volume 16 Number 11 1988
Nucleic Acids Research
Mkrodeletion associated with the integration process of hepatitis B virus DNA
Takaaki Nakamura, Takashi Tokino, Tsutomu Nagaya + and Kenichi Matsubara*
Institute for Molecular and Cellular Biology, Osaka University, Yamada-oka, Suita, Osaka 565, Japan
Received March 9, 1988; Revised and Accepted May 4, 1988
ABSTRACT
Hepatitis B vinos (HBV) DNA is often found in integrated form in
hepatocellular carcinomas (HCC) and in non-cancerous liver cells of chronic
carriers of HBV. However, the process of integration has not been well
understood. Analyses of integrant DNA was expected to give clues. However, the
majority of the integrants are products of multistep rearrangements following
integrations, and analysis of randomly selected samples do not give clues for
understanding the process of primary integrant formation. Therefore, one must
select an appropriate integrants) that has a simple structure. We surveyed a
collection of integrants prepared from many HCC's, and found one integrant that
has the simplest structure so far studied: The viral genome is almost complete, is
joined to cellular DNA using the cohesive end of the viral DNA, and furthermore,
the "left" and "right" flanking cellular DNA's are almost contiguous. Analysis of
the unoccupied sites in cellular DNA showed that, although almost contiguous, it
has generated a microdeletion (15 base pairs) in the target sequence. This target
sequence has a short region of homology to the sequence in the viral genome
located close to the junction. One integrant with strikingly similar features has
been reported independently. Two similar, but not identical cases from literatures
could be added to this category. Therefore, the integrants with these properties
may represent a unique category among those prepared from hepatocellular
carcinomas.
Based on these findings, we propose that this integrant represents the
primary product of integration, and discuss the intermediate acting in the process
of integration.
INTRODUCTION
Hepatitis B virus (HBV) is shown epidemiologically as a causative agent for
hepatocellular carcinoma (HCC) (1). The finding that HBV DNA is integrated in
many HCC's has raised much interest in the studies on the process of HBV DNA
integration and its subsequent effect on the induction of HCC (2). Because the
integration process can not be reproduced in cultured cells, attempts have been
madetoobtain insights into this problem by analyzing the integrants in HCC's (3,
4, 5, 6, 7, 8, 9, 10, 11). However, the results and models derived in different
research groups differed from each other, because many integrants are complex in
structure, reflecting the different process of their formation and multiple stages of
© IRL Press Limited, Oxford, England.
4865
Nucleic Acids Research
rearrangements (5, 7, 8, 12). Apparently, an appropriate integrants) must be
selected with which one can infer the integration process.
To select such integrants, two criteria must be met (i) The integrant
structure, of necessity, should be simple, (ii) The integrant should not be an
isolated case, but integrants with the similar structure should be found in multiple
members of HCC. We surveyed nineteen integrants obtained in our laboratory as
prepared from seven different HCC's (3) and looked for those that have the
simplest structure. The criteria for the "simple structure" was that the integrated
viral genome, as well as the flanking cellular DNA's, was not in rearranged form
or was not associated with large deletions. Absence of a large deletion could be an
unjustified criteria, but this was unavoidable for practical purposes in the
selection of candidates. We also took into account our previous inference (3, 9,13)
that the cohesive end region of the viral genome may be used in production of
primary integrants (3).
We found one integrant that meets these criteria. This paper reports the
structure of this integrant, and that of the unoccupied site of the cellular DNA
sequence used as a target for integration.
The results, compared with three reported cases (13, 14, 15) showed that
these integrants share the same basic features, indicating that they constitute a
unique category among the integrants. Based on these findings, we proposed a
model to account for the integration process of HBV DNA into liver cell
chromosomes.
MATERIALS AND METHODS
The integrant clone
The clone pY has been reported elsewhere (3).
Southern analyses
Restriction endonuclease fragments with unique cellular DNA sequences
were extracted from the "left" and "right" flanking cellular sequences of the
integrated clone pY (see Fig. 1A), and used as "left" and "right" probes for
Southern hybridization (16).
Cloning and analysis of cellular counterpart DNA sequences
A cosmid library was prepared from human leukocyte DNA partially
digested with Mbol (17). This library was screened by the left and the right probes
described above to isolate the cellular counterpart fragments covering the HBV
integration site. The fragment thus obtained was recloned into plasmid pBR325,
named pNY, and its sequence was analyzed as according to Sanger (18).
4866
Nucleic Acids Research
RESULTS AND DISCUSSION
HBV integration site in clone pY
The structure of an integrant clone pY is shown in Fig. 1 A. The viral insert
is 3.1 kb DNA of continuous subgenomic fragment that covers the genes C, S and
X. The left border, position 1822 lies 2 bp away from the DR1, that serves as a
specific site for initiation and termination of viral DNA and RNA syntheses (19,
20). Therightborder, position 1708, lies in the X gene.
To examine the structure of the cellular DNA in this integrant, we isolated
restriction fragments of cellular DNA containing unique sequences from the "left"
and the "right" flunking sequences of the integrant viral DNA. These DNA
fragments termed left and right probes were used as labeled probes in Southern
analyses. Fig. 2 shows the results of such analyses with human leukocyte DNA,
digested with different restriction enzymes. Both probes hybridized to one and the
same HindUl genomic DNA fragment, indicating that they lie very close together
in the unoccupied genome. The L and R probes did not hybridize to one DNA
fragment in other restriction digests, as there is more than one cleavage site for
such enzymes in between the L and R probe sites. We, therefore, cloned the
corresponding DNA fragment from a cosmid library, and recloned it into pBR325
for further analyses. This plasmid was designated pNY, whose restriction map is
HBV
lA)
DBl C
O—*•
H^Q G
X
9^_g
BCE
B
0
B
H
(B)
pNY
integration sita
Fig. l
Restriction map of the integrated HBV DNA and its flanking cellular
sequences in the clone pY (A), and that of the corresponding cellular sequence
around the unoccupied site (B). The open horizontal arrow denotes the HBV DNA
pointing the direction of its transcription. The thin line represents the flanking
cellular DNA. The open bars denote the unique cellular sequences used as the left
(L) and the right (R) probes for Southern analyses. The map of the partial HBV
genome is also displayed to demonstrate the location of the viral genes. C, HBcAg;
S, HBsAg; X, X gene. Restriction sites are : £coRI (E), flamHI (B), Bgltt (G),
Hindm (H), and Xhol (X). DR1 denotes the 11-base pair direct repeat sequence
that acts as a signal for transcription and replication (19, 20). The vertical arrow
in B represents the site of the viral DNA integration.
4867
Nucleic Acids Research
kb
L probe
E B G H
23.19.4 —
6.6 —
23.19.46.6-
—
#
4.4_
4.4 —
2.3 2.0-
kb
R probe
E B G H
1
'
#
2.32.0-
ft
Fig. 2
Southern blots of unoccupied cellular DNA using the left and right flanking
cellular sequences from an integrant as probes. Digests of normal human
leukocyte DNA by restriction enzymes as shown were electrophoresed and blotted
onto nitrocellulose filters and hybridized to the left (L) and the right (R) probes
prepared from the flanking sequence of the integrant clonejpY. The following
restriction enzymes were used: EcoBI (E), BaniSl (B), BgUI (G), and Hindm (H).
Numerals show the size of reference DNA fragments.
shown in Fig. IB. Comparison of this map with that of pY shows that the HBV
integration did not cause major rearrangements in the cellular sequence.
Nucleotide sequences at the unoccupied sites
To see the effect of HBV integration on cellular DNA, the sequence of the
flanking cellular DNA around the junction of the integrated HBV DNA in pY was
compared with that of the unoccupied cellular counterpart DNA in pNY. Fig. 3
shows that the sequence of the flanking cellular DNA is identical to that of the
unoccupied cellular DNA, except that it has a 15 bp (underlined) deletion at the
viral insertion site. This microdeletion may have been formed in association with
the HBV integration. No extensive homology was found between the HBV and
cellular DNA sequences, but we noticed a short (5 bp) sequence CCTCT being
shared between the viral DNA located close to the left junction and the deleted
portion of the cellular DNA. We also noticed a 3 bp sequence (TAA) at the right
junction homologous to the deleted portion of the cellular DNA (Fig. 4B).
A single nucleotide change, T to A, is observed in the pY at its 3' end (Fig. 3).
4868
Nucleic Acids Research
1S32
1708
HBV
CCATGCAACTTTTTCACCTCTGC
ATACTTCAAAGACTGT
pY
GTAQTTCCCqrTTTCACCTCTGC
ATACTfoTGATTTQTA
pNY
GTAGTTCC^AAATTCCTCTTGTTATTGATTTGTA
Fig. 3
DNA sequences around the HBV integration site. The sequences around the
left and right viral-cellular junctions in pY^are compared with the HBV sequence
(subtype adr, ref. 27, 28) and the unintegrated cellular sequence in the
corresponding region of the normal allele. The nucleotide numbers of the HBV
genome are indicated. The integrant HBV DNA sequence in the pY is boxed. The
deleted cellular sequence in the normal allele is underlined. Snort homologous
sequence that is present both in the viral DNA and in the deleted portion of
cellular DNA is demonstrated by thick bars.
This might reflect the polymorphism, since pY and pNY have been derived from
different individuals. Alternatively, the change might be accompanied with the
HBV integration. A similar one nucleotide substitution has been observed in
another integrant, DTI. These possibilities must be elucidated through collection
of more data (see Fig. 4).
Comparison with reported cases
These findings can be summarized as follows: (i) the "left" and "right"
flanking sequences are essentially contiguous in the normal unoccupied allele
DNA, but the target cellular DNA has generated a microdeletion, 15 bp in size, (ii)
the region of a microdeletion and the region of the viral genome that lies very close
to the viral-cell junction point carry a sequence homology, 5 bp, or 3 bp in size, (iii)
nonrearranged, and nearly the unit length of the viral genome , from DR1 at 5' end
to the gene X at 3' end, was integrated, (iv) at least one (in this case, both) of the
integrant viral DNA ends lies in the cohesive end region of the viral genome.
Upon surveying literatures, we noticed one case reported by Hino (14)
describing an integrant called C3 that has these four featureB in common. The C3
carries nearly the unit length of the viral genome, from the position 1824 on the
DR1 to 1762, almost identical to our case, and it has generated a 6 to 11 bp
microdeletion in the target cellular sequence in which a 5 bp sequence is
homologous to the viral sequence appearing at the junction. The striking
similarity between the pY and C3 leads us to propose that they can not be mere
coincidences of isolated cases among the HBV DNA integrants, but they represent
a unique category. Based on the simplest structures of both the HBV DNA and
cellular DNA in the integrants so far analyzed, we also propose, as noted in the
introduction, that they may represent the primary products of the virus
integration, reflecting the process of integration. The two integrated viral
4869
Nucleic Acids Research
OAGOCATAC^TCATTTOTAO •
TTGATITGTAG •
ATAGCjGATACACCCT •
GATACACCGT-
ACCGCAAATCCJCCOTCCAOTGTA-- CCCTCGAOTOTA-- -
Fig. 4
Four integrants that have the simplest structure, with several unique
properties in common, as gathered from this work and literatures ( ref. 13,14,15 ).
(A) Structures of the integrated HBV genome. Heavy lines and wavy lines
represent, respectively, viral genomes and the flanking cellular sequences. The
two 11-base pair direct repeats (DR1, DR2) are boxed. (B) The sequences around
the cellular-viral junctions in the integrants and those in the target cellular DNA'
s. The nucleotide numbers of the HBV genomes are indicated. The integrated
HBV genomes are boxed. DR1 and DR2 are the 11-base pair direct repeats.
Arrows show the direction of transcription of the viral genome. The
microdeletions in cellular sequences are underlined, and the small homologous
sequences between cellular and viral DNA's are underlined by thick bars and
weavy lines. Asterisks indicate mismatch bases.
genomes look very similar to thereversetranscripts of the pregenome DNA (2,19,
20), from which a region copying the 3' terminal portion of the mRNA or the 5'
portion of the first DNA strand, has been missing. We can speculate that such
DNA molecules, appearing as replicative intermediates, or as dead-end products
duringreplication,may have been used as substrates for integration.
4870
Nucleic Acids Research
Two integrants with similar, but not identical properties have been reported.
Dejean et al (13) found an integrant ADT1 covering 1591 to 2931, about 50% of the
viral genome, and Berger et al (15) found an integrant clone 26 covering 2536 to
1797, about three quarters of the viral genome. Both of these integrants are
associated with microdeletions in the target cellular sequence, 7 to 12 bp and 17
bp, and in both cases, one of the junctions terminates within the cohesive end
region of the viral DNA. Furthermore, in both clones, short homologies are found
between the deleted cellular sequence and the viral sequence that lies close to.or at
the junction (Fig. 4). However, the regions of the viral genome covered by these
two integrants are different from that of pY and C3, viz. they carry only a portion
of the viral genome, whereas the latter two carry almost the entire genome. In
addition, the ends of ADT1 and 26 do not coincide with those in pY and C3. It looks
as though the integration precursors for ADT1 and 26 are the same as those for pY
and C3, only that the former two have lost wider regions from both ends. If so, the
intermediate for the four integration events could have been viral replicative
intermediates that have generated some deletions, large or small, at one end or
both ends. Whether the missing regions have been absent from the beginning, viz.
in the replicative intermediates, or lost during integration is not clear. Other
replicative intermediates can also be imagined, but it seems to be too premature at
this time to further speculate the origin of the intermediates.
The similar features of the four integrants strongly suggests that the process
in which the viral DNA was integrated into cellular DNA was almost identical.
An attractive model would be to assume viral replicative intermediates, with one
of their broken ends in double stranded or in transient single stranded form, or one
end still attached to a protein (21) invading into cellular DNA carrying out strand
exchange using the short homology sequence. It is well known that illegitimate
recombinations are often associated with some deletion formation (22, 23). Fig. 4
shows that the four integrants carry the short homologous sequence close to,or at
one of the ends. It is likely that such a short homology may have served some role
in strand exchange. The nature and the location of the homologous sequence are
not uniform with these four samples. Thus, further accumulation of data are
awaited before we consider a detailed model to correlate the homology, directions
of strand invasion, and the structure of the substrate for integration. Such a
mechanism is quite different from that acting in retrovirus integration where the
direct repeat (in this case LTR) sequences are employed, giving rise to duplication
of the target cellular sequence (24,25).
Yaginuma et al (9) found an integrant whrerein the HBV DNA is flanked by
directly repeating DNA's derived from the host target sequence. No deletion in
4871
Nucleic Acids Research
cellular DNA was found in this case. They claimed, based on this finding, that the
HBV genome may be integrated by a mechanism similar to that acting in
integration of retrovirus (24). However, this case seems to be an exceptional one,
because no other case conforming to their model has been found since then.
Yaginuma et al (26) also reported an integrant 1707-1, that is associated
with 16 bp short deletion of the cellular DNA. However, a 5 bp viral sequence was
observed to repeat at both junctions, and no short homology as in the four cases in
Fig.4 was observed. This clone is .therefore, considered to belong to a different
category of integrants.
Many of the clones so far analyzed were found to comprise another category
of integrants wherein the structure of viral DNA, as well as cellular DNA, show
signs of complex rearrangements. Such rearrangements include chromosome
translocations, amplification of the integrated viral genome followed by their
transpositions along with the joined cellular DNA, and large deletions incurred
within the host chromosomes. We are tempted to hypothesize that such complex
integrants may have been formed from the simple primary integrants by
subsequent DNA,rearrangements. Tokino et al (12) have discussed the possibility
that such secondary rearrangement reactions may have been mediated by
transient activation of the cohesive end region in the integrant viral DNA. The
intriguing problems related to HBV replication, integration and subsequent
chromosome rearrangement will be solved in the future by establishing an
appropriate cell line. If secondary rearrangements are in fact frequent events, as
suggested, it would be interesting to know whether there is any correlation
between specific categories of integration and the type of HCC or non-cancerous
chronic carriers.
ACKNOWLEDGMENTS
We thank Dr. Y. Nakamura at Utah University for providing a cosmid library.
This work was supported by a Grant-in-Aid for Special Project Research in CancerBioScience from the Ministry of Education, Science and Culture of Japan.
*To whom correspondence should be addressed
••"Present address: Institute for Bioscience, Nippon Zeon Co., Yako 1-2-1, Kawasaki, 210 Japan
REFERENCES
1. Beasley, RJ5., Lin, C.C., Hwang, L.-Y., and Chin, C. S. (1981) Lancet ii,
1129-1133.
2. Tiollais, P., Pourcel, C. and Deiean, A. (1985) Nature 317,489-495.
3. Nagaya, T., Nakamura, T., Tokino, T., Tsurimoto, T., Imai, M., Mayumi, T.,
4872
Nucleic Acids Research
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26
27.
28.
Kamino, K., Yamamura, K., and Matsubara, K. (1987) Genes and
Development 1,773-782.
Dejean, A., Sonigo, P., Wain-Hobson, S., and Tiollais, P. (1984) Proc. Natl.
Acad.Sci. 81,5350-5354.
ffino, O., Shows, T. B., and Rogler, C. E. (1986) Proc. Natl. Acad. Sci. 83,
8338-8342.
Koch, S., Freytag von Loringhoven, A., Kahman, R., Hofscheider, P. H. and
Koshy, R. (1986) Nucl. Acids Res. 12, (17) 6871-6886.
Mizusawa, H., Taira, M., Yaginuma, K., Kobayashi, M., Yoshida, E., and
Koike, K. (1985) Proc. Natl. Acad. Sci. 82,208-212.
Rogler, C. E., Sherman, M., Su, C. Y., Shafritz, D. A. Summers, J., Shows, T.
B. Henderson, A., and Kews, M. (1985) Science 230,319-322.
Yaginuma, K., Kobayashi, M., Yoshida, E., and Koike, K. (1985) Proc. Natl.
Acad. Sci. 82,4458-4462.
Ziemer, M., Garcia, P., Shaul, Y., and Rutter, W. J. (1985) J. Virol. 53,885892.
Shih, C , Burke, K., Chou, M.^J., Zeldis, J. B., Yang, C.-S., Lee, C.-S.,
Isselbacher, K J., Wands, J.R. and Goodman, H. M. (1987) J. Virol. 61,34913498.
Tokino, T., Fukushige, S., Nakamura, T., Nagaya, T., Murotsu, T., Shiga, K.,
Aoki, N., and Matsubara, K. (1987) J. Virol. 61,3848-3854.
Dejean, A., Bougueleret, L., Grzescbik, K. H., and Tiollais, P. (1986) Nature.
322, 70-72.
Hino, O. (1986) KAN. TAN. SUI. (Japan) 13,455^161 (in Japanese).
Berger, I. and Shaul, Y. (1987) J. Virol. 61,1180-1186.
Southern, E. M. (1975) J. Mol. Biol. 98,503-517.
Collins, J. and Hohn, B. (1978) Proc. Natl. Acad. Sci. 75,4242^246.
Sanger, F., Nicklen, S., and Coulson. A. R. (1977) Proc. Natl. Acad. Sci. 74,
5463-5467.
Seeger, C , Ganem, D. and Varmus, H. E. (1986) Science 232,477-484.
Will, H., Reiser, W., Weimer, T., PfafT, M., Buescher, M., Sprengel, R.,
Catteneo, R. and Schaller, H. (1987) J. Virol. 61,904-911.
Gerlich, W. H. and Robinson, W. S. (1980) Cell 21,801-809.
Szostak, J. W., Orr-Weaver, T. L. and Rothstein, R. J. (1983) Cell 33,25-35.
Klar, A. J. S. and Strathern, J. N. (eds) (1984) Cold Spring Harbor Symp.
Quant Biol. 49.
Varmus, H. and Swanstrom, R. (1985) Replication of retroviruses. In
Weiss.R. (ed.), RNA tumor virus, pp.75-134. Cold Spring Harbor Laboratory,
Cold Spring Harbor, N. Y.
Panganibian, A. T. (1985) Cell 42,5-6.
Yaginuma, K., Kobayashi, H., Kobayashi, M., Morishima, T., Matsuyama,
K. and Koike, K. (1987) J. Virol. 61,1808-1813.
Fujiyama, A., Miyanohara, A., Nozaki, C , Yoneyama, T. Ohtomo, N. and
Matsubara, K. (1983) Nucl. Acids Res. 11 (13), 4601-4610.
Ohno, Y., Onda, H., Sasada, R., Igarashi, K. Sugino, Y. and Nishioka, K.
(1983) Nucl. Acids Res. 11 (6), 1747-1757.
4873