFP–SKL fusion protein. Images were
acquired for the gene and overlaid onto brightfield images of the
cell (Fig. 5b–l) at the indicated times after the addition of doxycycline. At various time points, an additional image was acquired,
showing the localization of the CFP–SKL fusion protein. Images
of CFP–SKL were taken at limited time points to reduce the possibility of phototoxicity.
Changes in chromatin organization were first detected about
30 min after the addition of doxycycline (Fig. 5c, see inset), and
fully extended chromatin organization was observed about 4 h
after doxycycline was added (Fig. 5j). The CFP–SKL gene product was first observed in living cells 3 h after the addition of
NATURE CELL BIOLOGY VOL 2 DECEMBER 2000 http://cellbio.nature.com
doxycycline (Fig. 5i). The lag period from the first observation of
a change in chromatin structure (+0.5 h) to the time the fusion
protein was first detected (+3 h) is probably related to the time
required for detectable levels of the fusion protein to accumulate
in the peroxisomes. RNA was easily detected at the site of transcription in many cells by in situ hybridization 2 h after the addition of doxycycline (Fig. 5q). For a more precise examination of
gene expression in living cells, images were acquired every 10 or 20
minutes over a 7-h period in both the YFP and CFP channels, and
the data were converted into a movie (see Supplementary
Information).
Over the time period that cells were observed, in many cases,
the locus appeared to reposition itself upon transcriptional activation (Fig. 5a–d). Cellular movements and nuclear rotation were
also seen during the observation of living cells (compare the
nuclear position in Fig. 5a, j, k). Cells that were not treated with
doxycycline showed no change in chromatin organization (Fig.
5m–p), no RNA hybridization signal (Fig. 5s), or any CFP–SKL
fusion protein signal (Fig. 5m–p, s), demonstrating the specificity
and tight control of the gene locus.
To examine potential chromatin movements during transcription more closely, 8 h after the addition of doxycycline images were
acquired every 15 s. Selected images from this time course are
shown in Fig. 6. No change in chromatin organization was
observed, and minimal movement of the locus was detected (compare Fig. 6a, b) over a 15-min time period. These data demonstrate
that significant movement of chromatin is not necessary for the
maintenance of gene activity.
Association with a PML body. Next, we examined the relationship
of the stably integrated gene locus to the localization of other
nuclear compartments. We investigated the relationship of the
gene locus to nucleoli, Cajal (coiled) bodies, and PML bodies. No
significant association was observed between the gene locus and
nucleoli or Cajal bodies. However, we found an association
between this locus and PML bodies in a significant number of
cells of all three clonal cell lines upon expression of the EYFP/lac
repressor and pTet-On (PML bodies have also been called ND10,
PODs (for PML oncogenic domains), and Kremer bodies (for a
review see ref. 14)). PML bodies vary in size from 0.3 to 1 µm in
diameter, and a typical mammalian nucleus contains 10–20 of
these structures. PML bodies have been suggested to play a role in
aspects of transcriptional regulation, and appear to be targets of
viral infection (for reviews see refs 14,15).
To study the relationship between the integrated gene locus
and PML bodies, we used clone-22 cells because the integrated
copy number was small (10 copies, ~185 kb), so the signal
appeared as a small dot, making the evaluation of co-localization
more precise. Clone-22 cells transiently transfected with pTet-On
and the pSV2-EYFP/lac repressor showed a significant degree of
association with PML bodies, as detected by immunocytochemistry, in the presence or absence of doxycycline, indicating that
this association was not dependent upon ongoing transcription of
the locus (Fig. 7a, b, Table 2). In cells transfected with only the
pSV2-EYFP/lac repressor (Fig. 7c) or pTet-On plasmids (Fig. 7d),
an association between the gene locus and PML bodies was still
observed.
To address whether this association was directly due to the
integration site of the gene locus or to the proteins associated with
the locus, clone-22 cells were fixed and stained with recombinant
EGFP/lac repressor protein. An association between the gene locus
and PML bodies was not observed if pSV2-EYFP/lac repressor and
pTet-On were not expressed in living cells (Fig. 7e). This finding
demonstrates that the association was related to a local high concentration of the expressed protein (EYFP/lac repressor or tetracycline receptor/VP16 transactivator) at the gene locus, rather than
the locus itself. These data suggest that PML bodies may function
as some kind of nuclear ‘sensor’ that can detect highly localized
concentrations of exogeneously introduced foreign proteins.
875
articles
a
b
c
d
e
f
Figure 7 Relationship between the integrated locus and PML bodies. PML
bodies were immunolabelled with monoclonal antibody 5E10 and are shown as a
red signal. The p3216PCβ integration site was visualized in clone-22 cells by in vivo
expressed EYFP/lac repressor (a–c), by EGFP/lac repressor overlay staining (d, e)
or by RNA FISH (f) after the addition of doxycycline and shown as a green signal.
CFP–SKL expression was shown as a cyan signal. Scale bar represents 10 µm;
insets, ×3 magnification.
Table 2 Association of a PML body with the integrated genetic locus
pTet-On
pSV2-EYFP/lac repressor
Dox
PML(+)/Per(+)
PML(+)/Per(–)
–
+
–
0/0
19/25 *
+
+
–
0/0
17/25 *
+
+
+
8/8
13/17 *
+
–
+
7/7
2/18
**
–
–
–
0/0
0/25
**
PML body localization in relation to the integrated genetic locus was examined in 25 clone-22 cells. PML(+), PML body was colocalized with or adjacent to DNA signal; PML(+)/Per(–), PML
body was co-localized with or adjacent to DNA signal in a peroxisome-negative cell. * Cells with EYFP/lac repressor signal were counted; only transfected cells were counted. ** Cells were
stained with the EGFP/lac repressor protein. All cells with DNA signal were counted, whether transfected or not.
Discussion
We have developed a cell system that allows the observation of
changes in chromatin organization related to gene expression, and
provides the ability to visualize gene readout directly in the form of
a CFP fusion protein with a peroxisome targeting signal. Using this
system we have visualized directly gene expression in living cells.
The mechanisms by which genes are activated have been investigated extensively using a variety of biochemical and genetic
approaches16. These studies have revealed the involvement of
876
ATP-driven chromatin remodelling complexes, as well as the chemical modification of specific lysine residues on the amino-terminal
histone tails by acetyltransferases (for review see refs 17–19).
However, the remodelling and modification of chromatin that allow
it to become transcriptionally competent must also be considered in
light of the constraints placed by chromatin packaging on the accessibility of chromatin to activator proteins in the interphase nucleus.
Although it has been difficult to accurately determine the packaging
ratio of the same gene in both the inactive and active states20,
NATURE CELL BIOLOGY VOL 2 DECEMBER 2000 http://cellbio.nature.com
articles
Robinett et al.7 used the lac operator/repressor system to examine
chromosome regions containing several copies of a dihydrofolate
reductase gene (a 90-million-base-pair amplified chromosome
region) to visualize chromatin organization directly at the level of
the 100–130-nm fibre in interphase cells. Remarkably, the observed
chromatin region was shown to undergo precisely timed contractions and expansions during the G1 and the late S/G2 phases8.
Tumbar et al.9 have since used this approach to observe the
unfolding and remodelling of a large heterochromatic chromosome amplified region containing repetitive DNA sequences that
represented the target of the herpes simplex virus acidic activation
domain VP16. VP16 targeting resulted in a decondensation of the
heterochromatic homogeneously staining region and to induce a
strong increase in histone acetylation at the targeted chromosome
site. In addition, hyperacetylation at H2A (Lys 5) and H4 was also
observed at this site. However, this locus did not directly encode a
protein that could be visualized in living cells, so only the result of
activator binding was observed rather than the transcription of a
specific locus. Here we have extended these studies by developing a
system in which direct gene readout can be visualized in living cells.
An important question with regard to the positioning of chromatin within the interphase nucleus is whether a particular locus
occupies a fixed interphase position. Using specific probes against
centromere-associated α-satellite DNA sequences, chromosomal
subdomains were found to exhibit changes in their intranuclear
localization during the cell cycle21–24. For example, in G1 cells,
chromosome-8 centromeres localize adjacent to the nuclear
periphery, whereas in G2 cells they localize to more internal
nuclear regions23. In a study using the lac operator/repressor system, a 90-million-base-pair region of late-replicating DNA was
found to move from a peripheral nuclear region into the nuclear
interior 4–6 h into S phase8. Dynamic aspects of chromatin have
also been studied by fluorescence recovery after photobleaching25,
and it was concluded that interphase chromatin is immobile over
distances of 0.4 µm or more25.
A second approach involved tagging specific chromosome sites
in living cells of the yeast Saccharomyces cerevisiae with GFP and in
Drosophila with fluorescently labelled topoisomerase II26. It was
found that chromatin undergoes significant diffusive brownian
motion within a restricted area with a radius of less than 0.3 µm in
yeast and 0.9 µm in Drosophila. The observed differences between
these reports may be due to differences in the sensitivities of the
respective techniques or the cell systems used. However, these studies indicate that chromatin does not appear to undergo any longrange movements over short time periods within the interphase
nucleus. The present study, in which we examined a stably integrated and transcriptionally active genetic locus, indicates that in
some cases there is chromatin movement when genes are activated
within the interphase nucleus of mammalian cells. Consistent with
this possibility, changes in centromere and chromosome distribution have been observed over longer time periods or after alterations in physiological conditions, for example in response to cell
differentiation27, transcription signals28, cell-cycle stage23,29–31, or
pathological state32.
We have found an association between the integrated genetic
locus and PML bodies. This association is independent of the transcriptional activity of the locus and seems to be mediated through
the transiently expressed proteins that associate with the integrated
locus. These data lead us to propose that the PML body may act as
a ‘sensor’ with the ability to detect and mark local accumulations of
proteins or nucleic acids that are foreign or ‘suspect’ to the cell. In
previous studies, interferon has been shown to cause an increase in
the number and size of PML bodies by upregulating the PMLbody-associated proteins Sp100 and PML33–36 through activation of
an interferon response element. Based on this finding, it was suggested that these proteins, and the PML body itself, are part of an
inducible intracellular defence mechanism37. In support of this
view, the genomes of several viruses (simian virus 40, adenovirus 5
NATURE CELL BIOLOGY VOL 2 DECEMBER 2000 http://cellbio.nature.com
and herpes simplex virus type 1) were shown to localize to PML
bodies when cells were infected. In addition, several transiently
expressed proteins (such as ISG20 and BRCA1) have also been
shown to localize adjacent to PML bodies after an excess of the protein is expressed38,39.
In summary, we have developed a cell system in which gene
expression can be visualized directly in living cells and the dynamics of various nuclear proteins and structures can be studied in relation to the site of gene expression. Using this system, we have found
that gene expression induces dynamic changes in chromatin structure and that the PML body may act as a nuclear sensor that can
detect local concentrations of exogeneously introduced foreign
proteins. In particular, this system will be useful for studying the
spatial and temporal dynamics of nuclear proteins involved in such
processes as transcription, RNA processing and DNA repair.
Methods
Plasmid construction.
The plasmids pTK-Hyg, pTet-On and pEYFP-C1 were purchased from Clontech (Palo Alto); pQE30
was obtained from Qiagen; and pCFP-C1 was obtained by inserting the NheI/ScaI fragment of pCFP-C3
in the NheI/blunted BspEI sites of pEYFP-C1. p3′SS–EGFP dimer lac repressor and pSV2DHFR8.32
were described previously7,9. EV-124 encoding the tetracycline-responsive transcriptional activator (TetOff) and pUHD10-4B were obtained from M. Wilkinson and J. Skowronski, respectively. pUHD10-4B is
composed of a XhoI-tet responsive element (TRE)–SacI–KpnI–CMV minimal promoter–SacII–
XbaI–Nef cDNA–BamHI–rabbit β-globin intron–HindIII. p3216PCβ consists of 32 units of lac operator, 16 units of TRE, the CMV minimal promoter (P), CFP with peroxisome-targeting signal (C) and
rabbit β-globin gene intron (β), and was constructed as follows. The TRE fragment (blunted SacI/XhoI)
of pUHD10-4B was subcloned in blunted SalI/XhoI sites of pBluescriptIIKS (-). TRE was amplified to
TRE16 by four-cycle amplification using XhoI, SalI and EcoRI according to ref. 7. The CMV minimal
promoter was excised from pUHD10-4B with blunted KpnI/SacII sites and inserted downstream (blunted SalI/SacII) of TRE16. Nef cDNA was removed from pUHD10-4B by XbaI/BamHI digestion followed
by blunting and self-ligation. The original TRE and CMV minimal promoter were replaced with TRE16
with a CMV promoter constructed in pBluescriptIIKS(-) using XhoI/SacII sites resulting in p16Pβ. The
peroxisome targeting signal-1 was fused to the C terminus of CFP by subcloning the HaeIII/KpnI fragment encoding 25 amino acid residues of rat acetyl-CoA oxidase C terminus in blunted EcoRI/KpnI
sites of pCFP–C1. CFP–SKL cDNA was then excised with NheI/blunted KpnI site and subcloned into
the XbaI/blunted SpeI site of pBluescriptII KS (-). CFP–SKL cDNA was then introduced between the
SacII and BamHI sites of p16Pβ, resulting in p16PCβ. The BamHI site was removed by digestion, bluntended and self-ligated. The XhoI site was then converted to a BamHI site using the oligonucleotide linker TCGAGGATCC, resulting in p16PCβ(B-/+). p16PCβ(B-/+) was digested with BamHI and partly
filled-in in the presence of dGTP and dATP with Klenow DNA polymerase. A fragment of 32 copies of
lac operator sequence was excised with XhoI/SalI from pSV2-DHFR-8.32 and partly filled-in in the
presence of dCTP, and TTP and was inserted in the digested p16PCβ(B-/+), resulting in p3216PCβ. The
HindIII site of pSV2neo was converted to a NheI site by blunt-ending and self-ligation. pSV2-EYFP-C1
was made by replacing the CMV promoter (blunted AseI/NheI) of pEYFP-C1 with the SV2 promoter
(PvuII/NheI) from pSV2neo with a NheI site. pSV2-EYFP/lac repressor was made by inserting the lac
repressor fragment (blunted PstI/BamHI) of p3′SS–EGFP dimer lac repressor between blunt-ended
EcoRI and BglII sites of the pSV2-EYFP-C1 vector. pQE-EGFP/lac repressor was made by trimolecular
ligation of pQE30 (digested with SalI/PstI), EGFP (SalI/BamHI fragment from p3′SS–EGFP dimer lac
repressor) and lac repressor (BamHI/PstI fragment from p3′SS–EGFP dimer lac repressor).
Cell culture and isolation of p3216PCβ stably integrated clones.
BHK cells were cultured in DMEM supplemented with 10% FBS (Tet System Approved, Clontech) and
25 mM HEPES/NaOH, pH 7.3 and 10% CO2. Cells were grown in 10-cm Petri dishes and transfected
with 18 µg p3216PCβ and 2 µg pTK-Hyg or pSV2hyg by a modified calcium phosphate co-precipitation method40. Stable transformant clones were selected with 200 µg ml–1 hygromycin B for 10 days.
Then 71 isolated clones were further transfected with EV-124. Cells were fixed 24 h after removing calcium phosphate precipitates from the medium, and the expression of CFP–SKL was examined by fluorescence microscopy. Five clones exhibited inducible expression of the integrated CFP–SKL reporter
plasmid, and three of the five (clones 2, 22 and 102) showed good growth. Clones 2 and 22 were
derived from transfection with pTK-Hyg and clone 102 was derived from pSV2hyg. These clones were
cultured in DMEM containing 150 µg ml–1 hygromycin B (Sigma).
Immunoblotting and Southern blotting
Immunoblot analysis was performed as previously described41. Genomic DNA was extracted from the
cells according to ref. 42 and digested with PstI. After agarose gel electrophoresis, DNA was transferred
onto a Biodyne A membrane (Life Technologies, Rockville, MD). An oligonucleotide (CACATGTGGAATTGTGAGCGGATAACAATTTGTG, corresponding to lac operator sequence) labelled with biotin
at both the 3’ and 5’ ends was used as a probe. Washing was done with 1x SSC at 37 °C. Detection was
done with the PHOTOGENE Nucleic Acid Detection System ver. 2 (Life Technologies).
Electroporation and activation of transcription.
Cells were detached from the Petri dish with PBS containing 1 mM EDTA, centrifuged and resuspended in complete medium. pTet-On (20 µg) and pSV2-EYFP/lac represor (2 µg) were added into a 200-µl
cell suspension in a 4-mm gap cuvette and electroporated using a gene pulser (Bio Rad) at 200 V,
950 µF. Electroporated cells were transferred into 2 ml of medium, centrifuged, resuspended and plat-
877
articles
ed onto a coverslip coated with mouse type IV collagen (Life Technologies). Hygromycin B was not
added after electroporation. For fixed-cell observation, doxycycline was added at a final concentration
of 1 µg ml–1 2 h after inoculation. For living-cell observations, 50 µg pTet-On was used and the coverslip was set into the Focht Live-cell Chamber System 2 (Bioptechs Inc., Butler, PA.) 1.5 h after electroporation and the chamber was placed on the microscope stage. Phenol red-free L15 medium (Life
Technologies) supplemented with 10% FBS was used for cell culture in the chamber. At 2 h a fluorescence image was taken and medium containing 1 µg ml–1 doxycycline was perfused into the chamber.
Medium was changed every 3 h.
Immunofluorescence and RNA fluorescence in situ hybridization.
Cells were rinsed once with PBS and fixed with 4% formaldehyde in PBS for 1 h at room temperature.
After washing 3 times with PBS, cells were treated with 0.1% Triton X-100 in PBS for 15 min at room
temperature. To detect the PML body, monoclonal antibody 5E10 and Texas-red conjugated antimouse IgG (Jackson Labs, Bar Harbor) were used. For RNA detection, a 1.2-kb BamHI/HindIII fragment corresponding to the rabbit β-globin intron of p3216PCβ was labelled with 16-biotin dUTP by
nick translation and detection was accomplished using Texas Red-avidin (Vector Labs, Burlingame).
Hybridization was performed according to ref. 43. Cells were mounted in 90% glycerol/10% PBS containing 25 mg ml–1 1,4-diazabicyclo-[2.2.2] octane (DABCO).
Overlay staining of lac operator sequence with recombinant EGFP/lac
repressor.
Escherichia coli JM109 was transformed with pQE-EGFP/lac repressor and cultured with 2X YT medium containing 2% glucose to suppress the expression of recombinant protein. Histidine-tagged
EGFP/lac repressor was produced by removing glucose at 25 °C overnight without the addition of
IPTG. Protein purification was performed according to the manufacturer’s instructions (Qiagen) using
PBS containing 10% glycerol, 0.5 M NaCl and 0.1 mM DTT to avoid aggregation of the recombinant
protein. After elution with imidazole (400 mM), recombinant protein was precipitated with 33%
ammonium sulphate and resuspended in 0.1 M Tris-HCl, pH 7.5, containing 33% glycerol.
To localize lac operator sequences, cells were rinsed once with PBS and fixed with cold 4%
formaldehyde in PBS at 4 °C for 2 min. This brief fixation is needed to maintain peroxisome structure.
Cells were washed twice with PBS containing 20 mM glycine at room temperature, incubated with
0.1% saponin in PBS at 4 °C for 5 min, then rinsed twice with PBS at room temperature for 1 min
each. Cells were fixed with 4% formaldehyde in PBS at room temperature for 1 h. After the second fixation, cells were washed three times with PBS and blocked with 10% (w/v) skimmed milk in PBS for
2 h. Cells were then incubated with 8 µg ml–1 recombinant EGFP/lac repressor in PBS containing 5%
(w/v) skimmed milk, 5 mM MgCl2, 0.1 mM EDTA for 30 min. After washing three times with PBS
containing 5 mM MgCl2 and 0.1 mM EDTA, cells were mounted with 90% glycerol/10% PBS containing 25 mg ml–1 DABCO.
Microscopic observation and image processing.
Live and fixed cells were observed using an Olympus IX-70 inverted fluorescence microscope equipped
with a Hamamatsu C4742-95-12NR ORCA camera. Filters for Texas Red (exciter HQ560/55, emitter
HQ645/75, beam-splitter Q595LP), YFP (HQ520/20X, HQ520LP, Q515LP; for double labelling with
CFP), YFP (HQ520/20X, HQ560/40m, Q515LP; for double labelling with Texas Red), GFP (HQ470/40,
HQ525/50, Q495LP), and CFP (D436/10, D470/30, 460DCLP) were obtained from Chroma
Technology Corp., Brattleboro. For double labelling with GFP and CFP, the YFP filter was used instead
of that for GFP to minimize spectral overlap. For living-cell observations, a 1.25% ND filter for YFP
excitation and a 6% ND filter for CFP excitation were used. Exposure time for image acquisition was
0.5 s. To adjust the focus of the YFP image, a 0.36% ND filter was used and exposure time was less
than 5 s at each data acquisition point. The CCD camera was controlled by OpenLab software
(Improvision, Boston), and acquired images were processed using Adobe PhotoShop software.
RECEIVED 28 JUNE; REVISED 22 AUGUST; ACCEPTED 22 AUGUST;
PUBLISHED 10 NOVEMBER 2000
1. Spector, D. L. Macromolecular domains within the cell nucleus. Annu. Rev. Cell Biol. 9, 265–315
(1993).
2. Lamond, A. I. & Earnshaw, W. C. Structure and function in the nucleus. Science 280, 547–553 (1998).
3. Misteli, T. & Spector, D. L. Applications of the green fluorescent protein in cell biology and biotechnology. Nature Biotechnol. 15, 961–964 (1997).
4. Tsien, R. Y. The green fluorescent protein. Annu. Rev. Biochem. 67, 509–544 (1998).
5. Ellenberg, J., Lippincott-Schwartz, J. & Presley, J. F. Dual-colour imaging with GFP variants. Trends
Cell. Biol. 9, 52–56 (1999).
6. Belmont, A. S. & Straight, A.F. In vivo visualization of chromosomes using lac operator–repressor
binding. Trends Cell. Biol. 8, 121–124 (1998).
7. Robinett, C. C. et al. In vivo localization of DNA sequences and visualization of large-scale chromatin organization using lac operator/repressor recognition. J. Cell Biol. 135, 1685–1700 (1996).
8. Li, G., Sudlow, G. & Belmont, A. S. Interphase cell cycle dynamics of a late-replicating, heterochromatic homogeneously staining region: precise choreography of condensation/decondensation and
nuclear positioning. J. Cell Biol. 140, 975–989 (1998).
9. Tumbar, T., Sudlow, G. & Belmont, A. S. Large-scale chromatin unfolding and remodeling induced
by VP16 acidic activation domain. J. Cell Biol. 145, 1341–1354 (1999).
10. Straight, A. F., Belmont, A. S., Robinett, C. C. & Murray, A. W. GFP tagging of budding yeast chromosomes reveals that protein-protein interactions can mediate sister chromatid cohesion. Curr.
Biol. 6, 1599–1608 (1996).
11. Minshull, J. et al. Protein phosphatase 2A regulates MPF activity and sister chromatid cohesion in
budding yeast. Curr. Biol. 6, 1609–1620 (1996).
878
12. Miyazawa, S. et al. Peroxisome targeting signal of rat liver acyl-coenzyme A oxidase resides at the
carboxy terminus. Mol. Cell. Biol. 9, 83–91 (1989).
13. Miller, J. H. & Reznikoff, W. A. The Operon, 17–220 (Cold Spring Harbor Laboratory Press, New
York, 1980).
14. Maul, G. G., Negorev, D., Bell, P. & Ishov, A. M. Properties and assembly mechanisms of ND10,
PML bodies, or PODs. J. Struct. Biol. 129, 278–287 (2000).
15. Zhong, S., Salomoni, P. & Pandolfi, P. P. The transcriptional role of PML and the nuclear body.
Nature Cell Biol. 2, E85–E90 (2000).
16. Weintraub, H. & Groudine, M. Chromosomal subunits in active genes have an altered conformation. Science 193, 848–856 (1976).
17. Paranjape, S. M., Kamakaka, R. T. & Kadonaga, J. T. Role of chromatin structure in the regulation
of transcription by RNA polymerase II. Annu. Rev. Biochem. 63, 265–297 (1994).
18. Armstrong, J. A. & Emerson, B. M. Transcription of chromatin: these are complex times. Curr.
Opin. Genet. Dev. 8, 165–172 (1998).
19. Kuo, M. H. & Allis, C. D. Roles of histone acetyltransferases and deacetylases in gene regulation.
Bioessays 20, 615–626 (1998).
20. Pederson, T. Chromatin structure and gene transcription: nucleosomes permit a new synthesis. Int.
Rev. Cytol. 55, 1–21 (1978).
21. Manuelidis, L. Different central nervous system cell types display distinct and nonrandom arrangements of satellite DNA sequences. Proc. Natl Acad. Sci. USA 81, 3123–3127 (1984).
22. Manuelidis, L. & Borden, J. Reproducible compartmentalization of individual chromosome
domains in human CNS cells revealed by in situ hybridization and three-dimensional reconstruction. Chromosoma 96, 397–410 (1988).
23. Ferguson, M. & Ward, D. C. Cell cycle dependent chromosomal movement in pre-mitotic human
T-lymphocyte nuclei. Chromosoma 101, 557–565 (1992).
24. Dietzel, S. et al. Three-dimensional distribution of centromeric or paracentromeric heterochromatin of chromosomes 1, 7, 15, and 17 in human lymphocyte nuclei studied with light microscopic
axial tomography. Bioimaging 3, 121–133 (1995).
25. Abney, J. R., Cutler, B., Fillbach, M. L., Axelrod, D. & Scalettar, B. A. Chromatin dynamics in interphase nuclei and its implications for nuclear structure. J. Cell Biol. 137, 1459–1468 (1997).
26. Marshall, W. F. et al. Interphase chromosomes undergo constrained diffusional motion in living
cells. Curr. Biol. 7, 930–939 (1997).
27. Manuelidis, L. Individual interphase chromosome domains revealed by in-situ hybridization. Hum.
Genet. 71, 288–293 (1985).
28. Janevski, J., Park, P. C. & De Boni, U. Organization of centromeric domains in hepatocyte nuclei:
rearrangement associated with de novo activation of the vitellogenin gene family in Xenopus laevis.
Exp. Cell Res. 217, 227–239 (1995).
29. Bartholdi, M. F. Nuclear distribution of centromeres during the cell cycle of human diploid fibroblasts. J. Cell Sci. 99, 255–263 (1991).
30. Funabiki, H., Hagan, I., Uzawa, S. & Yanagida, M. Cell cycle-dependent specific positioning and
clustering of centromeres and telomeres in fission yeast. J. Cell Biol. 121, 961–976 (1993).
31. LaSalle, J. M. & Lalande, M. Homologous association of oppositely imprinted chromosomal
domains. Science 272, 725–728 (1996).
32. Borden, J. & Manuelidis, L. Movement of the X chromosome in epilepsy. Science 242, 1687–1691 (1988).
33. Guldner, H. H., Szostecki, C., Grotzinger, T. & Will, H. IFN enhance expression of Sp100, an
autoantigen in primary biliary cirrhosis. J. Immunol. 149, 4067–4073 (1992).
34. Koken, M. H. et al. The t(15;17) translocation alters a nuclear body in a retinoic acid-reversible
fashion. EMBO J. 13, 1073–1083 (1994).
35. Korioth, F., Gieffers, C., Maul, G. G. & Frey, J. Molecular characterization of NDP52, a novel protein of the nuclear domain 10, which is redistributed upon virus infection and interferon treatment. J. Cell Biol. 130, 1–13 (1995).
36. Maul, G. G., Yu, E., Ishov, A. M. & Epstein, A. L. Nuclear domain 10 (ND10) associated proteins are
also present in nuclear bodies and redistribute to hundreds of nuclear sites after stress. J. Cell.
Biochem. 59, 498–513 (1995).
37. Ishov, A. M. & Maul, G. G. The periphery of nuclear domain 10 (ND10) as site of DNA virus deposition. J. Cell Biol. 134, 815–826 (1996).
38. Maul, G. G., Jensen, D. E., Ishov, A. M., Herlyn, M. & Rauscher, F. J. III Nuclear redistribution of
BRCA1 during viral infection. Cell Growth Differ. 9, 743–755 (1998).
39. Gongora, C. et al. Molecular cloning of a new interferon-induced PML nuclear body-associated
protein. J. Biol. Chem. 272, 19457–19463 (1997).
40. Chen, C. & Okayama, H. High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol. 7, 2745–2752 (1987).
41. Mintz, P. J., Patterson, S. D., Neuwald, A. F., Spahr, C. S. & Spector, D. L. Purification and biochemical characterization of interchromatin granule clusters. EMBO J. 18, 4308–4320 (1999).
42. Sambrook, J., Fritsch, E. F. & Maniatis, T. Molecular Cloning (Cold Spring Harbor Laboratory Press,
New York, 1989).
43. Spector, D. L., Goldman, R. D. & Leinwand, L. A. Cells: A Laboratory Manual (Cold Spring Harbor
Laboratory Press, New York, 1998).
ACKNOWLEDGEMENTS
We thank T. Misteli for discussions and P. Sacco-Bubulya and N. Saitoh for reviewing the manuscript.
pW7-C3 (=pCFP-C3), which encoded CFP, was provided by R. Tsien, EV-124 was provided by M.
Wilkinson and pUHD10-4B was provided by J. Skowronski, and monoclonal antibody 5E10 was
obtained from R. van Driel. S.M.J. is supported by an NIH/NCI training grant 5T32CA09311. D.L.S. is
funded by a grant from NIGMS (NIH 498100).
Correspondence and requests for materials should be addressed to D.L.S. Supplementary Information
is available on Nature Cell Biology’s World-Wide Web site (http://cellbio.nature.com) or as paper copy
from the London editorial office of Nature Cell Biology.
NATURE CELL BIOLOGY VOL 2 DECEMBER 2000 http://cellbio.nature.com