Plant and Bacterial Symbiotic Mutants Define Three
Transcriptionally Distinct Stages in the Development of the
Medicago truncatula/Sinorhizobium meliloti Symbiosis1
Raka Mustaphi Mitra and Sharon Rugel Long*
Department of Biological Sciences, Stanford University, Stanford, California 94305
In the Medicago truncatula/Sinorhizobium meliloti symbiosis, the plant undergoes a series of developmental changes simultaneously, creating a root nodule and allowing bacterial entry and differentiation. Our studies of plant genes reveal novel
transcriptional regulation during the establishment of the symbiosis and identify molecular markers that distinguish classes
of plant and bacterial symbiotic mutants. We have identified three symbiotically regulated plant genes encoding a ␤,1–3
endoglucanase (MtBGLU1), a lectin (MtLEC4), and a cysteine-containing protein (MtN31). MtBGLU1 is down-regulated in
the plant 24 h after exposure to the bacterial signal, Nod factor. The non-nodulating plant mutant dmi1 is defective in the
ability to down-regulate MtBGLU1. MtLEC4 and MtN31 are induced 1 and 2 weeks after bacterial inoculation, respectively.
We examined the regulation of these two genes and three previously identified genes (MtCAM1, ENOD2, and MtLB1) in
plant symbiotic mutants and wild-type plants inoculated with bacterial symbiotic mutants. Plant (bit1, rit1, and Mtsym1) and
bacterial (exoA and exoH) mutants with defects in the initial stages of invasion are unable to induce MtLEC4, MtN31,
MtCAM1, ENOD2, and MtLB1. Bacterial mutants (fixJ and nifD) and a subset of plant mutants (dnf2, dnf3, dnf4, dnf6, and dnf7)
defective for nitrogen fixation induce the above genes. The bacA bacterial mutant, which senesces upon deposition into plant
cells, and two plant mutants with defects in nitrogen fixation (dnf1 and dnf5) induce MtLEC4 and ENOD2 but not MtN31,
MtCAM1, or MtLB1. These data suggest the presence of at least three transcriptionally distinct developmental stages during
invasion of M. truncatula by S. meliloti.
The two partners in the legume-Rhizobium symbiosis navigate a complex developmental pathway, resulting in the formation of a plant-derived root nodule in which bacteria reside and reduce molecular
nitrogen for use by the plant. Nodulation initiates
with chemical signaling between the plant and the
bacteria; the plant secretes flavonoid molecules into
the rhizosphere, and the bacteria respond with lipochitooligosaccharide signaling molecules termed
Nod factors (Long, 1996). The plant responds to bacterial Nod factors by initiating cortical cell divisions
to build the nodule. Rhizobia enter the plant through
a tubular plant-derived structure constructed in the
root hair termed the infection thread (Bauer, 1981).
Once the infection thread reaches the inner cortical
cells of the plant, the bacteria are released into the
plant cell, encapsulated in plant membranes. Within
these symbiosomes, the bacteria differentiate into
bacteroids that in the presence of low oxygen tension
express the proteins necessary to reduce molecular
nitrogen into ammonia for transport to the plant
(Oke and Long, 1999b).
1
This work was supported by the Howard Hughes Medical
Institute, by the U.S. Department of Energy (grant no. DE–FG03–
90ER20010 to S.R.L.), and by Howard Hughes Medical Institute
(Predoctoral Fellowship to R.M.M.).
* Corresponding author; e-mail [email protected]; fax 650 –
725– 8309.
Article, publication date, and citation information can be found
at http://www.plantphysiol.org/cgi/doi/10.1104/pp.103.031518.
Bacterial mutants have revealed distinct developmental signals and stages in the progression of the
symbiosis. Bacterial mutants that cannot provoke the
cell divisions necessary for nodule formation (Nod⫺)
have defects in the genes required for Nod factor
synthesis (Spaink, 2000). Bacterial mutants with defects in cell surface polysaccharides are unable to
successfully infect the plant (Gonzalez et al., 1996).
The bacA bacterial mutant, which has a defect in a
putative peptide antibiotic transporter and compromised membrane integrity, senesces upon deposition
into plant cells, suggesting an environmental change
from infection thread to symbiosome (Glazebrook et
al., 1993; Ichige and Walker, 1997). In addition, bacterial mutants that can successfully invade the plant,
begin bacteroid development, but cannot fix nitrogen
have defects in the signaling or enzymatic components necessary for the reduction of molecular nitrogen into ammonia (Ruvkun et al., 1982; David et al.,
1988).
Four broad classes of plant symbiotic mutants have
been identified: mutants that cannot make nodules
(Nod⫺), mutants with defects in infection, mutants
that make nodules that cannot fix nitrogen (Fix⫺),
and mutants that make an excessive number of nodules (supernodulator; Bénaben et al., 1995; Penmetsa
and Cook, 1997; Catoira et al., 2000, 2001; Penmetsa
et al., 2003; C.C. Starker, L. Smith, G.E.D. Oldroyd,
J. Doll, and S.R. Long, unpublished data). The Nod⫺
mutants of Medicago truncatula have been characterized for cell signaling responses, cell growth, and
Downloaded
from on June
15, 2017 - Published
www.plantphysiol.org
Plant Physiology, February 2004, Vol.
134, pp. 595–604,
www.plantphysiol.org
© by
2004
American Society of Plant Biologists
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
595
Mitra and Long
transcriptional responses to bacterial signals. For example, the Nod⫺ plant mutant dmi1 perceives Nod
factor, showing a calcium flux and root hair swelling,
but is unable to mount a calcium spiking response or
initiate the expression of genes normally induced in
the symbiosis (Catoira et al., 2000; Wais et al., 2000;
Shaw and Long, 2003a). In contrast to the Nod⫺
mutants, few infection or Fix⫺ mutants of M. truncatula have been characterized. The Mtsym1 mutant
forms two classes of nodules when infected with
Sinorhizobium meliloti: small, round nodules in which
the infection aborts in the outer cortical cells of the
root and elongated nodules in which bacteria are
released but are unable to differentiate into nitrogen
fixing bacteroids (Bénaben et al., 1995). The ratio of
nodule classes is dependent on the bacterial strain
with which the plants are inoculated; 70% of the
nodules induced by Rm2011 versus 30% of those
induced by CC169 are small and round. A recent
genetic screen in M. truncatula has identified two new
infection mutants and a panel of seven Fix⫺ mutants
(C.G. Starker, L. Smith, G.E.D. Oldroyd, J. Dal, and
S.L. Long, unpublished data). When inoculated, the
mutants with infection defects, rit1 and bit1, induce
small bumps on the root surface and infection
threads that abort in the epidermis or outer cortex of
the root. Unlike the infection mutants, the Fix⫺ mutants (dnf [defective in nitrogen fixation] mutants)
form infection threads that proceed through the cortical cells and produce limited nodule-like structures.
Based on light microscopy, the infection threads of
these Fix⫺ mutants are indistinguishable from those
of wild-type plants. Although broad categories of
infection and fixation mutants have been established,
in general, the nature of the mutations responsible
for the defects is unclear.
The characterization of symbiotically required and
regulated genes provides insight into the molecular
events in the symbiosis. In some cases, plant genes
responsible for symbiotic defects have been shown to
be symbiotically regulated (Schauser et al., 1999;
Krusell et al., 2002; Nishimura et al., 2002). In M.
truncatula, several genes induced during nodulation,
termed “nodulins” or “enods” (early nodulins), have
been identified. RIP1 encodes a peroxidase that is
induced preceding infection of the plant (Cook et al.,
1995) and may have a role in protection of the plant
from oxidative damage (Ramu et al., 2002). ENOD2,
an early nodulin, is induced during infection (Dickstein et al., 1988) and has been successfully used as a
marker for nodule organogenesis. Leghemoglobin, a
protein that is necessary to maintain low oxygen
levels within the nodule, is induced in mature nodules (Gallusci et al., 1991). More recently, with the
accumulation of M. truncatula expressed sequence
tags (ESTs), bioinformatics approaches have allowed
for screening of regulated genes based on expression
levels in different libraries (Fedorova et al., 2002;
Journet et al., 2002) and the identification of novel
596
nodulins, such as a nodule-specific calmodulin-like
protein. To date, genes that are suppressed early in
the symbiosis have not been described.
We have studied symbiotically regulated genes to
gain clues about the initial physiological events of the
plant in the establishment of the symbiosis and to
distinguish Fix⫺ plant mutants that appeared phenotypically indistinguishable. We report the identification of one gene suppressed early in the symbiosis,
encoding a ␤, 1–3 endoglucanase, and two genes
induced later in the symbiosis: a lectin and a novel
gene. Using the expression of these two genes and
three previously identified nodulins, we were able to
distinguish between infection and fixation mutants of
both the plant and bacteria, defining three transcriptionally distinct developmental stages in the
symbiosis.
RESULTS
Identification of Three Symbiotically Regulated
M. truncatula Genes
We used two approaches to identify plant genes
that are differentially regulated in the symbiosis and,
thus, act as markers for distinct developmental
stages. First, we used subtractive hybridization (Diatchenko et al., 1999) in an attempt to produce a
library enriched for symbiotically induced plant
genes (see “Materials and Methods”). This screen did
not yield any reliably up-regulated genes; however,
northern-blot analysis of 45 library clones identified a
clone (no. 108) that was weakly suppressed 24 to 48 h
after plants were flood inoculated with S. meliloti
(Fig. 1A). Although subtracted libraries enrich for
differentially regulated genes, factors such as transcript abundance result in the representation of randomly amplified genes in the library (Ji et al., 2002).
Clone 108 was suppressed 2.9- ⫾ 1.1-fold at 24 h and
3.2- ⫾ 1.2-fold at 48 h postinoculation with S. meliloti
(n ⱖ 5, Fig. 1A). Under the same conditions, the
positive control RIP1 was induced 4.5- ⫾ 2.7-fold at
24 h and 6.4- ⫾ 2.6-fold at 48 h postinoculation (n ⱖ
4, Fig. 1A). We used the BLASTX algorithm to determine homology of newly identified genes to previously described proteins (http://www.ncbi.nlm.nih.
gov/BLAST/). The full-length sequence containing
the identified clone (TC78899) shows homology to
the glucan endo-1,3-␤-glucosidases GL153 (E value ⫽
e-101) and PR2 (E value ⫽ 5e-98) from tobacco (Nicotiana tabacum), which are members of the
pathogenesis-related protein 2 (PR2) family of genes.
These genes are rapidly induced in leaves upon exposure to pathogens (Ward et al., 1991). Based on
homology to ␤-glucosidases, we refer to this gene as
MtBGLU1.
Second, we employed a bioinformatics approach,
taking advantage of the publicly available M. truncatula EST database to identify induced genes (see “Materials and Methods”). At The Institute of Genomic
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 134, 2004
Transcriptionally Distinct Symbiotic Stages of Medicago truncatula
Research, M. truncatula ESTs are compiled into
longer tentative consensus sequences (TCs) based on
regions of overlap (Quackenbush et al., 2001). By
comparing the representation of TCs in libraries from
uninoculated and S. meliloti-inoculated roots, we
identified nine candidates for further analysis. Using
northern blotting to assess transcript abundance, we
identified two transcripts strongly expressed in nodules but not roots: TC77066 and TC86036. TC77066 is
induced 7 d postinoculation, and TC86036 is induced
2 weeks postinoculation with S. meliloti (Fig. 1B). In
addition, we examined the expression of a recently
identified nodule specific calmodulin-like protein
(herein referred to as MtCAM1, Gen Bank accession
no. AF494212; Fedorova et al., 2002), which shows
induction at 2 weeks postinoculation. Under these
conditions, ENOD2 and Leghemoglobin 1 (MtLB1),
two previously characterized nodulins, are induced
at 1 and 2 weeks postinoculation, respectively.
TC77066 encodes a legume-specific lectin with closest homology (E value ⫽ 2e-65) to bark lectins of
Robinia pseudoacacia (Van Damme et al., 1995). Lectins
are carbohydrate-binding proteins that have been
suggested to have roles in storage of nutrients, defense against pathogen attack, and rhizobial recognition (Van Damme et al., 1998). Although TC77066
does not have significant homology with previously
identified nodule-specific M. truncatula lectins
(Bauchrowitz et al., 1992), we refer to it as MtLEC4
using the previously established naming system for
M. truncatula. TC86036 has weak homology (E
value ⫽ 2e-06) to a nodule-specific protein from
Galega orientalis (GenBank accession no. CAB51773;
Kaijalainen et al., 2002) and putatively encodes a
Cys-containing protein (CCP) with a conserved signal peptide and nodule-enhanced expression (Fedorova et al., 2002; Mergaert et al., 2003). We refer to
this transcript as MtN31 (M. truncatula nodulin 31)
according to previously established nomenclature
(Gamas et al., 1996). This transcript is synonymous
with the gene product designated as NCR 158 (for
Nodule-specific Cys-rich protein) by Mergaert et al.
(2003).
Figure 1. Identification of symbiotically regulated M. truncatula
genes. a, Clone 108 (MtBGLU1) is suppressed early in the symbiosis.
A representative northern blot is shown of RNA from roots exposed
to buffer, wild-type S. meliloti (Rm1021), or the SL44 bacterial
mutant which is unable to make Nod factor. Plants were harvested 6,
24, or 48 h after inoculation. Experiments were repeated at least four
times. Blots were serially probed for clone 108 (top), RIP1 (middle),
or Actin (lower). b, Representative northern blots showing induction
of TC77066 (MtLEC4), TC86036 (MtN31), MtCAM1, ENOD2, and
MtLB1 during nodulation. Plants were harvested 0, 4, 7, 14, or 28 d
after inoculation with wild-type S. meliloti. Experiments were repeated three times. The upper blot was serially probed with TC77066
(top), TC86036 (upper middle), MsENOD2 (lower middle), or Actin
(lower) probes. The lower blot was serially probed with MtCAM1
(top), MtLB1 (middle), or Actin (lower) probes.
Plant Physiol. Vol. 134, 2004
Nod Factor Is Necessary and Sufficient to Suppress the
Expression of MtBGLU1
The bacterial signaling molecule, Nod factor, elicits
many nodulation responses in M. truncatula including the modulation of gene expression (Journet et al.,
1994; Cook et al., 1995; De Carvalho-Niebel et al.,
1998). To determine whether the presence of Nod
factor is necessary to down-regulate MtBGLU1 expression or whether transcriptional down-regulation
is dependent upon another bacterial signal, we inoculated plants with the bacterial mutant SL44, which
has a deletion in the nodD1-nodABC region, rendering
it unable to synthesize the N-acetyl-glucosamine
backbone of Nod factor (Fisher et al., 1988). As a
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
597
Mitra and Long
consequence, the mutant does not elicit early signaling responses (Wais et al., 2002) or induce nodule
formation on the plant (S.R. Long., unpublished
data). The SL44 bacterial mutant did not suppress the
expression of MtBGLU1 (Fig. 1A), indicating the importance of Nod factor for the regulation of this gene.
To determine whether Nod factor was sufficient to
down-regulate MtBGLU1 expression, we treated
plants with 100 pm Nod factor (Fig. 2). Expression of
MtBGLU1 was suppressed at both 24 (2.5- ⫾ 1.0-fold)
and 48 (2.1- ⫾ 0.6-fold) h posttreatment. Under these
conditions, RIP1 was induced 2.2- ⫾ 0.9-fold at 24 h
and 2.5- ⫾ 0.5-fold at 48 h postinoculation. These
results suggest that Nod factor is the bacterial signal
that triggers suppression of MtBGLU1.
The Nodⴚ Plant Mutant, dmi1, Is Defective for
MtBGLU1 Suppression
To further validate the importance of Nod factor
for suppression of MtBGLU1, we tested the expression of this gene in a plant mutant defective in Nod
factor signaling. The dmi1 mutant responds to Nod
factor but cannot initiate calcium spiking, gene expression, or nodule morphogenesis (Catoira et al.,
2000; Wais et al., 2000; Shaw and Long, 2003a). In the
mutant, MtBGLU1 transcript levels differed from the
wild type (1.3- ⫾ 0.8-fold), and RIP1 transcript levels
were unchanged (0.7- ⫾ 0.4-fold) 48 h postinoculation (n ⫽ 5, Fig. 3). This result suggests that dmi1
is defective in the ability to completely suppress
MtBGLU1. Previous studies showed a slight induction of RIP1 in dmi1 mutants indicating possible leakiness of the mutation or an inability to sustain early
gene expression changes in the mutant (Catoira et al.,
Figure 2. Nod factor is sufficient to down-regulate MtBGLU1. Shown
is a representative northern blot of RNA from plants exposed to 100
pM Nod factor or to buffer for 24 or 48 h. Experiments were repeated
five times. The same blot was serially probed with an MtBGLU1 (top),
RIP1 (middle), or Actin (lower) probe.
598
Figure 3. dmi1 is defective in the ability to suppress MtBGLU1.
Shown is a representative northern blot of RNA from wild-type or
dmi1-2 plants exposed to S. meliloti (Rm1021) for 48 h. Experiments
were repeated at least three times. The blot was serially hybridized to
an MtBGLU1 (top), RIP1 (middle), or Actin (lower) probe.
2000). Our data are consistent with the theory that
down-regulation of MtBGLU1 expression is part of a
pathway leading to successful bacterial invasion and
nodulation.
Nodulins Show Altered Expression in Response to
Bacterial Mutants with Defects in Alfalfa
(Medicago sativa) Infection or Nitrogen Fixation
The timing of MtLEC4 and MtN31 expression suggests that they are induced later in the symbiosis,
perhaps in response to bacterial invasion or nitrogen
fixation. To test this hypothesis, we inoculated wildtype plants with S. meliloti mutants with known defects in infection of alfalfa or nitrogen fixation. Two
mutants, exoA (Rm7031) and exoH (DW223), have
defects in infection of alfalfa and exopolysaccharide
biosynthesis (Finan et al., 1985; Leigh et al., 1985,
1987). We expect exoA mutants have a similar invasion defect as exoY mutants, which are blocked for
the exopolysaccharide biosynthetic step preceding
that which requires exoA (Reuber and Walker, 1993).
exoY and exoH bacterial mutants induce infection
threads that abort in the root hair cell (Fig. 4; Cheng
and Walker, 1998). The bacA bacterial mutant can
invade alfalfa, is deposited into plant cells, but senesces before developing into mature bacteroids (Fig.
4; Glazebrook et al., 1993). Both fixJ and nifD mutant
bacteria, which cannot make nitrogenase, are released into alfalfa cells and can differentiate into
elongate bacteroids, but the bacteria typically degenerate and the nodule prematurely senesces (Fig. 4;
Ruvkun and Ausubel, 1981; Hirsch et al., 1982; Ruv
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 134, 2004
Transcriptionally Distinct Symbiotic Stages of Medicago truncatula
by any other mutant strains tested. Acetylene reduction of fixJ and nifD mutants showed that all were
unable to fix nitrogen, confirming the mutant phenotype of the bacteria throughout nodulation (n ⬎ 30
for each mutant; data not shown).
Photographs of M. truncatula nodules at the developmental stage used for transcript analysis illustrate
the morphology of nodules induced by bacterial mutants (Fig. 5B). Although alfalfa makes large nodulelike structures in response to bacterial mutants with
exopolysaccharide defects (Yang et al., 1992), we
noted that M. truncatula inoculated with exoA or exoH
mutants produces bumps that are much smaller than
the nodules induced by the other bacterial mutants
tested (Fig. 5B). It is not known whether bacterial
infection arrests in the same manner in both M. truncatula and alfalfa, nor whether bacA, fixJ, or nifD
bacterial mutants exhibit the same infection defects
in M. truncatula as in alfalfa. However, if the developmental blocks are similar in both organisms, then
these data suggest that the induction of MtLEC4 and
Figure 4. Model of infection and fixation defects. Bacterial (blue
lettering) and plant mutants (black lettering) define distinct developmental blocks in the symbiosis. Bacterial invasion of plants (blue) can
be arrested at one of three points: before inner cortical cell penetration (upper), after release into plant cells (upper middle), and after
differentiation into bacteroids (lower middle). These phases can be
transcriptionally separated using the expression patterns of MtLEC4,
ENOD2, MtN31, MtCAM1, and MtLB1.
kun et al., 1982; Batut et al., 1985; David et al., 1988;
Vasse et al., 1990).
Both MtLEC4 and MtN31 showed altered expression in aberrant nodules formed by the bacterial mutants tested. The exoA and exoH mutants failed to
induce expression of either MtLEC4 or MtN31 (Fig.
5A). The bacA mutant induced MtLEC4 but not
MtN31. Both the fixJ and nifD mutants induced
MtLEC4 to normal levels and MtN31 to reduced levels when compared with wild-type bacteria (Fig. 5A).
The previously identified nodulins MtCAM1,
ENOD2, and MtLB1 also exhibited altered expression
in response to bacterial mutants (Fig. 5A). ENOD2
and MtLEC4 show similar expression patterns with
no induction by exoA and exoH and induction by
bacA, fixJ, and nifD mutants. This result contrasts
with previous studies of alfalfa in which ENOD2
expression was induced by bacteria with defects in
exopolysaccharide production (Dickstein et al., 1988,
1991). MtLB1 and MtCAM1 showed expression patterns similar to MtN31 (Fig. 5A). Both were induced
by fixJ and nifD bacteria to reduced levels as compared with the wild type, and neither was induced
Plant Physiol. Vol. 134, 2004
Figure 5. MtLEC4, MtN31, MtCAM1, ENOD2, and MtLB1 exhibit
altered expression in response to bacterial mutants. a, Representative
northern blots of RNA from M. truncatula plants exposed to bacterial
mutants: exoA (Rm7031), exoH (DW223), bacA (VO2119), fixJ
(VO2683), and nifD (VO2746) or to wild-type bacteria (Rm1021) for
4 weeks. Experiments were repeated at least three times. The upper
blot was serially hybridized to an MtLEC4, MtN31, or actin probe.
The lower blot was serially hybridized to an MtCAM1, MsENOD2,
Actin, or MtLB1 probe. b, Representative photographs of M. truncatula root sections inoculated with each bacterial mutant. All photographs are at the same magnification. Scale bar ⫽ 0.5 mm.
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
599
Mitra and Long
ENOD2 in M. truncatula correlates with sustained
plant infection, cell divisions, or cell expansion,
whereas the initial induction of MtN31, MtCAM1, and
MtLB1 correlates with the presence of elongate bacteroids within the plant cells of the nodule (Fig. 4).
Nodulins Show Altered Expression in Plants
Mutant for Bacterial Entry or Nitrogen Fixation
Because the late nodulins distinguish three transcriptionally distinct classes of bacterial mutants, we
tested whether they also distinguish classes of plant
mutants that appear otherwise phenotypically similar. We examined the expression of these genes in 11
plant mutants with defects in infection or nitrogen
fixation. Three infection mutants, rit1, bit1, and
Mtsym1, have defects in the ability of the infection
thread to penetrate past the outer cortical cells of the
plant (Fig. 4; Bénaben et al., 1995; C.G. Starker, L.
Smith, G.E.D. Oldroyd, J. Doll, and S.L. Long, unpublished data). Although Mtsym1 can induce either
small or elongate nodules, in our conditions, with the
bacterial strain Rm1021, elongate nodules were never
observed (data not shown). Seven M. truncatula mutants, dnf1 to dnf7, have defects in nitrogen fixation.
Although infection threads in these mutants are indistinguishable from the wild type based on light
microscopy, it is unknown whether bacteria can differentiate into bacteroids (Starker et al., unpublished
data).
As observed with bacterial infection mutants, the
plant mutant bit1, which has defects in early infection, never induced MtLEC4, MtN31, MtCAM1,
Figure 6. MtLEC4, MtN31, MtCAM1, ENOD2, and MtLB1 exhibit
altered expression in plant mutants. Shown are representative northern blots of RNA from M. truncatula plant mutants exposed to
wild-type bacteria (Rm1021) for 4 weeks. Experiments were repeated
at least three times. The upper blot was serially hybridized to an
MtLEC4, MtN31, MsENOD2, or Actin probe. The lower blot was
serially hybridized to an MtCAM1, MtLB1 or Actin probe.
600
ENOD2, or MtLB1 (Fig. 6). In most cases, these genes
were not induced in Mtsym1 and rit1, although for
each mutant in one of four northern blots, weak
expression of MtLEC4 (Mtsym1) or MtLEC4 and
MtN31 (rit1) was observed. This result may indicate
that the mutations responsible for the infection defects are leaky. Two of the Fix⫺ plant mutants, dnf1
and dnf5, showed gene expression similar to that
observed when wild-type plants were inoculated
with bacA bacterial mutant; only MtLEC4 and
ENOD2 were induced in these mutants. In contrast,
the remaining Fix⫺ mutants induced all the genes
tested (Fig. 6). These data suggest the presence of at
least three distinct transcriptional phases in the symbiosis that can be correlated with phenotypes of both
plant and bacterial mutants (Fig. 4).
DISCUSSION
We report the identification of three genes regulated in the legume-Rhizobium symbiosis and use
them in concert with three previously identified
nodulins to study plant and bacterial symbiotic
mutants.
Although several symbiotically induced plant
genes have been identified previously (Cook et al.,
1995; Gamas et al., 1996; De Carvalho-Niebel et al.,
1998), this study contains the first report, to our
knowledge, of a gene, MtBGLU1, which is suppressed early in the symbiosis. Our results suggest
that the same signal that induces expression of early
nodulins, the bacterial signal Nod factor, is also sufficient to suppress MtBGLU1. This suppression is
part of a Nod factor signaling pathway downstream
of Nod factor recognition because the Nod factor
signaling plant mutant dmi1 is defective in the ability
to down-regulate MtBGLU1. This finding adds evidence to the theory that bacterial recognition can
trigger suppression of plant pathways (Shaw and
Long, 2003b), although the mechanism for concurrent
induction and suppression is unclear. Perhaps the
Nod factor signal transduction machinery can function both in an inhibitory and activating manner
toward different promoters. Alternately, a branch
point in the transduction of the Nod factor signal
may allow the activation of different sets of molecular machines to either induce or suppress genes.
Based on homology, MtBGLU1 encodes a ␤,1–3
endoglucanase with high homology to pathogenesisinduced proteins, GL153 and PR2. Although it is
unclear whether these proteins exhibit antifungal activity (Sela-Buurlage et al., 1993), they are markers
indicating the initiation of a plant defense response
to pathogens (Ward et al., 1991). Because the PR2
class of genes is induced as part of plant defense to
pathogens, the suppression of MtGBLU1 we observe
in response to a symbiont may indicate a suppression
of plant defenses. Preliminary studies indicate that
MtBGLU1 is not induced by a benzothiadiazole de-
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 134, 2004
Transcriptionally Distinct Symbiotic Stages of Medicago truncatula
rivative (data not shown), which can normally induce plant defense responses in the salycilic acid
pathway (Friedrich et al., 1996); however, recent
work using fungal elicitors provides evidence for the
suppression of defenses early in nodulation. Fungal
oligosaccharide elicitors trigger a rapid oxidative
burst in M. truncatula roots (Shaw and Long, 2003b).
Nod factor suppresses this oxidative burst in wildtype plants; however, it is unable to do so in the
Nod⫺ plant mutant nfp. These data suggest a direct
link between Nod factor suppression of defenses and
induction of nodulation.
Although our in silico examination of nodulins
identified two nodulins, MtLEC4 and MtN31, not all
candidates tested showed differential expression.
Previous studies validating expression patterns of 91
predicted nodule-enhanced TCs using macroarray
hybridizations showed that TCs specified by five or
more ESTs were reliably induced in nodules (Fedorova et al., 2002). Under our conditions, this was
not the case. For example, the expression pattern,
TC32071, comprised of 32 ESTs from inoculated and
nodule libraries and no ESTs from uninoculated root
libraries, was validated using macroarrays (Fedorova
et al., 2002). Using northern blotting, we were unable
to confirm differential expression of this TC. The
discrepancy in the validation of in silico predictions
may be explained by the technique used, differences
in the growth conditions, nodulation kinetics, or the
bacterial strain used.
MtN31 belongs to a large family of nodule-specific
CCPs (Fedorova et al., 2002; Mergaert et al., 2003).
CCP gene family members have only been identified
to date in galegoid legumes forming indeterminate
nodules (Mergaert et al., 2003). These genes are transcriptionally up-regulated in nodules, although the
initiation of gene induction can vary between 7 and
13 d after inoculation (Mergaert et al., 2003). Previous
macroarray hybridization studies of gene expression
of 14 CCPs under a series of conditions yielded parallel observations as those we report for MtN31 (Mergaert et al., 2003). As observed with MtN31, the 14
CCPs are induced by a bacterial mutant defective in
nitrogen fixation (fixG; Mergaert et al., 2003). Although induction of the 14 CCPs is greatly reduced in
plants inoculated with bacterial mutants defective in
exopolysaccharide production (exoB) or with a mutation in bacA, the authors note a limited plant transcriptional response to these mutants (Mergaert et al.,
2003). We never observed induction of MtN31in response to exoA or bacA bacterial mutants; this difference can be attributed to the sensitivity or fidelity of
the assay used.
The developmental blocks defined by five bacterial
mutants and 11 plant mutants fell into three classes
(Fig. 4). The first class, including bacterial (exoA and
exoH) and plant (bit1, rit1, and Mtsym1) mutants defective in infection, was unable to induce any of the
nodulins tested, and inoculation resulted in the forPlant Physiol. Vol. 134, 2004
mation of small bumps on the surface of the root.
Previous studies using alfalfa (Dickstein et al., 1988)
showed that bacterial mutants with defects in exopolysaccharide biosynthesis or nitrogen fixation could
induce ENOD2 expression and large nodule-like
structures that lack a persistent meristem (Yang et al.,
1992). Under our conditions, alfalfa constructs larger
nodule-like structures than M. truncatula when inoculated with exoA or exoH bacterial mutants (data not
shown). In addition, alfalfa, unlike M. truncatula, can
induce nodule formation in the absence of Rhizobia
(Truchet et al., 1989) and allow effective nodulation
by lpsB bacterial mutants (Niehaus et al., 1998). These
data suggest that the development of the symbiosis is
more tightly controlled in M. truncatula than in alfalfa
and that the induction of ENOD2 and MTLEC4 requires that the symbiosis progress past the developmental block induced by early infection mutants.
The second class of bacterial (bacA) and plant (dnf1
and dnf5) mutants, which showed infection of the
inner cortex, induced ENOD2 and MtLEC4 and created larger nodule-like structures than those induced
by early infection mutants (Fig. 4). MtLEC4 has homology to bark lectins. The role of lectins in the
legume-Rhizobium symbiosis has been well studied
(Hirsch, 1999). Most research has focused on the role
of lectins in Nod factor recognition or bacterial attachment. The heterologous expression of a pea (Pisum sativum) lectin in alfalfa enhances nodule formation by non-host bacteria that generate host-specific
Nod factor (van Rhijn et al., 2001). In Dolichos biflorus,
a Nod factor-binding lectin with apyrase activity is
localized to root hairs (Etzler et al., 1999; Kalsi and
Etzler, 2000). Lectins have been found in nodules of
several species (VandenBosch et al., 1994; Bauchrowitz et al., 1996; Kardailsky et al., 1996), and alfalfa
plants expressing antisense versions of noduleenhanced lectins show severe developmental defects
(Brill et al., 2001). Previously studied lectins should
be assessed for their induction pattern in plant mutants and in wild-type plants inoculated with bacterial mutants to determine whether they show similar
expression patterns to MtLEC4. Although the role of
MtLEC4 is unknown, its induction is correlated with
bacterial penetration of the root cortex and sustained
cell divisions; thus, MtLEC4 may have a role in the
formation of a persistent nodule meristem or in the
release of bacteria into plant cells. Future studies that
biochemically define the lectin substrate may offer
clues as to the role of the lectin in the recognition of
plant or bacterial carbohydrates.
The final class of bacterial (fixJ and nifD) and plant
mutants (dnf2, 3, 4, 6, and 7) induced all the genes
tested and created large nodule-like structures but
still had defects in nitrogen fixation (Fig. 4). Interestingly, fixJ bacterial mutants could not induce MtN31,
MtCAM1, and MtLB1 to the same level as was induced by nifD bacterial mutants (Fig. 5A). Both mutants are unable to fix nitrogen, but the FixJ defect is
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
601
Mitra and Long
upstream of the NifD defect and may result in transcriptional misregulation of additional bacterial
genes. The differential response of the plant to fixJ
and nifD mutant bacteria may suggest that the plant
monitors bacterial physiology, bacterial development, or the availability of reduced nitrogen closely
after bacteroid differentiation.
The three classes of infection and fixation mutants
may indicate the presence of three discrete checkpoints in the progression of nodulation. It will be
interesting to determine what signals mediate these
potential checkpoints. Our studies of the transcriptional profile of two groups of genes revealed similar
developmental arrests induced in plant mutants and
in wild-type plants inoculated with bacterial mutants. The identification of correlated phenotypes
suggests a complex interplay between the two partners in which they coordinate symbiotic development. Future studies examining the mechanism of
this coordination will be useful in determining
whether environmental, physiological, metabolic, or
signaling components are important for the development of a successful symbiosis.
Trizol addition. If necessary, further homogenization was performed using
a Polytron homogenizer (PT 10/35, Brinkman, Westbury, NY). Poly(A⫹)
RNA was purified using the Qiagen Oligotex mRNA Mini kit (Qiagen,
Valencia, CA). To verify yield and quality of RNA, samples were subject to
spectrophotometric examination (Sambrook et al., 1989) and gel electrophoresis. For each preparation, approximately 40 ␮g of total RNA was
isolated from 30 roots. Five to 15 micrograms of total RNA was electrophoresed on a 1.2% (w/v) agarose gel with 6.2% (v/v) formaldehyde in MOPS
buffer, and RNA was transferred to a nylon membrane (Hybond N⫹,
Amersham Pharmacia Biotech, Buckinghamshire, UK).
PCR or reverse transcriptase-PCR was used to generate DNA fragments
for probing northern blots. Primer pairs and probe lengths used for newly
identified genes are: MtBGLU1 (CTTTGATGCCCAATTAGACTCAGTA and
TAAAGATTGTCCAACCTCCTAACCT, 449 bp), MtLEC4 (TGAAGTGAAAGACCATGAGTAGATG and CACAGTTATCTTCAACTTTCCCAAG, 675
bp), and MtN31 (ATCAACTTTTTCGAAATCTTACGTG and CCTATTTCATTGAAGTTAACAAAGCA, 505 bp). A 670-bp DNA fragment representing previously published probe sequences was used for pGVN-55I10
(Fedorova et al., 2002). A 419-bp fragment of M. truncatula MtLB1 (Gallusci
et al., 1991), a 419-bp fragment of M. truncatula RIP1 (Cook et al., 1995), and
a 209-bp fragment of alfalfa (Medicago sativa) ENOD2 (Dickstein et al., 1988)
were used to represent known nodulins. Actin was used as a loading control
(Oldroyd et al., 2001). Radiolabeled DNA probes were generated using the
Amersham Rediprime II Random Prime Labeling System. Radioactivity on
northern blots was quantitated using a phosphor imager to give a calculated
signal “volume” (pixel density ⫻ area of band) for each band on the blot
(Bio-Rad GS-363 Molecular Imager, Bio-Rad, Hercules, CA). For calculations
of fold suppression of MtBGLU1, normalized for loading, the following
equation was used:
MATERIALS AND METHODS
Fold suppression of Mtbglu1 ⫽
Plant Growth Conditions
Medicago truncatula [Gaertn.] cv Jemalong A-17 seeds were scarified using
concentrated sulfuric acid for 10 to 15 min, rinsed with sterile water, and
sterilized in commercial bleach for 3 min. After rinsing to remove residual
bleach, seeds were imbibed in sterile water for 4 to 12 h while shaking and
were stored under water at 4°C to be used within a week. Mutant seeds were
prepared in the same manner except rit1 seeds, which were scarified for 3
min and sterilized for 3 min in a solution of 20% (v/v) commercial bleach
and 0.5% (v/v) Tween 20. Seeds were germinated overnight in inverted
petri dishes in the dark and plated on buffered nodulation medium (BNM;
pH 6.5; Ehrhardt et al., 1992) with 1.2% (w/v) agar and 1 mm
␣-aminoisobutyric acid (Sigma-Aldrich, St. Louis). Plants were grown at
22°C in a growth room with 14 h of light per day at 110 ␮E m⫺2 s⫺1.
Bacterial Strains and Nod Factor
Sinorhizobium meliloti strain Rm1021 is a streptomycin-resistant derivative
of wild-type field isolate SU47 (Meade et al., 1982). exoA (Rm7031; Leigh et
al., 1985), exoH (DW223; Wells and Long, 2002), bacA (VO2119; Oke and
Long, 1999a), fixJ (VO2683; Oke and Long, 1999a), and SL44 (Fisher et al.,
1988) mutant strains were published previously. The nifD mutant (VO2746)
was created by transduction of the mutation from Rm1312Sp (Barnett et al.,
1998) into Rm1021 (V. Oke, unpublished data).
Bacteria were grown in liquid tryptone-yeast extract (Beringer, 1974)
supplemented with appropriate antibiotics. Antibiotics were used at the
following concentrations: 500 ␮g mL⫺1 streptomycin, 50 ␮g mL⫺1 spectinomycin, and 50 ␮g mL⫺1 neomycin. For inoculations, bacteria were pelleted,
washed in 0.5⫻ BNM, and then diluted in 0.5⫻ BNM to an approximate
OD600 of 0.03 (approximately 3 ⫻ 107 cfu mL⫺1). Plant roots were flood
inoculated 5 d after planting with 10 mL of inoculum per plate (245 ⫻ 245 ⫻
20 mm, Nalgene Nunc Intl., Naperville, IL). NodRm-IV (Ac and S) was
purified previously (Ehrhardt et al., 1996) and diluted to 100 pm in 0.5⫻
BNM and applied as above.
[volume MtBGLU1buffer/volume actinbuffer]
[volume MtBGLU1bacteria/volume actinbacteria]
A reciprocal equation was used to calculate fold induction of RIP1. The
average fold change and sd of the fold change are calculated for each gene.
Subtractive Hybridization
Subtractive hybridization was performed on 8 ␮g of Poly(A⫹) RNA using
the PCR-Select subtractive hybridization kit (CLONTECH, Palo Alto, CA).
Plant roots were exposed to buffer or S. meliloti for 6 h. In an attempt to
enrich for plant genes induced early in the symbiosis, RNA derived from
buffer inoculated roots was subtracted from RNA derived from bacterial
inoculated roots.
Database Analyses
Excel (Microsoft, Redmond, WA) was used to analyze the M. truncatula
Gene Index (MtGI) Release 4.0 (http://www.tigr.org/tdb/mtgi) and identify TCs containing ESTs from Rhizobia-inoculated or nodule libraries. In an
attempt to eliminate constitutively expressed genes, TCs that were represented in uninoculated root or leaf libraries were omitted from further
analyses. To identify putative Rhizobium-induced genes, the number of
ESTs from inoculated or nodule libraries was tallied for each TC. TCs were
then sorted based on this factor normalized for library size. Nine genes with
interesting homology or with the most extreme nodule-specific representation were examined by northern hybridization. TCs representing these
genes were numbered as follows: 28734, 32071, 32103, 35875, 35941, 36232,
39290, 39747, and 39884 and have been renumbered in the current version of
MtGI (7.0) as 77713/7714, 85766/85767, 77066, 85309, 86036, 77299, 78239,
77544, and 85172 (TCs that were split into two are indicated by a slash). Four
of the renamed TCs (85766/86767, 77066, and 86036) still show inoculationor nodule-specific representation in MtGI (7.0). In the older version of MtGI
(4.0), MtLEC4 and MtN31 were represented by TCs 32103 and 35875, respectively. In the current release of MtGI (7.0), MtBGLU1, MtLEC4, and
MtN31are represented by TCs 78899, 77066, and 86036, respectively. DNA
for probing northern blots was amplified using reverse transcriptase-PCR
on M. truncatula cDNA.
RNA Preparation and Northern Hybridizations
RNA was purified with Trizol (Invitrogen, Carlsbad, CA) using the
manufacturer’s protocol for tissues with high lipid content. Roots were
harvested and ground in liquid nitrogen using a mortar and pestle before
602
Distribution of Materials
Upon request, all novel materials described in this publication will be
made available in a timely manner for noncommercial research purposes,
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 134, 2004
Transcriptionally Distinct Symbiotic Stages of Medicago truncatula
subject to the requisite permission from any third party owners of all or
parts of the material. Obtaining any permissions will be the responsibility of
the requestor.
ACKNOWLEDGMENTS
We would like to thank Valerie Oke (University of Pittsburgh) for the
nifD strain V02746, Harita Veereshlingam and Rebecca Dickstein (University of North Texas, Denton) for providing the plasmid template for the
Enod2 probe, and Susan Miller and Carroll Vance (University of Minnesota,
St. Paul) for providing pGVN-55I10. Colby Starker generously provided the
seed for rit1, bit1, and the dnf mutants and probe for MtLB1. Lucinda Smith
(Stanford University, Stanford, CA) produced the seed for the dmi1 mutant.
We thank former and current members of the lab, especially Colby Starker
(Stanford University, Stanford, CA), Sidney Shaw (Stanford University,
Stanford, CA), Giles Oldroyd (John Innes Centre, Norwich, UK), Melicent
Peck (Stanford University, Stanford, CA), David Keating (Loyola University
Chicago, Maywood, IL) and Robert Fisher (Stanford University, Stanford,
CA) for critical reading of the manuscript before publication.
Received August 14, 2003; returned for revision August 27, 2003; accepted
October 13, 2003.
LITERATURE CITED
Barnett MJ, Swanson JA, Long SR (1998) Multiple genetic controls on
Rhizobium meliloti syrA, a regulator of exopolysaccharide abundance.
Genetics 148: 19–32
Batut J, Terzaghi B, Ghérardi M, Huguet M, Terzaghi E, Garnerone A,
Boistard P, Huguet T (1985) Localization of a symbiotic fix region on
Rhizobium meliloti pSym megaplasmid more than 200 kilobases from the
nod-nif region. Mol Gen Genet 199: 232–239
Bauchrowitz M, Barker D, Truchet G (1996) Lectin genes are expressed
throughout root nodule development and during nitrogen-fixation in the
Rhizobium-Medicago symbiosis. Plant J 9: 31–43
Bauchrowitz MA, Barker DG, Nadaud I, Rouge P, Lescure B (1992) Lectin
genes from the legume Medicago truncatula. Plant Mol Biol 19: 1011–1017
Bauer W (1981) Infection of legumes by Rhizobia. Annu Rev Plant Physiol
Plant Mol Biol 32: 407–449
Bénaben V, Duc G, Lefebvre V, Huguet T (1995) TE7, an inefficient
symbiotic mutant of Medicago truncatula Gaertn. cv Jemalong. Plant
Physiol 107: 53–62
Beringer JE (1974) R factor transfer in Rhizobium leguminosarum. J Gen
Microbiol 84: 188–198
Brill LM, Evans CJ, Hirsch AM (2001) Expression of MsLEC1- and MsLEC2antisense genes in alfalfa plant lines causes severe embryogenic, developmental and reproductive abnormalities. Plant J 25: 453–461
Catoira R, Galera C, de Billy F, Penmetsa RV, Journet EP, Maillet F,
Rosenberg C, Cook D, Gough C, Dénarié J (2000) Four genes of Medicago
truncatula controlling components of a Nod factor transduction pathway.
Plant Cell 12: 1647–1666
Catoira R, Timmers AC, Maillet F, Galera C, Penmetsa RV, Cook D,
Dénarié J, Gough C (2001) The HCL gene of Medicago truncatula controls
Rhizobium-induced root hair curling. Development 128: 1507–1518
Cheng HP, Walker GC (1998) Succinoglycan is required for initiation and
elongation of infection threads during nodulation of alfalfa by Rhizobium
meliloti. J Bacteriol 180: 5183–5191
Cook D, Dreyer D, Bonnet D, Howell M, Nony E, VandenBosch K (1995)
Transient induction of a peroxidase gene in Medicago truncatula precedes
infection by Rhizobium meliloti. Plant Cell 7: 43–55
David M, Daveran ML, Batut J, Dedieu A, Domergue O, Ghai J, Hertig C,
Boistard P, Kahn D (1988) Cascade regulation of nif gene expression in
Rhizobium meliloti. Cell 54: 671–683
De Carvalho-Niebel F, Lescure N, Cullimore JV, Gamas P (1998) The
Medicago truncatula MtANN1 gene encoding an annexin is induced by
Nod factors and during the symbiotic interaction with Rhizobium meliloti.
Mol Plant-Microbe Interact 11: 504–513
Diatchenko L, Lukyanov S, Lau YF, Siebert PD (1999) Suppression subtractive hybridization: a versatile method for identifying differentially
expressed genes. Methods Enzymol 303: 349–380
Plant Physiol. Vol. 134, 2004
Dickstein R, Bisseling T, Reinhold VN, Ausubel FM (1988) Expression of
nodule-specific genes in alfalfa root nodules blocked at an early stage of
development. Genes Dev 2: 677–687
Dickstein R, Scheirer DC, Fowle WH, Ausubel FM (1991) Nodules elicited
by Rhizobium meliloti heme mutants are arrested at an early stage of
development. Mol Gen Genet 230: 423–432
Ehrhardt DW, Atkinson EM, Long SR (1992) Depolarization of alfalfa root
hair membrane potential by Rhizobium meliloti Nod factors. Science 256:
998–1000
Ehrhardt DW, Wais R, Long SR (1996) Calcium spiking in plant root hairs
responding to Rhizobium nodulation signals. Cell 85: 673–681
Etzler ME, Kalsi G, Ewing NN, Roberts NJ, Day RB, Murphy JB (1999) A
Nod factor binding lectin with apyrase activity from legume roots. Proc
Natl Acad Sci USA 96: 5856–5861
Fedorova M, Van De Mortel J, Matsumoto PA, Cho J, Town CD, VandenBosch KA, Gantt JS, Vance CP (2002) Genome-wide identification of
nodule-specific transcripts in the model legume Medicago truncatula.
Plant Physiol 130: 519–537
Finan TM, Hirsch AM, Leigh JA, Johansen E, Kuldau GA, Deegan S,
Walker GC, Signer ER (1985) Symbiotic mutants of Rhizobium meliloti
that uncouple plant from bacterial differentiation. Cell 40: 869–877
Fisher RF, Egelhoff TT, Mulligan JT, Long SR (1988) Specific binding of
proteins from Rhizobium meliloti cell-free extracts containing NodD to
DNA sequences upstream of inducible nodulation genes. Genes Dev 2:
282–293
Friedrich L, Lawton K, Reuss W, Masner P, Specker N, Gut Rella M, Meier
B, Dincher S, Staub T, Uknes S et al. (1996) A benzothiadiazole derivative induces systemic acquired resistance in tobacco. Plant J 10: 61–70
Gallusci P, Dedieu A, Journet EP, Huguet T, Barker DG (1991) Synchronous expression of leghaemoglobin genes in Medicago truncatula during
nitrogen-fixing root nodule development and response to exogenously
supplied nitrate. Plant Mol Biol 17: 335–349
Gamas P, De Carvalho-Niebel F, Lescure N, Cullimore J (1996) Use of a
subtractive hybridization approach to identify new Medicago truncatula
genes induced during root nodule development. Mol Plant-Microbe Interact 9: 233–242
Glazebrook J, Ichige A, Walker GC (1993) A Rhizobium meliloti homolog of
the Escherichia coli peptide-antibiotic transport protein SbmA is essential
for bacteroid development. Genes Dev 7: 1485–1497
Gonzalez JE, York GM, Walker GC (1996) Rhizobium meliloti exopolysaccharides: synthesis and symbiotic function. Gene 179: 141–146
Hirsch AM (1999) Role of lectins (and rhizobial exopolysaccharides) in
legume nodulation. Curr Opin Plant Biol 2: 320–326
Hirsch AM, Long SR, Bang M, Haskins N, Ausubel FM (1982) Structural
studies of alfalfa roots infected with nodulation mutants of Rhizobium
meliloti. J Bacteriol 151: 411–419
Ichige A, Walker GC (1997) Genetic analysis of the Rhizobium meliloti bacA
gene: functional interchangeability with the Escherichia coli sbmA gene
and phenotypes of mutants. J Bacteriol 179: 209–216
Ji W, Wright MB, Cai L, Flament A, Lindpaintner K (2002) Efficacy of SSH
PCR in isolating differentially expressed genes. BioMed Central Genomics 3: 12
Journet EP, Pichon M, Dedieu A, de Billy F, Truchet G, Barker DG (1994)
Rhizobium meliloti Nod factors elicit cell-specific transcription of the
ENOD12 gene in transgenic alfalfa. Plant J 6: 241–249
Journet EP, van Tuinen D, Gouzy J, Crespeau H, Carreau V, Farmer MJ,
Niebel A, Schiex T, Jaillon O, Chatagnier O et al. (2002) Exploring root
symbiotic programs in the model legume Medicago truncatula using EST
analysis. Nucleic Acids Res 30: 5579–5592
Kaijalainen S, Schroda M, Lindstrom K (2002) Cloning of nodule-specific
cDNAs of Galega orientalis. Physiol Plant 114: 588–593
Kalsi G, Etzler ME (2000) Localization of a Nod factor-binding protein in
legume roots and factors influencing its distribution and expression.
Plant Physiol 124: 1039–1048
Kardailsky IV, Sherrier DJ, Brewin NJ (1996) Identification of a new pea
gene, PsNlec1, encoding a lectin-like glycoprotein isolated from the
symbiosomes of root nodules. Plant Physiol 111: 49–60
Krusell L, Madsen LH, Sato S, Aubert G, Genua A, Szczyglowski K, Duc
G, Kaneko T, Tabata S, de Bruijn F et al. (2002) Shoot control of root
development and nodulation is mediated by a receptor-like kinase. Nature 420: 422–426
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
603
Mitra and Long
Leigh JA, Reed JW, Hanks JF, Hirsch AM, Walker GC (1987) Rhizobium
meliloti mutants that fail to succinylate their calcofluor-binding exopolysaccharide are defective in nodule invasion. Cell 51: 579–587
Leigh JA, Signer ER, Walker GC (1985) Exopolysaccharide-deficient mutants of Rhizobium meliloti that form ineffective nodules. Proc Natl Acad
Sci USA 82: 6231–6235
Long SR (1996) Rhizobium symbiosis: nod factors in perspective. Plant Cell
8: 1885–1898
Meade HM, Long SR, Ruvkun GB, Brown SE, Ausubel FM (1982) Physical
and genetic characterization of symbiotic and auxotrophic mutants of
Rhizobium meliloti induced by transposon Tn5 mutagenesis. J Bacteriol
149: 114–122
Mergaert P, Nikovics K, Kelemen Z, Maunoury N, Vaubert D, Kondorosi
A, Kondorosi E (2003) A novel family in Medicago truncatula consisting of
more than 300 nodule-specific genes coding for small, secreted polypeptides with conserved cysteine motifs. Plant Physiol 132: 161–173
Niehaus K, Lagares A, Puhler A (1998) A Sinorhizobium meliloti lipopolysaccharide mutant induces effective nodules on the host plant Medicago
sativa (alfalfa) but fails to establish a symbiosis with Medicago truncatula.
Mol Plant-Microbe Interact 11: 906–914
Nishimura R, Hayashi M, Wu GJ, Kouchi H, Imaizumi-Anraku H, Murakami Y, Kawasaki S, Akao S, Ohmori M, Nagasawa M et al. (2002)
HAR1 mediates systemic regulation of symbiotic organ development.
Nature 420: 426–429
Oke V, Long SR (1999a) Bacterial genes induced within the nodule during
the Rhizobium-legume symbiosis. Mol Microbiol 32: 837–849
Oke V, Long SR (1999b) Bacteroid formation in the Rhizobium-legume
symbiosis. Curr Opin Microbiol 2: 641–646
Oldroyd GE, Engstrom EM, Long SR (2001) Ethylene inhibits the Nod
factor signal transduction pathway of Medicago truncatula. Plant Cell 13:
1835–1849
Penmetsa RV, Cook DR (1997) A legume ethylene-insensitive mutant hyperinfected by its rhizobial symbiont. Science 275: 527–530
Penmetsa RV, Frugoli JA, Smith LS, Long SR, Cook DR (2003) Dual
genetic pathways controlling nodule number in Medicago truncatula.
Plant Physiol 131: 998–1008
Quackenbush J, Cho J, Lee D, Liang F, Holt I, Karamycheva S, Parvizi B,
Pertea G, Sultana R, White J (2001) The TIGR Gene Indices: analysis of
gene transcript sequences in highly sampled eukaryotic species. Nucleic
Acids Res 29: 159–164
Ramu SK, Peng HM, Cook DR (2002) Nod factor induction of reactive
oxygen species production is correlated with expression of the early
nodulin gene RIP1 in Medicago truncatula. Mol Plant-Microbe Interact 15:
522–528
Reuber TL, Walker GC (1993) Biosynthesis of succinoglycan, a symbiotically important exopolysaccharide of Rhizobium meliloti. Cell 74: 269–280
Ruvkun GB, Ausubel FM (1981) A general method for site-directed mutagenesis in prokaryotes. Nature 289: 85–88
Ruvkun GB, Sundaresan V, Ausubel FM (1982) Directed transposon Tn5
mutagenesis and complementation analysis of Rhizobium meliloti symbiotic nitrogen fixation genes. Cell 29: 551–559
604
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory
Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY
Schauser L, Roussis A, Stiller J, Stougaard J (1999) A plant regulator
controlling development of symbiotic root nodules. Nature 402: 191–195
Sela-Buurlage MB, Ponstein AS, Bres-Vloemans SA, Melchers LS, Van
Den Elzen P, Cornelissen B (1993) Only specific tobacco (Nicotiana
tabacum) chitinases and [beta]-1,3-glucanases exhibit antifungal activity.
Plant Physiol 101: 857–863
Shaw SL, Long SR (2003a) Nod factor elicits two separable calcium responses in Medicago truncatula root hair cells. Plant Physiol 131: 976–984
Shaw SL, Long SR (2003b) Nod factor inhibition of reactive oxygen efflux
in a host legume. Plant Physiol 132: 2196–2204
Spaink HP (2000) Root nodulation and infection factors produced by rhizobial bacteria. Annu Rev Microbiol 54: 257–288
Truchet G, Barker DG, Camut S, De Billy F, Vasse J, Huguet T (1989)
Alfalfa nodulation in the absence of Rhizobium. Mol Gen Genet 219: 65–68
Van Damme EJ, Barre A, Smeets K, Torrekens S, Van Leuven F, Rouge P,
Peumans WJ (1995) The bark of Robinia pseudoacacia contains a complex
mixture of lectins: characterization of the proteins and the cDNA clones.
Plant Physiol 107: 833–843
Van Damme EJ, Peumans WJ, Barre A, Rouge P (1998) Plant lectins: a
composite of several distinct families of structural and evolutionary
related proteins with diverse biological roles. Crit Rev Plant Sci 17:
575–692
VandenBosch KA, Rodgers LR, Sherrier DJ, Kishinevsky BD (1994) A
peanut nodule lectin in infected cells and in vacuoles and the extracellular matrix of nodule parenchyma. Plant Physiol 104: 327–337
van Rhijn P, Fujishige NA, Lim PO, Hirsch AM (2001) Sugar-binding
activity of pea lectin enhances heterologous infection of transgenic alfalfa
plants by Rhizobium leguminosarum biovar viciae. Plant Physiol 126:
133–144
Vasse J, de Billy F, Camut S, Truchet G (1990) Correlation between ultrastructural differentiation of bacteroids and nitrogen fixation in alfalfa
nodules. J Bacteriol 172: 4295–4306
Wais RJ, Galera C, Oldroyd G, Catoira R, Penmetsa RV, Cook D, Gough
C, Dénarié J, Long SR (2000) Genetic analysis of calcium spiking responses in nodulation mutants of Medicago truncatula. Proc Natl Acad Sci
U S A 97: 13407–13412
Wais RJ, Keating DH, Long SR (2002) Structure-function analysis of Nod
factor-induced root hair calcium spiking in Rhizobium-legume symbiosis.
Plant Physiol 129: 211–224
Ward E, Payne G, Moyer M, Williams S, Dincher S, Sharkey K, Beck J,
Taylor H, Ahlgoy P, Meins F et al. (1991) Differential regulation of
beta-1,3-glucanase messenger-RNAs in response to pathogen infection.
Plant Physiol 96: 390–397
Wells DH, Long SR (2002) The Sinorhizobium meliloti stringent response
affects multiple aspects of symbiosis. Mol Microbiol 43: 1115–1127
Yang C, Singer ER, Hirsch AM (1992) Nodules initiated by Rhizobium
meliloti exopolysaccharide mutants lack a discrete, persistent nodule
meristem. Plant Physiol 98: 143–151
Downloaded from on June 15, 2017 - Published by www.plantphysiol.org
Copyright © 2004 American Society of Plant Biologists. All rights reserved.
Plant Physiol. Vol. 134, 2004