THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 28, pp. 20667–20675, July 13, 2007
© 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
Structure of an Atypical Orphan Response Regulator Protein
Supports a New Phosphorylation-independent
Regulatory Mechanism*
Received for publication, September 26, 2006, and in revised form, April 17, 2007 Published, JBC Papers in Press, May 9, 2007, DOI 10.1074/jbc.M609104200
Eunmi Hong‡§, Hyang Mi Lee¶, Hyunsook Ko储, Dong-Uk Kim¶, Byoung-Young Jeon‡, Jinwon Jung‡, Joon Shin‡§,
Sung-Ah Lee储, Yangmee Kim储1, Young Ho Jeon**, Chaejoon Cheong**, Hyun-Soo Cho§¶2, and Weontae Lee‡§3
From the ‡Department of Biochemistry and HTSD-NMR & Application NRL, Yonsei University, Seoul 120-749, the ¶Department of
Biology and §Protein Network Research Center, Yonsei University, the 储Department of Bioscience and Biotechnology and Brain
Korea 21, Division of Bioscience and Biotechnology, Konkuk University, Seoul 143-701, and the **Magnetic Resonance Team,
Korea Basic Science Institute (KBSI), Ochang, Chungbuk 363-883, Korea
* This work was supported in part by the Korea Science and Engineering
Foundation (KOSEF) through the National Research Laboratory Program funded by the Ministry of Science and Technology (M1-0203-000020) and the Protein Network Research Center at Yonsei University
(R112000078010010) and in part by the Brain Korea 21(BK21) program, the
Basic Science Research Program (to C. C.) from the Ministry of Science and
Technology of the Republic of Korea and the NMR Research Program (to
Y. H. J.) from the Korea Basic Science Institute, and Korea Research Foundation Grants KRF-2004-005-C00112 and R08-2004-000-10403-02-004
funded by the Korean Government (to H. C.). The costs of publication of
this article were defrayed in part by the payment of page charges. This
article must therefore be hereby marked “advertisement” in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
The atomic coordinates and structure factors (code 2HQN, 2HQO, 2HQR, and
2PLN) have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, NJ
(http://www.rcsb.org/).
1
Supported by Molecular and Cellular BioDiscovery Research Program
Grant M10301030001-05N0103-00110 from the Ministry of Science and
Technology.
2
To whom correspondence may be addressed. E-mail: [email protected].
3
To whom correspondence may be addressed: Dept. of Biochemistry, College of Science, Yonsei University, 134 Shinchon-Dong, Seodaemoon-Gu,
Seoul 120-749, Korea. Tel.: 82-2-2123-2706; Fax: 82-2-363-2706; E-mail:
[email protected].
JULY 13, 2007 • VOLUME 282 • NUMBER 28
Two-component systems are the predominant signal transduction systems used by prokaryotes and are frequently
involved in the regulation of cellular functions in response to
variable environmental conditions. These systems exhibit a
phosphorelay process from a sensor histidine kinase to an intracellular response regulator protein (RR),4 which typically acts
as a transcription regulator (1). The environmental stimulus
triggers the autophosphorylation of the transmitter domain of
histidine kinase and then the phosphate group is transferred to
an aspartate residue in the N-terminal regulatory domain of RR.
Phosphorylation induces a conformational change resulting in
dimerization of RR and binding to the promoter of target genes.
RRs consist of a conserved N-terminal regulatory domain and a
variable C-terminal transactivation domain. The transactivation domains can be divided into three major subfamilies based
on the homology of their DNA-binding region: the OmpR/
PhoB winged-helix domain (2– 4), the NarL/FixJ four-helix
domain (5, 6), and the NtrC ATPase-coupled transcription factors (7). Other response regulator proteins, which are classified
as a fourth subfamily, contain different effector domains, such
as enzymes.
In most RRs, phosphorylation induces conformational
changes in a conserved region including the ␤4-␣4 loop and the
␣4 helix. In CheY, the phosphate provides hydrogen bonds to
the Thr87 O-␥ and the Ala88 amide nitrogen, which then provide space for Tyr106 to access the interior, resulting in a stabilizing hydrogen bond between the Tyr106 hydroxyl and the
Glu89 carbonyl oxygen in the loop. This conformational change
drives the conformational change of the ␣4-␤5-␣5 face of the
regulatory domain that in turn promotes dimerization. A conserved tyrosine (corresponding to Tyr106 of CheY) is the key
residue indicating the status of an RR: the inward position, in
which the hydroxyl group points toward the N terminus of helix
␣4, is found in the active state, whereas the outward position is
found in the inactive state. It is well known that dimerization
allows or increases DNA binding to the promoter recognition
element (8).
Recent analysis of the H. pylori genome sequence revealed
the presence of four two-component systems and two orphan
4
The abbreviations used are: RR, response regulator; HP, Helicobacter pylori;
NOE, nuclear Overhauser effect.
JOURNAL OF BIOLOGICAL CHEMISTRY
20667
Downloaded from www.jbc.org at YONSEI UNIVERSITY on December 6, 2007
Two-component signal transduction systems, commonly found
in prokaryotes, typically regulate cellular functions in response to
environmental conditions through a phosphorylation-dependent
process. A new type of response regulator, hp1043 (HP-RR) from
Helicobacter pylori, has been recently identified. HP-RR is essential
for cell growth and does not require the well known phosphorelay
scheme. Unphosphorylated HP-RR binds specifically to its own
promoter (P1043) and autoregulates the promoter of the tlpB gene
(PtlpB). We have determined the structure of HP-RR by NMR and
x-ray crystallography, revealing a symmetrical dimer with two
functional domains. The molecular topology resembles that of the
OmpR/PhoB subfamily, however, the symmetrical dimer is stable
even in the unphosphorylated state. The dimer interface, formed
by three secondary structure elements (␣4-␤5-␣5), resembles that
of the active, phosphorylated forms of ArcA and PhoB. Several conserved residues of the HP-RR dimeric interface deviate from the
OmpR/PhoB subfamily, although there are similar salt bridges and
hydrophobic patches within the interface. Our findings reveal how
a new type of response regulator protein could function as a cell
growth-associated regulator in the absence of post-translational
modification.
Structure of a New Response Regulator hp1043
response regulators (9). Based on structural and functional
homologies, one of these pairs (analogues of the CheA-CheY
proteins) may play a role in regulating random tumbling
motions and flagellar rotation in response to signals from chemotaxis receptors (10, 11). The other three pairs of histidine
kinase and RR proteins (HP0165-HP0166, HP1364-HP1365,
and HP0244-HP0703) and two RR proteins (HP1043 and
TABLE 1
Structural statistics of HP-RR
NMR
HP-RRr
HP-RRe
3299
778
932
717
872
52
93
2622
673
622
491
782
54
56
1817
458
433
416
510
Mean root mean square deviations
from the average coordinateb
Backbone atoms (N,C␣,C⬘,O)
Heavy atoms
1.199
1.838
Ramachandran plot (%)
Most favored regions
Additional allowed regions
Generously allowed regions
Disallowed regions
84.2%
12.0%
2.7%
1.1%
X-ray (HP-RRr)
Space group
Unit cell parameters
Resolution (Å)
Rsym (%)
R-factorc (Rfree) (%)
Root mean square deviation bond
length (Å)
Root mean square deviation bond
angle (°)
38
0.31 ⫾ 0.05 Å 0.24 ⫾ 0.05 Å
0.78 ⫾ 0.06 Å 0.82 ⫾ 0.05 Å
87%
12.9%
0%
0%
80.8%
18%
1.1%
0.1%
P212121
a ⫽ 89.0, b ⫽ 41.3, c ⫽ 36.7,
␣ ⫽ ␤ ⫽ ␥ ⫽ 90°
1.5–1.8
9.4 (39.5)
20.6 (25.5)
0.0052
1.1673
Ramachandran plot (%)
Most favored region
95.2
Additional allowed regions
4.8
Disallowed regions
0
a
Two restraints per one hydrogen bond.
b
Root mean square deviation values for residues 1–115 for HP-RRr and 119 –218 for
HP-RRc.
c
R-factor ⫽ ⌺储Fo兩 ⫺ 兩Fc储/⌺兩Fo兩, where 兩Fo兩 and 兩Fc兩 are the observed and calculated
structure factor amplitudes, respectively. Rfree was calculated with 5% of the data.
5
E. Hong and W. Lee, unpublished results.
FIGURE 1. Binding affinities of HP-RR for different DNA sequences. A, DNA sequences (D1–D8) are displayed together with that of the consensus sequence.
The DNA sequence with a blue box showed higher affinity to HP-RR than its own promoter sequence. B, electrophoretic mobility shift assay experiments were
performed with HP-RR and labeled target DNA. Binding activities were determined by the signal intensity relative to that of the wild-type DNA.
20668 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 282 • NUMBER 28 • JULY 13, 2007
Downloaded from www.jbc.org at YONSEI UNIVERSITY on December 6, 2007
NOE distance restraints
All
Intraresidue
Sequential (兩i⫺j兩 ⫽ 1)
Medium range (2 ⱕ 兩i⫺j兩 ⱕ5 )
Long range (兩i⫺j兩 ⬎ 5)
Intermolecular
Hydrogen bonds distance
restraintsa (No.)
HP-RR
HP1021) are predicted to be involved in transcriptional regulation (12). The hp1043 and hp1021 genes encode orphan RRs,
for which no histidine kinases have been identified (12, 13). The
orphan response regulator HP1043 (HP-RR) has been shown to
be essential for the growth of H. pylori (14).
HP-RR binds to its own promoter and performs an autoregulatory function (13, 15). Interestingly, a recent report revealed
that the regulatory domain (HP-RRr) is not phosphorylated in
vitro and phosphorylation is not necessary for its function, indicating that HP-RR differs from the well known two-component
response regulators. HP-RR has thus been classified as belonging to a new response regulator family (14, 15). According to
structural studies of the ArcA regulatory domain, it is suggested
that the OmpR/PhoB family has a common dimerization mechanism mediated by the ␣4-␤5-␣5 interface with the participation of well conserved residues (16). However, HP-RR has 5
residue substitutions of 11 conserved residues, which could
affect the interactions of the dimer interface. A recent report
showed that PhoB adopts two different dimerization modes:
the inactive ␣1-␣5 interface dimer and the active ␣4-␤5-␣5
interface dimer (17). These reports raise questions about the
structure-function relationships of HP-RR related to dimerization and activation. Previous studies proposed that HP-RR
forms a dimer in vivo (13). We have also reported preliminary
NMR data showing that HP-RR is a symmetric dimer with two
functional domains, an N-terminal regulatory domain (⬃14
kDa) and C-terminal DNA-binding/transactivation domain
(⬃11 kDa) (18). Additionally, ultracentrifugation data also support that HP-RR is a stable dimer in solution.5 In this report, we
present a detailed three-dimensional structure of HP-RR, a new
class of phosphorylation-independent response regulator,
using NMR spectroscopy, x-ray crystallography, and site-directed mutagenesis. The structural information presented here
will promote understanding of the molecular function of this
new type of response regulator.
Structure of a New Response Regulator hp1043
Downloaded from www.jbc.org at YONSEI UNIVERSITY on December 6, 2007
FIGURE 2. Backbone superimposition of the NMR structures and molecular topology of HP-RR. A, both regulatory and DNA-binding domains of the 20
final simulated annealing structures are superimposed. B, stereoview of the ribbon diagram of HP-RR. Monomers are shown in yellow and blue, respectively.
C, the global fold labeled with secondary structures is displayed.
EXPERIMENTAL PROCEDURES
Cloning, Expression, and Purification—Plasmid construction, protein expression, and purification of full-length HP-RR
was performed as described (18). DNA fragments encoding the
N-terminal regulatory domain, HP-RRr (residues 1–119), and
the C-terminal effector domain, HP-RRe (residues 120 –223),
were inserted into pET-21a(⫹) with a C-terminal (His)6 tag and
into pET-21b3-2 (GE Healthcare) with an N-terminal (His)6
tag. These vectors were used to transform the Escherichia coli
strain BL21(DE3) (Invitrogen) for fusion protein expression.
HP-RRr and HP-RRe were overexpressed and purified according to the methods used for full-length HP-RR (18). For x-ray
JULY 13, 2007 • VOLUME 282 • NUMBER 28
crystallography, selenomethionine-substituted HP-RRr was
prepared by transforming E. coli B834(DE3) methionine auxotroph cells (Novagen) with the vector containing HP-RRr and
growing the cells in selenomethionine-containing minimal
medium.
Site-directed Mutagenesis—Mutations were introduced
into both HP-RR and HP-RRe using an overlapping PCR
strategy. Two PCRs were performed using pET21b3-2 as
templates. The PCR products were purified with QIAquick
(Qiagen), mixed together, and used as the templates in the
final stage. All mutant proteins were expressed and purified
as described above.
JOURNAL OF BIOLOGICAL CHEMISTRY
20669
Structure of a New Response Regulator hp1043
20670 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 282 • NUMBER 28 • JULY 13, 2007
Downloaded from www.jbc.org at YONSEI UNIVERSITY on December 6, 2007
TROSY-based triple resonance
pulse sequences (21). Data for HPRRr and HP-RRe were collected by
conventional triple resonance pulse
sequences. Three-dimensional experiments used for sequential assignments included HNCO, HNCACB,
CBCA(CO)NH, HBHA(CO)NH,
C(CCCO)NH, H(CCCO)NH, and
HCCH-TOCSY. For structural
information, 15N-edited and 13Cedited NOESY-HSQC spectra were
used. Dihedral backbone restraints
were derived from 1Ha, 13C␣, 13C␤,
and 13CO chemical shifts using the
program TALOS (22). The hydrogen bond restraints were determined from hydrogen exchange
experiments on amide protons.
Residual dipolar couplings were
measured by taking the difference in
the corresponding J splittings in oriented and isotropic media and 1DNH
dipolar coupling constants were
obtained using a two-dimensional
in-phase or anti-phase 1H-15N
HSQC spectra in a liquid crystalline
medium (23).
NMR Structure Calculation—Initial structure calculations were performed using CYANA 2.0 (24, 25).
The structures were refined with
FIGURE 3. NMR structures of the DNA-binding domain and chemical shift mapping of the residues impor- NIH-XPLOR (version 2.9.7) software
tant for DNA binding. A, stereoview of the backbone traces from the final ensemble of 20 solution structures.
The ␣-helices are displayed in orange and ␤-sheets in blue. B, electrostatic potential surface of the transactiva- (26) by a combination of torsion angle
tion domain is displayed. Red, blue, and white colors represent negative, positive, and neutral electrostatic and Cartesian dynamics. A total of
potential, respectively. The backside view of the molecule rotated by 180° around the vertical axis is also 100 structures were calculated, and 20
shown. Residues important for DNA binding are labeled. C, chemical shift change of the effector domain upon
DNA binding. The chemical shift changes are calculated by using the equation: ⌬␦tot ⫽ ((⌬␦HNWHN)2 ⫹ structures with the lowest target
(⌬␦NWN)2)1/2, where ␦i is the chemical shift of nucleus i, and Wi denotes its weight factor (WHN ⫽ 1, WN ⫽ 0.2). function values were selected for
D, residues that exhibit significant chemical shift perturbation upon DNA binding. Magenta indicates ⌬␦tot ⬎
structural analysis. A summary of
0.2, and yellow indicates 0.1 ⬍ ⌬␦tot ⬍0.2.
NMR-derived restraints and strucElectrophoretic Mobility Shift Assay—A double-stranded tures of HP-RR, HP-RRr, and HP-RRe is given in Table 1. The
PHP1043 oligonucleotide was synthesized with the following final structures with the lowest NOE energies were validated by
sequence: 5⬘-ATTAATATTTTCTTAAACTAATTTAAAAT- the program PROCHECK (27). Solution structures were ana3⬘. DNA was end-labeled with 20 units of T4 polynucleotide lyzed and visualized using the programs VMD-XPLOR (28),
kinase and 250 ␮Ci of [␥-32P]ATP. Labeled DNA was purified PyMOL (29), and MOLMOL (30). The electrostatic surface
with a Qiagen nucleotide removal kit. To measure DNA bind- potential was calculated with the program APBS (31).
Crystallization and Structure Determination—The purificaing, purified HP-RR and HP-RRe were incubated with radiolabeled DNA at room temperature for 30 min in the presence of tion and crystallization of HP-RRr were carried out as described
0.2 ␮g of poly(dI-dC). DNA complexes were separated on a 5% previously (32). Selenomethionine-substituted HP-RRr crystals
native polyacrylamide gel in 1⫻ Tris glycine (10% Tris glycine) were also obtained under the same crystallization conditions
at 140 V for 4 h and visualized by autoradiography.
with the addition of 5 mM dithiothreitol. Before data collection,
NMR Spectroscopy—All NMR experiments were recorded at the crystals were immersed briefly in a cryoprotectant solution,
303 K on a Bruker DRX500 or a DRX600 equipped with an which was the reservoir solution plus 15% ethylene glycol. A
x,y,z-shielded gradient triple resonance probe or a z-shielded three-wavelength MAD data set of the selenomethionine-lagradient triple resonance cryoprobe. NMR spectra were pro- beled crystal based on 200 images (1° rotation) was collected at
cessed with the NMRPipe/nmrDraw software package (19) 0.97940 Å (edge wavelength), 0.97929 Å (peak wavelength), and
and analyzed using SPARKY (20). Backbone resonance data 0.97162 Å (remote wavelength). All data were collected at beam
of HP-RR were collected by using deuterium-decoupled line 6B of the Pohang Accelerator Laboratory (PAL) in Pohang,
Structure of a New Response Regulator hp1043
RESULTS
Characterization of DNA Binding of HP-RR—A recent report
proposed that unphosphorylated HP-RR specifically binds to a
29-mer target DNA containing its own promoter sequence
(13), which is dependent upon the growth phase at the posttranscriptional level. We have determined the promoter DNA
sequences (ATTAATATTTTCTTAAACTAATTTAAAAT)
important in binding to HP-RR based on data from electrophoretic mobility shift assays (Fig. 1, A and B). HP-RR has well
conserved residues in its transactivation domain, just like
OmpR (2), PhoB (4, 39), and the DrrD. As expected, unphosphorylated HP-RR successfully bound to its target DNA
sequences (Fig. 1B). Interestingly, the protein had increased
affinity for binding DNA mutated at the 11th position (D4)
(Fig. 1B).
Structure of HP-RR Dimer—Based on gel filtration chromatography and cross-linking experiments, HP-RR is a symmetric
dimer. A superposition of the final 20 NMR structures over the
energy minimized average structure shows that it consists of 12
␤-strands and 8 ␣-helices in each monomer unit (Fig. 2A). The
molecular topology of the HP-RR resembles that of the OmpR/
PhoB subfamily with a 2-fold symmetry in the absence of phosphorylation. The N-terminal regulatory domain forms a compact dimer and the transactivation domain is connected to the
regulatory domain by a short flexible linker (Fig. 2, B and C). A
total of 51 intermolecular NOEs for the dimer interface are
observed between two subunits (e.g. Thr79(A)/Arg100(B),
JULY 13, 2007 • VOLUME 282 • NUMBER 28
FIGURE 4. X-ray structure and dynamics properties of the dimeric interface of the regulatory domain. A, structural comparison of the superimposed C␣ atoms of HP-RRr (yellow), the active ArcAN (orange, PDB accession
code 1XHF), and the active PhoBN (green, PDB accession code 1ZES). Major
structural deviations occur from a 4-amino acid deletion as shown within the
blue circle. B, both electrostatic and hydrophobic interactions of the dimeric
interface are shown. A network of ionic interactions is formed between Glu83
(␣4), Asp93 (␤5), and Arg108 (␣5). The core interactions of the hydrophobic
patch consisting of Val84 (␣4), Phe87 (␣4), Ala104 (␣5), Ala107 (␣5), and Ala111
(␣5) are also shown between dimeric interface. C, dynamic properties of HPRRr. S2 and Rex values are depicted. Order parameters, S2, are colored onto the
ribbon structure. According to increasing S2, residues are colored from red
(S2 ⬍ 0.70) to yellow (S2 ⬎ 0.90) in a linear fashion. For the residues with Rex ⬎
0.5 s⫺1, ribbon diameter (pink color) is increased in a linear fashion.
Ser80(A)/Ser101(B), Ser80(A)/Ala104(B), Val84(A)/Ala104(B), and
Phe87(A)/Ala111(B)). However, no intermolecular interactions
between transactivation domains have been observed. The
molecular topology of the regulatory domain is an ␣/␤-fold
with a central five-stranded ␤-sheet surrounded by five ␣-helices. The electrostatic surface of HP-RR mainly consists of two
oppositely charged regions, which differs slightly from PhoB.
JOURNAL OF BIOLOGICAL CHEMISTRY
20671
Downloaded from www.jbc.org at YONSEI UNIVERSITY on December 6, 2007
Korea using a Bruker AXS proteum300 CCD detector (Bruker,
Madison, WI). The data were then indexed, integrated, and
scaled using the HKL2000 suite (33). Four selenium sites in the
asymmetric unit were located and used for phase determination at 2.2 Å with the program SOLVE (34). The phases were
subsequently improved by density modification with the program RESOLVE (35). The program O (36) was used for the
electron density model building. The 1.8-Å peak wavelength
anomalous dispersion data were re-averaged and used for the
refinement of the model with the CNS program package (37).
Statistics for crystallographic data are summarized in Table 1.
Backbone Dynamics—NMR spin-relaxation experiments
were performed using the published gradient-selected sensitivity enhanced pulse sequences (38). The longitudinal (R1) spin
relaxation rates of the regulatory domain were measured with
relaxation delays of 0.002 (⫻2), 0.15, 0.3 (⫻2), 0.6, 0.78, 1.0, and
1.2 s. The transverse (R2) relaxation rates of the regulatory
domain were obtained with total relaxation delays of 0.0 (⫻2),
0.015824, 0.031648, 0.047472 (⫻2), 0.063296, 0.07912, and
0.094944 s. The longitudinal (R1) spin relaxation rates of the
effector domain were measured with relaxation delays of 0.002
(⫻2), 0.065, 0.145, 0.246, 0.366 (⫻2), 0.527, and 0.759 s. The
transverse (R2) relaxation rates of the effector domain were
obtained with total relaxation delays of 0.0 (⫻2), 0.017248,
0.034496, 0.051744 (⫻2), 0.068992, 0.08624, and 0.103488 s.
The heteronuclear cross-relaxation rate (NOE) was obtained by
interleaving pulse sequences with and without proton saturation. A recycle delay of 2.5 s was used in all (R1, R2) relaxation
experiments. NMR data were processed with NMRPipe (19)
and visualized with SPARKY (20).
Structure of a New Response Regulator hp1043
Downloaded from www.jbc.org at YONSEI UNIVERSITY on December 6, 2007
20672 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 282 • NUMBER 28 • JULY 13, 2007
Structure of a New Response Regulator hp1043
the side chain of Arg108 with the carbonyl oxygen of Tyr94. In
addition, the hydrophobic interactions among residues Val84,
Phe87, Ala104, Ala107, and Ala111 serve as a major stabilizing
force for the HP-RR dimer (Fig. 4B). Therefore, it is conceivable
that the ionic interactions could serve as a driving force for the
initial dimerization process of HP-RR, whereas the hydrophobic interactions contribute to dimer stability.
Protein Dynamics of HP-RR—NMR relaxation data were analyzed within the model-free formalism of protein dynamics and
indicate an extensive reduction in backbone motion for the
residues in the interface region. These effects are reflected by an
increase in the generalized order parameter, S2, of the residues
in the interface region. These results imply that the dynamics of
the dimer illuminates the relative contributions of charged and
hydrophobic interactions between these residues. Hydrophobic interactions between the residues in the interface region,
such as Val84, Phe87, Ala104, and Ala107 resulted in high order
parameters for these residues (Val84, S2 ⫽ 0.84; Phe87, S2 ⫽
0.92; Ala104, S2 ⫽ 1; Ala107, S2 ⫽ 0.99; Ala111, S2 ⫽ 0.99) (Fig.
4C). Also, interactions between the charged residues such as
Glu83/Arg108 and Asp92/Arg112 resulted in high order parameters for these residues (Glu83, S2 ⫽ 0.94; Asp92, S2 ⫽ 0.94;
Arg108, S2 ⫽ 0.98; Arg112, S2 ⫽ 0.96). The R2/R1 ratio is 1.54 ⫾
0.498 for the regulatory domain, and 5.34 ⫾ 0.527 for the transactivation domain, indicating that the regulatory domain forms
a rigid dimer, whereas the transactivation domain acts as a
monomer. The S2 from backbone data of the transactivation
domain averages 0.8882 ⫾ 0.013 for all residues (data not
shown). The NH exchange rates of the residues in the solvent
exposed loops are higher than that of those in regions of secondary structure. However, Ile95, Ala96, and Val86 show relatively high exchange rates indicating that the dimeric interface
is mainly comprised of side chain-side chain interactions. In
addition, the relaxation rates are relatively uniform across the
whole transactivation domain except some residues.
Site-directed Mutagenesis Supports Structural Data of
HP-RR—Based on structural and sequence information, mutational analysis for both the regulatory and transactivation
domains was performed (Fig. 5A). Seventeen mutant proteins
were prepared to study both structural stability and DNA binding, although only 10 mutants are correctly folded and purified.
Because phenylalanine 87 in the dimeric interface is a leucine or
alanine residue in all other response regulator proteins, we constructed F87L and F87A mutants to examine a correlation
between sequences. The F87L mutant exists as a monomer by
FIGURE 5. A summary of site-directed mutagenesis data and a DNA binding model of the HP-RR. A, locations of point mutations in both the regulatory
domain and the effector domain are shown. The view on the left is rotated by 180° with respect to the view on the right. B, DNA binding activities determined
by the electrophoretic mobility shift assay and the solubility of each mutant protein are summarized. DNA was end-labeled with 20 units of T4 polynucleotide
kinase and 250 ␮Ci of [␥-32P]ATP. To measure DNA binding, purified HP-RR and HP-RRe were incubated with radiolabeled DNA at room temperature for 30 min
in the presence of 0.2 ␮g of poly(dI-dC). DNA complexes were separated on a 5% native polyacrylamide gel (10% Tris glycine) in 1⫻ Tris glycine at 140 V for 4 h
and visualized by autoradiography. DNA binding was determined by the signal intensity relative to the wild-type protein (⫹⫹⫹). Symbols indicate the relative
binding affinity: ⫹⫹⫹⫹, higher binding than wild type; ⫹⫹, 30 – 80% of wild type; ⫹, 10 –30% of wild type; ⫺, ⱕ5% of wild type. C, sequence alignment of
HP-RR, ArcA, OmpR, PhoB, DrrD, DrrB, and PhoP was performed using T-Coffee and the figure was rendered using ESPript. Residues relating the dimer interface
are highly conserved in this subfamily. However, the HP-RR sequences shows differences in the dimer interface, and pink highlights represent residues that are
not conserved. Residues involved in formation of the hydrophobic patch and the intermolecular salt bridges are colored with blue and yellow, respectively, and
conserved residues are displayed in bold. Residue numbers for HP-RR are shown every 10 residues by black small-sized letters. Identified secondary structural
elements of HP-RR are shown above in blue and pink for the regulatory domain and the effector domain, respectively. The mutated positions for the full-length
domain and the effector domain are indicated by a black filled circle and a black filled triangle, respectively. In the OmpR/PhoB subfamily sequences, the
phosphorylated residue Asp is shown as a black filled star. D, structural model of HP-RR protein-DNA complex based on structural data. The DNA structure is
assumed to be the normal B form. HP-RR forms a symmetric dimer in a head-to-head orientation with DNA due to a short flexible linker.
JULY 13, 2007 • VOLUME 282 • NUMBER 28
JOURNAL OF BIOLOGICAL CHEMISTRY
20673
Downloaded from www.jbc.org at YONSEI UNIVERSITY on December 6, 2007
An ensemble of the 20 lowest energy NMR structures of the
transactivation domain is displayed in Fig. 3A. The transactivation domain (HP-RRe) consists of an N-terminal four-stranded
anti-parallel ␤ sheet (strands ␤6-␤9) and a helix bundle with
three ␣-helices (␣6, ␣7, and ␣8). The ␤-hairpin between ␣6 and
␣7 enables close interactions with ␤10. The two helices comprised of ␣7 and ␣8 form a helix-turn-helix DNA binding motif.
The recognition helix (␣8) is also very well defined. The electrostatic surface showed that the transactivation domain consists
of two distinct regions with opposite charge distribution (Fig.
3B). The loop between ␣7 and ␣8, referred to as a transcription
loop for both transcription activation and interaction with the
␴80 subunit of the RNA polymerase, is identified. Similar to
PhoB/OmpR family proteins, the DNA-binding domain is also
stabilized by a conserved hydrophobic core. Comparing the
structure of HP-RR with OmpR and PhoB, the root mean
square deviations of the C␣ atoms of the secondary structural
regions are 3.638 Å (OmpR) and 2.146 Å (PhoB, data not
shown). Most of the differences originate from the transactivation and winged loop regions (Fig. 3B). To map the DNA-binding site and residues critical for DNA binding, chemical shift
perturbations were measured by NMR titration with its consensus DNA. The most significant chemical shift changes were
observed for the residues of ␣8, a recognition helix as shown in
Fig. 3, C and D.
Dimeric Interface of HP-RR—The crystal structure clearly
shows that the 2-fold symmetric dimeric interface is stabilized
by the ␣4-␤5-␣5 interface that buries 1610 Å2 of surface area
(800 Å2 per monomer) (Fig. 4A). The dimeric interface of the
HP-RR regulatory domain is similar to that of the active, phosphorylated protein of ArcA (16) and PhoB (17); however, the
electrostatic interactions and the hydrophobic patch are different from that of active PhoB, which is composed of four salt
bridges and three hydrophobic residues. This might be due to
amino acid substitutions in the consensus sequence of the
dimeric interface. Residues Arg91, Glu111, Lys117, Arg122, and
Leu95 in PhoB are replaced by Glu83, Ala104, Glu110, Phe115, and
Phe87 in HP-RR, respectively. In addition, solution structure of
the regulatory domain based on NMR data confirmed that
HP-RR forms a stable dimer through both electrostatic and
hydrophobic interactions. An electrostatic charge network
among charged side chains forms three salt bridges: Asp93–
Arg108, Glu83–Arg108, and Arg100–Glu83 (Fig. 4B). The ionic
interactions are consolidated by inter-subunit hydrogen bonds
of the Arg112 side chain with the carbonyl oxygen of Asp92 and
Structure of a New Response Regulator hp1043
DISCUSSION
Recent studies have already proposed that the HP-RR is
capable of specific binding to its target genes without phosphorylation (14, 15). Other RRs, such as PhoP or BvgV, can bind to
DNA without phosphorylation (41– 43); however, the affinity
of DNA binding is increased by phosphorylation. Surprisingly,
HP-RR does not have the conserved phosphorylation site corresponding to Asp57 in E. coli CheY and avidly binds its own
promoter sequence without phosphorylation. Previously, Schar
et al. (14) modified a putative phosphorylation site and showed
that it was not required for HP-RR function in vivo. In addition,
they showed that HP-RR could not be phosphorylated in vitro.
For DrrB and CheB, the regulatory and DNA-binding
domains are located very close in space such that the ␣4-␤5-␣5
face of the regulatory domain packs extensively against the
DNA-binding domain providing steric hindrance in the nonphosphorylated state. However, in the case of the OmpA/PhoB
family protein DrrD, the end of helix ␣5 of the regulatory
domain contacts only with the antiparallel ␤-sheet of the DNAbinding domain. Although there are subtle differences in the
interdomain interface of the known RR proteins, the DNAbinding domains of RR proteins are generally inhibited by the
regulatory domain. The inhibition of DNA binding is relieved
through a conformational change induced by phosphorylation
of the regulatory domain that triggers dimerization of RR proteins. In contrast, we propose that the two domains of HP-RR
act independently because no interdomain interaction was
observed from NMR data. This finding is supported by
mutagenesis, showing that the monomeric F87L mutant successfully binds to DNA. This implies that dimerization of the
20674 JOURNAL OF BIOLOGICAL CHEMISTRY
regulatory domain in HP-RR does not affect the activity of the
DNA-binding domain.
Recent studies of activated regulatory domains have provided significant structural insights into their function as
inducible switches. The unphosphorylated NarL protein could
not bind to DNA because the regulatory domain is in close
contact with the recognition helix of the effecter domain,
resulting the inhibition of DNA binding (40). The inhibitory
role of the regulatory domain was also observed for the CheB
protein from Salmonella typhimurium (44). In both cases,
phosphorylation drives a structural transition of the response
regulator protein to permit DNA binding. The effect of phosphorylation has been also studied for several response regulator
proteins including NtrC (45), Spo0A (46), and FixJ (47) and in
the phosphorylation mimic state of phosphono-CheY (48) and
BeF⫺
3 -activated CheY (49). All studies reported that modification induced conformational changes. For NtrC, the ␣4 helix of
the phosphorylated state provides a hydrophobic surface allowing interactions with the other domain of the protein.
From primary sequence comparison of HP-RR with the
OmpR/PhoB subfamily, it is also found that HP-RR does not
have the consensus sequence at the acidic pocket that is
required for the phosphotransfer reaction (Fig. 5C). However,
the molecular topology of HP-RR resembles that of the OmpR/
PhoB subfamily and the dimeric interface formed by the
␣4-␤5-␣5 face is also similar to the active, phosphorylated form
of ArcA and PhoB proteins (Fig. 4A). In HP-RR, a major structural difference occurs in the ␤3-␣3 loop due to a 4-residue
deletion. By detailed comparison with the phosphorylated form
of ArcA and PhoB, the deviations of the C␣ atoms of the regulatory domain are 1.97 Å (ArcA) and 3.35 Å (PhoB) (Fig. 4A). In
addition, the orientation of key residues responsible for the
conformational change is also similar to that of the activated
PhoB protein (data not shown). Tyr94 (equivalent to Tyr102 in
PhoB) in particular adopts an inward position, indicating that
HP-RR is in an active conformation. This data supports the idea
that the conserved canonical phosphorylation site is unnecessary in HP-RR (14) because it is already in an active conformation without phosphorylation. The chemical shift perturbation
of the effecter domain upon DNA binding is relatively small,
implying that a conformational change does not occur upon
DNA binding except in binding loops (Fig. 3D). This is supported by the fact that the NMR spectra of the HP-RRe are
nearly identical to those of the full-length protein (data not
shown). 15N relaxation showed that the mobility of the putative
binding sites is enhanced from the microsecond to millisecond
time scale. Based on significant Rex values of HP-RR, both regulatory and transactivation domains might not experience
cross-talk or a dynamic interaction between two domains in
solution. Localized collective motions within backbone residues also support that the transactivation domain might bind
like a monomer upon DNA binding. Based on our findings, we
built a protein-DNA complex model by molecular modeling
(Fig. 5D). Our structure showed that HP-RR has a smaller flexible linker connecting the two domains than PhoB (39). Considering that the regulatory domains form a symmetric dimer
mediated by the ␣4-␤5-␣5 face with a very short 2-residue
linker, it is conceivable that HP-RR might bind to DNA in a
VOLUME 282 • NUMBER 28 • JULY 13, 2007
Downloaded from www.jbc.org at YONSEI UNIVERSITY on December 6, 2007
gel filtration high pressure liquid chromatography, and our
structure predicts it would disturb the dimeric interface. However, the F87A mutant expresses as an inclusion body, suggesting that the size of the hydrophobic residues is of importance
for hydrophobic interactions, which might be critical for protein folding. It is interesting to see that even though F87L is a
monomer, it retains DNA binding ability like wild-type,
whereas a dimerization-induced conformational change allows
DNA binding in the case of the PhoB and NarL response regulator proteins (17, 40). In addition, mutation of the DNA-binding domain does not affect dimerization of the regulatory
domain. Taken together, these data suggest that unlike apoPhoB, the HP-RR regulatory domain does not inhibit DNA
binding activity of the transactivation domain. The two
domains of HP-RR could in fact act independently.
The charged mutants, D93N and R108E, express as inclusion
bodies, indicating that these charged residues are also critical
for protein folding. However, R100A folded successfully, implying that Arg100 might be not critical for protein folding. None of
the mutations of the dimeric interface in the regulatory domain
affect DNA binding ability. Mutations at Val183, Asn189, Gln190,
and Gln193, located in the putative DNA recognition helix (␣8),
reduced DNA binding affinity compared with that of the wild
type. Interestingly, mutations at Thr206 and Thr208 completely
destroy the DNA binding ability, indicating that the two residues are critical for DNA binding (Fig. 5B).
Structure of a New Response Regulator hp1043
head-to-head orientation, which is quite consistent with the
fact that the DNA sequence of the binding site is an inverted
repeat (Fig. 5D).
From our data, we have a clearer understanding about how
this atypical bacterial response regulator protein could function
as a cell growth-associated regulator without a phosphorylation
event. A recent report showed that expression of HP-RR is regulated both on the post-transcriptional and post-translational
levels (15). However, the question as to how the regulation of
the protein can be achieved still remains. We conclude that
HP-RR could possess its activity without phosphorylation
because the structure of the regulatory domain resembles that
of the active, phosphorylated form of ArcA and PhoB. Our
study suggests how HP-RR differing from the well known twocomponent systems possibly functions in the absence of posttranslational modification.
REFERENCES
1. Stock, A. M., Robinson, V. L., and Goudreau, P. N. (2000) Annu. Rev.
Biochem. 69, 183–215
2. Martinez-Hackert, E., and Stock, A. M. (1997) Structure 5, 109 –124
3. Kondo, H., Nakagawa, A., Nishihira, J., Nishimura, Y., Mizuno, T., and
Tanaka, I. (1997) Nat. Struct. Biol. 4, 28 –31
4. Okamura, H., Hanaoka, S., Nagadoi, A., Makino, K., and Nishimura, Y.
(2000) J. Mol. Biol. 295, 1225–1236
5. Baikalov, I., Schroder, I., Kaczor-Grzeskowiak, M., Grzeskowiak, K., Gunsalus, R. P., and Dickerson, R. E. (1996) Biochemistry 35, 11053–11061
6. Baikalov, I., Schroder, I., Kaczor-Grzeskowiak, M., Cascio, D., Gunsalus,
R. P., and Dickerson, R. E. (1998) Biochemistry 37, 3665–3676
7. Pelton, J. G., Kustu, S., and Wemmer, D. E. (1999) J. Mol. Biol. 292,
1095–1110
8. Simonovic, M., and Volz, K. (2001) J. Biol. Chem. 276, 28637–28640
9. Tomb, J. F., White, O., Kerlavage, A. R., Clayton, R. A., Sutton, G. G.,
Fleischmann, R. D., Ketchum, K. A., Klenk, H. P., Gill, S., Dougherty, B. A.,
Nelson, K., Quackenbush, J., Zhou, L., Kirkness, E. F., Peterson, S., Loftus,
B., Richardson, D., Dodson, R., Khalak, H. G., Glodek, A., McKenney, K.,
Fitzegerald, L. M., Lee, N., Adams, M. D., Hickey, E. K., Berg, D. E., Gocayne, J. D., Utterback, T. R., Peterson, J. D., Kelley, J. M., Cotton, M. D.,
Weidman, J. M., Fujii, C., Bowman, C., Watthey, L., Wallin, E., Hayes,
W. S., Borodovsky, M., Karp, P. D., Smith, H. O., Fraser, C. M., and Venter,
J. C. (1997) Nature 388, 539 –547
10. Armitage, J. P. (1999) Adv. Microb. Physiol. 41, 229 –289
11. Eisenbach, M. (1996) Mol. Microbiol. 20, 903–910
12. Beier, D., and Frank, R. (2000) J. Bacteriol. 182, 2068 –2076
13. Delany, I., Spohn, G., Rappuoli, R., and Scarlato, V. (2002) J. Bacteriol. 184,
4800 – 4810
14. Schar, J., Sickmann, A., and Beier, D. (2005) J. Bacteriol. 187, 3100 –3109
15. Muller, S., Pflock, M., Schar, J., Kennard, S., and Beier, D. (2007) Microbiol.
Res. 162, 1–14
16. Toro-Roman, A., Mack, T. R., and Stock, A. M. (2005) J. Mol. Biol. 349,
11–26
17. Bachhawat, P., Swapna, G. V., Montelione, G. T., and Stock, A. M. (2005)
Structure (Camb.) 13, 1353–1363
18. Hong, E., Jung, J. W., Shin, J., Kim, J. H., Jeon, Y. H., Yamazaki, T., and Lee,
JULY 13, 2007 • VOLUME 282 • NUMBER 28
JOURNAL OF BIOLOGICAL CHEMISTRY
20675
Downloaded from www.jbc.org at YONSEI UNIVERSITY on December 6, 2007
Acknowledgments—We thank Sun-Sin Cha, Kyung-Jin Kim, and
Ghyung-Hwa Kim for assistance at beam line 6B and 4A of Pohang
Light Source.
W. (2004) J. Biomol. NMR 28, 85– 86
19. Delaglio, F., Grzesiek, S., Vuister, G. W., Zhu, G., Pfeifer, J., and Bax, A.
(1995) J. Biomol. NMR 6, 277–293
20. Goddard, T. D., and Kneller, D. G. (2004) SPARKY 3, 3.110 Ed., University
of California, San Francisco, CA
21. Pervushin, K., Riek, R., Wider, G., and Wuthrich, K. (1997) Proc. Natl.
Acad. Sci. U. S. A. 94, 12366 –12371
22. Cornilescu, G., Delaglio, F., and Bax, A. (1999) J. Biomol. NMR 13,
289 –302
23. Clore, G. M., and Gronenborn, A. M. (1998) Proc. Natl. Acad. Sci. U. S. A.
95, 5891–5898
24. Jee, J., and Guntert, P. (2003) J. Struct. Funct. Genomics 4, 179 –189
25. Guntert, P., Mumenthaler, C., and Wuthrich, K. (1997) J. Mol. Biol. 273,
283–298
26. Schwieters, C. D., Kuszewski, J. J., Tjandra, N., and Clore, G. M. (2003) J.
Magn. Reson. 160, 65–73
27. Laskowski, R. A., Rullmann, J. A., MacArthur, M. W., Kaptein, R., and
Thornton, J. M. (1996) J. Biomol. NMR 8, 477– 486
28. Schwieters, C. D., and Clore, G. M. (2001) J. Magn. Reson. 149, 239 –244
29. DeLano, W. L. (2004) Abstr. Pap. Am. Chem. S 228, U313–U314
30. Koradi, R., Billeter, M., and Wuthrich, K. (1996) J. Mol. Graph. 14, 29 –32,
51–55
31. Baker, N. A., Sept, D., Joseph, S., Holst, M. J., and McCammon, J. A. (2001)
Proc. Natl. Acad. Sci. U. S. A. 98, 10037–10041
32. Lee, H. M., Hong, E., Jeon, B. Y., Kim, D. U., Byun, J. S., Lee, W., and Cho,
H. S. (2006) Biochim. Biophys. Acta 1764, 989 –991
33. Otwinowski, Z., and Minor, W. (1997) Macromol. Crystallogr. A 276,
307–326
34. Terwilliger, T. C., and Berendzen, J. (1999) Acta Crystallogr. D Biol. Crystallogr. 55, 849 – 861
35. Terwilliger, T. C. (2000) Acta Crystallogr. D Biol. Crystallogr. 56, 965–972
36. Jones, T. A., Zou, J. Y., Cowan, S. W., and Kjeldgaard, M. (1991) Acta
Crystallogr. Sect. A 47, 110 –119
37. Brunger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P.,
Grosse-Kunstleve, R. W., Jiang, J. S., Kuszewski, J., Nilges, M., Pannu, N. S.,
Read, R. J., Rice, L. M., Simonson, T., and Warren, G. L. (1998) Acta
Crystallogr. D Biol. Crystallogr. 54, 905–921
38. Kordel, J., Skelton, N. J., Akke, M., Palmer, A. G., 3rd, and Chazin, W. J.
(1992) Biochemistry 31, 4856 – 4866
39. Blanco, A. G., Sola, M., Gomis-Ruth, F. X., and Coll, M. (2002) Structure
(Camb.) 10, 701–713
40. Maris, A. E., Sawaya, M. R., Kaczor-Grzeskowiak, M., Jarvis, M. R., Bearson, S. M., Kopka, M. L., Schroder, I., Gunsalus, R. P., and Dickerson, R. E.
(2002) Nat. Struct. Biol. 9, 771–778
41. Boucher, P. E., Murakami, K., Ishihama, A., and Stibitz, S. (1997) J. Bacteriol. 179, 1755–1763
42. Liu, W., and Hulett, F. M. (1997) J. Bacteriol. 179, 6302– 6310
43. Zu, T., Manetti, R., Rappuoli, R., and Scarlato, V. (1996) Mol. Microbiol.
21, 557–565
44. Djordjevic, S., Goudreau, P. N., Xu, Q., Stock, A. M., and West, A. H.
(1998) Proc. Natl. Acad. Sci. U. S. A. 95, 1381–1386
45. Kern, D., Volkman, B. F., Luginbuhl, P., Nohaile, M. J., Kustu, S., and
Wemmer, D. E. (1999) Nature 402, 894 – 898
46. Lewis, R. J., Brannigan, J. A., Muchova, K., Barak, I., and Wilkinson, A. J.
(1999) J. Mol. Biol. 294, 9 –15
47. Birck, C., Mourey, L., Gouet, P., Fabry, B., Schumacher, J., Rousseau, P.,
Kahn, D., and Samama, J. P. (1999) Structure Fold. Des. 7, 1505–1515
48. Halkides, C. J., McEvoy, M. M., Casper, E., Matsumura, P., Volz, K., and
Dahlquist, F. W. (2000) Biochemistry 39, 5280 –5286
49. Lee, S. Y., Cho, H. S., Pelton, J. G., Yan, D., Berry, E. A., and Wemmer, D. E.
(2001) J. Biol. Chem. 276, 16425–16431