Identification of a Second Group of Type I
IFNs in Fish Sheds Light on IFN Evolution in
Vertebrates
This information is current as
of June 15, 2017.
Jun Zou, Carolina Tafalla, Jonathan Truckle and Chris J.
Secombes
J Immunol 2007; 179:3859-3871; ;
doi: 10.4049/jimmunol.179.6.3859
http://www.jimmunol.org/content/179/6/3859
Subscription
Permissions
Email Alerts
This article cites 38 articles, 13 of which you can access for free at:
http://www.jimmunol.org/content/179/6/3859.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2007 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
References
The Journal of Immunology
Identification of a Second Group of Type I IFNs in Fish Sheds
Light on IFN Evolution in Vertebrates1
Jun Zou,2* Carolina Tafalla,† Jonathan Truckle,* and Chris J. Secombes*
I
n eutherian mammals, type I IFNs comprise seven major homologous subgroups including IFN-␣, -␤, -␦, -␧, -␬, -␶, and
-␻ and are the key cytokines orchestrating host antiviral defense and other physiological processes (1). Not all subgroups exist in all eutherian mammals, as with IFN-␶ which is found in
ruminants and IFN-␦ which has been discovered only in pigs to
date (2). With the exception of IFN-␦, each of these IFNs are
encoded by multiple gene families, at least in some species (2). For
example, the IFN-␣ subfamily contains some 13 genes in humans
and mice (3), whereas duplicated IFN-␤ genes are known in cattle
(4). It has not been fully established why so many IFNs are needed.
Emerging evidence in mammals indicates at least some of the IFN
isoforms are involved in physiological processes such as reproduction and development in addition to immune responses (5).
Unique expression patterns are also observed in tissues or cells for
individual IFNs, indicating expression is differentially regulated. A
subpopulation of the dendritic cells, plasmacytoid dendritic cells,
is capable of producing ⬎100-fold higher amounts of IFN-␣ relative to other cell types, although the isoforms have yet to be
identified, and appear to be the main source of circulating IFNs (6).
Some of the IFN-␣ isoforms are synthesized immediately after
induction or viral infection, whereas others are synthesized at a
later stage (7). In ruminants, IFN-␶, also designated as tropho-
*Scottish Fish Immunology Research Centre, School of Biological Sciences, University of Aberdeen, Aberdeen, United Kingdom; and †Centro de Investigacion en
Sanidad Animal (CISA-INIA), Valdeolmos, Madrid, Spain
Received for publication February 22, 2007. Accepted for publication June 25, 2007.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by an European Community-funded IMAQUANIM
project (Contract 007103).
2
Address correspondence and reprint requests to Dr. Jun Zou, Scottish Fish Immunology Research Centre, School of Biological Sciences, University of Aberdeen, Aberdeen, United Kingdom. E-mail address: [email protected]
Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00
www.jimmunol.org
blast IFN, is temporally synthesized in fetuses during ruminant
pregnancy and is involved in the maternal recognition of pregnancy (5). The IFN-␶ is not induced by viral infection; however,
it possesses antiviral activity, although weaker than other type
I IFN counterparts.
All of these type I IFN genes do not contain introns and are
closely clustered in the same chromosome (8 –10). Also, they all
share a common receptor consisting of a heterodimer of IFNR1
and IFNR2, although sequence homology between the two chains
is rather limited. It has been suggested by evolutionary analysis
that IFN-␣ and IFN-␤ diverged ⬃130 million years ago (2), with
subsequent numerous rounds of gene duplications within mammals resulting in the other isoforms such as IFN-␦, -␧, -␬, -␶, and
-␻. These intronless genes are believed to have arisen from an
ancestor gene shared by structurally related cytokine genes IL-10
and IFN-␭, which possess 5 exons and 4 introns (11). Strong evidence supporting this hypothesis has come from recent studies
confirming that fish type I IFN genes not only contain introns but
also possess the same genomic gene structure seen in IL-10 and
IFN-␭ genes (12). It is generally believed that a retroposition event
led to the emergence of the intronless IFN genes at some point
before the divergence of birds and mammals, because birds also
possess intronless type I IFN genes (13).
Type I IFN-like genes are now sequenced in several fish species
including zebrafish (Danio rerio; Ref. 14), catfish (Ictalurus punctatus; Ref. 15), Atlantic salmon (Salmo salar; Ref. 16), and the
pufferfish (Takifugu rubripes; Ref. 17). In general, they are 175–
194 aa long with a typical hydrophobic signal peptide except for
one of the reported catfish IFN molecules (15). Functional studies
have demonstrated that fish IFNs are capable of inducing expression of the anti-viral protein Mx and exhibit antiviral activities.
However, fish type I IFNs share limited sequence homology with
their counterparts in birds and mammals. For example, zebrafish
IFN has 34 –39% similarity with avian and mammalian IFN-␣ and
IFN-␤. Multiple copies of IFN genes have been suggested by
Southern blot analysis in catfish (15) and, more recently, duplicated genes have been shown to be tandemly linked within a
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
In this report, three type I IFN genes were identified in rainbow trout (rt) Oncorhynchus mykiss and are classified into two groups
based on their primary protein sequences: group I containing two cysteine residues; and group II containing four cysteines
residues. The group I rtIFNs were induced in fibroblasts (RTG-2 cells), macrophages (RTS-11 cells), and head kidney leukocytes
when stimulated with polyinosinic:polycytidylic acid, whereas group II IFN was up-regulated in head kidney leukocytes but not
in RTG-2 and RTS-11 cells. Recombinant group I rtIFNs were potent at inducing Mx expression and eliciting antiviral responses,
whereas recombinant group II rtIFN was poor in these activities. That two subgroups of type I IFN exist in trout prompted a
survey of the genomes of several fish species, including zebrafish, medaka, threespine stickleback and fugu, the amphibian Xenopus
tropicalis, the monotreme platypus and the marsupial opossum, to gain further insight into possible IFN evolution. Analysis of the
sequences confirmed that the new IFN subgroup found in trout (group II IFN) exists in other fish species but was not universally
present in fish. The IFN genes in amphibians were shown for the first time to contain introns and to conserve the four cysteine
structure found in all type I IFNs except IFN-␤␧ and fish group I IFN. The data overall support the concept that different
vertebrate groups have independently expanded their IFN types, with deletion of different pairs of cysteines apparent in fish group
I IFN and IFN-␤␧ of mammals. The Journal of Immunology, 2007, 179: 3859 –3871.
3860
EVOLUTION OF TYPE I IFNs
Table I. Primer sequences and use
Sequence (5⬘-3⬘)
Adaptor oligo(dT)
Adaptor
Oligo(dG)
FISH-F1
IFN-F5
IFN-R1
IFN-R3
IFN-R6
IFN2-F1
IFN2-F2
IFN2-RF1
IFN2-RR1
IFN3-F4
IFN3-R1
IFN3-R2
IFN3-R3
GAP-EF2
GAP-ER2
IFN1-EF2
IFN1-ER2
IFN2-EF2
IFN2-ER2
IFN3-EF2
IFN3-ER2
Mx-EF1
Mx-ER1
IFN1-RF1
IFN1-RR1
IFN2-RF2
IFN2-RR2
IFN3-RF1
IFN3-RR1
GGCCACGCGTCGACTAGTAC(dT)17
GGCCACGCGTCGACTAGTAC
GGGGGGIGGGIIGGGIIG
TACAGTGCTGAGGCGTGGGAG
CTACGGAACAACATTTCGGAC
AGACCGGCAATACAGTTCAG
AACTGGTAAGGGCGTAGCTTC
TCTTTCCCGATGAGCTCCCA
CGAGTTTGAGGACAAAGTCAG
GGAATAGGAATAGGAAGTCAG
ATGCAGAGCGTGTGTCATTGC
TCAGTACATCTGTGCCGCAAG
ACATGGCTGTATTGAAATGG
GTCAATCGAGCAGCCGAACAG
CTTTCGCACAATCTCCCATG
TCCAGAGGATTCCCAAACAC
ATGTCAGACCTCTGTGTTG
TCCTCGATGCCGAAGTTGTC
AATTCCTGTGTATCACCTGCCA
GATGATCAGTACATCTGTCTG
AGTTCCTGTGTATCACCTGTCG
GATGCTCAGTACATCTGTCCCA
CTTAGAGTTATGTGTCGTAGG
ATGTGGTTCTCCTCACGGCTTG
CCTCCTGAAATCAGCGAAGACA
GAGTCTGAAGCATCTCCCTCTG
CGGATCCTGTGACTGGATTCGACACCACTA
CAAGCTTATGATCAGTACATCT
CGCATGCTGTGACTGGATCCAACACCACTT
CAAGCTTATGCTCAGTACATCTGTCCCA
TTGCAGGTGGACGCAGTTTAGGGGATCC
TAAGCTTTCATCACGGCTTGACTCTG
6.0-kb region in a head-to-tail manner in the fugu genome (17). In
Atlantic salmon, two IFN cDNA variants with 95.4% identity have
also been reported, and recent evidence has shown they are encoded by two distinct genes (16, 18). To date, the genes found in
fish all appear to be related to a single group of IFNs, which differ
from other known IFN proteins in containing two cysteine residues
rather than the four seen in avian IFNs and mammalian IFN-␣, -␦,
-␧, -␬, -␶, and -␻ and different to the two cysteines seen in mammalian IFN-␤, making evolutionary relationships difficult to
interpret.
In this study, three cDNA variant transcripts of type I IFN like
molecules have been cloned and sequenced in rainbow trout Oncorhynchus mykiss, and their corresponding genomic organization
has been determined. They belong to two distinct groups that differ
importantly in the number of cysteines residues they possess, while
retaining the 5 exon-4 intron gene organization. Expression of the
three trout IFN genes was investigated in fibroblast and macrophage cell lines and in primary leukocyte cultures after stimulation
with polyinosinic-polycytidylic acid (poly(I:C))3 and in tissues
from fish challenged with viral hemorrhagic septicemia virus
(VHSV). The effects of the recombinant IFNs on the expression of
the Mx gene, as well as their antiviral activity, were also assessed.
Comparative analysis was performed using the IFN sequences retrieved by informatics analysis of various vertebrate genomes including zebrafish, medaka, threespine stickleback, fugu, Xenopus,
3
Abbreviations used in this paper: poly(I:C), polyinosinic-polycytidylic acid; rtIFN,
rainbow trout IFN; RTG, rainbow trout gonad; EST, expressed sequence tag; UTR,
untranslated region; VHSV, viral hemorrhagic septicemia virus; IPNV, infectious
pancreatic necrosis virus; P/S, 100 ␮g/ml penicillin and 100 U/ml streptomycin; oligo(dT), oligodeoxythymidylate; oligo(dG), oligodeoxyguanylate; rrtIFN, recombinant rtIFN.
Used for
3⬘-RACE
3⬘-RACE
5⬘-RACE
rtIFN1 3⬘-RACE
rtIFN1 genomic cloning
rtIFN1 and rtIFN2 5⬘-RACE
rtIFN2 3⬘-RACE
rtIFN2 genomic cloning
rtIFN3 cDNA and genomic cloning
rtIFN3 5⬘RACE
Expression study
rtIFN1 expression
rtIFN2 expression
rtIFN3 expression
Mx expression
Expression plasmid construction
platypus, and opossum to gain further insight into the evolution of
the IFN gene family.
Materials and Methods
Preparation of primary cultures of leukocytes and maintenance
of cell lines
Rainbow trout (O. mykiss; 100 –200 g) were purchased from a local Scottish fish farm (Almond Bank) and maintained in 1-m-diameter fiberglass
tanks supplied with recirculating freshwater at 9 –12°C. Fish were fed
twice daily with a commercial pelleted trout diet. Fish were anesthetized
with 2-phenoxyethanol (0.05%; Sigma-Aldrich) before injection or sacrifice for tissue collection.
The primary cultures of head kidney leukocytes were prepared as described previously (19). The head kidney tissue was collected under sterile
conditions from freshly killed rainbow trout and gently pushed through a
100-␮m pore size nylon mesh (John Staniar) with ice cold Leibovitz medium (L-15; Invitrogen Life Technologies) containing 2% FCS (SigmaAldrich) and 10 U/ml heparin (Sigma-Aldrich). After a washing with L-15
medium containing 0.1% FCS and 10 U/ml heparin, the cell pellet was
resuspended in L-15 medium containing 0.1% FCS, 100 ␮g/ml penicillin,
and 100 U/ml streptomycin (P/S; Invitrogen Life Technologies) and plated
into 25-cm2 flasks at a concentration of 1 ⫻ 106 cells/flask.
A rainbow trout macrophage-like cell line (RTS-11) was maintained at
20°C in L-15 medium containing 30% FCS and P/S (20). A rainbow trout
fibroblast-like cell line (RTG-2) was maintained at 20°C in L-15 medium
containing 10% FCS and P/S. Cells were passaged to fresh flasks at 80%
confluence and cultured for 2 days before stimulation in the presence
of FCS.
Gene cloning
All PCR products were ligated into pGEM T Easy vector (Progema) at 4°C
overnight, and the ligation reaction was transformed into Escherichia coli
TAM-competent cells (ActifMotif). Positive clones were screened by standard colony PCR and cultured at 37°C overnight in a shaker for plasmid
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Primer Name
The Journal of Immunology
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 1. Multiple alignment of fish
and amphibian IFN protein sequences deduced from their intron containing IFN genes
(A) and comparison of cysteine patterns of
trout IFNs and human type I IFNs and
IFN-␭s (B). Identical amino acids among all
sequences are indicated by an asterisk (ⴱ),
whereas those with high or low similarity are
indicated with a colon (:) and period (.), respectively. The predicted signal peptides are
underlined and potential glycosylation sites
are in bold. Conserved cysteines potentially
forming disulfide bridges are arrowed and
numbered. The cysteines conserved in most
IFN-␭s are shadowed. Exons are separated
by spaces and indicated. Note: medaka IFN
genes lack the third intron as indicated in the
alignment.
3861
3862
preparation. Plasmid DNA was extracted using a Qiagen miniprep kit and
sequenced by MWG-Biotech.
To prepare cDNA templates for IFN cloning, the RTG-2 cells were
stimulated with 50 ␮g/ml poly(I:C) for 4 h at 20°C and harvested for
extraction of total RNA using the RNA-STAT60 reagent (AMS Biotechnology) according to the manufacturer’s instructions. Single-strand cDNA
was synthesized by reverse transcription with oligodeoxythymidylate (oligo(dT))12–18 (Invitrogen Life Technologies) or adaptor-dT primer (Table I)
using Bioscript reverse transcriptase (Bioline), diluted with 10 mM TrisEDTA buffer (10 mM Tris, 1 mM EDTA, pH 8.0; TE) and stored at ⫺20°C
before use. A primer (Fish-F1) encoding the conserved motif region ([YH]
SA[EAG]AWE) of the aligned fish IFN protein sequences and the adaptor
primer (Table I) were used to amplify the 3⬘ end of the trout IFN genes by
PCR under the following conditions: 1 cycle of 94°C for 3 min; 35 cycles
of 94°C for 15 s, 55°C for 15 s, 72°C for 30 s; 1 cycle of 72°C for 5 min.
The first-round PCR products were then reamplified using the same primers and ligated into the pGEM T Easy vector (Promega), and the clones
with inserts were sequenced. After a partial sequence was obtained, the 5⬘
end region of the IFN cDNA was amplified by RACE PCR. Briefly, the
cDNA was synthesized using oligo(dT)12–18 and tailed with dCTP using
TdT (Promega) according to the manufacturer’s instructions and used for
RACE PCR with two pairs of primers R3/oligodeoxyguanylate (oligo(dG))
and R6/oligo(dG) under hot start conditions (Table I). The programs for
both rounds of RACE PCR were: 1 cycle of 94°C for 3 min; 32 cycles of
94°C for 20 s, 62°C for 20 s, and 72°C for 45 s; and 1 cycle of 72°C for
5 min.
Sequencing of the PCR products generated with R6/oligo(dG) revealed
two different sequences, one overlapping the obtained 3⬘ end region of the
trout IFN cDNA (termed rtIFN1) and the other (termed rtIFN2) having
several nucleotide mismatches. To obtain the 3⬘ end region of the rtIFN2
cDNA, primers IFN2-F1 and IFN2-F2 specific to the rtIFN2 gene were
synthesized and used for PCR using the PCR protocol described above.
To search for novel IFN genes, the cloned rtIFN1 and rtIFN2 protein
sequences were used to search the TIGR-expressed sequence tag (EST)
database (www.tigr.org). This identified a novel partial EST sequence (accession number TC83306) with significant homology with the C-terminal
region of IFN-␣ from birds and mammals. This EST contig was compiled
from three EST sequences (GenBank accession numbers CR376285,
BX858275, and CR370794) which were generated from trout testis cDNA
libraries. It also contained multiple ATTTA instability motifs within the
3⬘-untranslated region (UTR), a common feature for most IFN genes. More
importantly, an amino acid motif (CAWE) conserved in higher vertebrate
type I IFNs but not present in the fish IFNs identified to date was also found
at the corresponding region of the EST contig, indicating the EST may
represent a new class of type I IFN in fish in addition to the rtIFN1 and
rtIFN2 genes. This new trout IFN gene was named rtIFN3. Initial attempts
to clone the full length cDNA of this molecule from the RTG-2 cells
stimulated with poly(I:C) failed to generate any product. Subsequently,
leukocytes were freshly isolated from rainbow trout head kidney tissue and
stimulated with 100 ␮g/ml poly(I:C) (Sigma-Aldrich) for 6 h at 20°C.
Total RNA was extracted and the synthesized cDNA used for RACE PCR
using primers IFN3-R2/oligo(dG) and IFN3-R3/oligo(dG) (Table I). This
generated a 425-bp fragment containing a 32-bp 5⬘-UTR and 393-bp coding sequence. The full length cDNA sequence was then confirmed by sequencing the PCR products amplified by primers IFN3-F4 and IFN3-R1
(Table I).
To clone the genomic sequences of the three IFN genes, genomic DNA
was extracted from tail fin tissues using a phenol-chloroform extraction
method. Briefly, trout tail fins were collected and cut into small pieces. The
tissues were lysed in a buffer containing 100 mM Tris-HCl (pH 8.5), 5 mM
EDTA, 0.2% SDS, 200 mM NaCl, and 100 ␮g/ml proteinase K at 50°C for
3–5 h with inversion every half-hour. The DNA lysate was extracted twice
with an equal volume of phenol/chloroform (24:1, v/v; Sigma-Aldrich),
and the aqueous phase was collected. Genomic DNA was then precipitated
with 2 volumes of cold 100% ethanol and washed once with cold 70%
ethanol. The DNA pellet was dried briefly at room temperature and dissolved in TE buffer. For amplification of the genomic sequence of the trout
IFN genes, 0.25 ␮g of genomic DNA were used for hot start PCR under the
following conditions: 1 cycle of 94°C for 3 min; 30 cycles of 94°C for 20 s,
62°C for 20 s, and 72°C for 2 min; and 1 cycle of 72°C for 5 min using a
mixture of BIOTAQ DNA polymerase (Bioline) and Pfu DNA polymerase
(Promega; 25:1, unit/unit). Primers used for genomic PCR were: IFN1-F5/
IFN1-R1 for rtIFN1; IFN2-RF1/RR1 for rtIFN2; and IFN3-F4/IFN3-R1 for
rtIFN3. The PCR products were cloned and sequenced as described
previously.
Sequence analysis
BLAST was used for identification of homologous sequences in the
GenBank databases. A multiple alignment was generated using the
CLUSTAL W program (version 1.83; Ref. 21). A phylogenetic tree was
constructed using the neighbor-joining method within the Mega3 software
program (22). Global comparison of two sequences was performed using
Needleman-Wunsch global alignment (23). The presence or absence of a
signal peptide was predicted using the SignalP program (version 2.0; Ref.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 1. (continued)
EVOLUTION OF TYPE I IFNs
The Journal of Immunology
3863
Table II. Features of rainbow trout IFN genes and deduced proteins
cDNA
Genomic
Mature
5⬘-UTR
Coding
3⬘-UTR ATTTA Length
Intron Precursor
Accession No.
(aa)
Peptide (aa)
(bp)
region (bp)
(bp)
motif
(bp) Exons Introns phase
rtIFN1 AJ580911
AM489415
rtIFN2 AJ582754
AM489416
rtIFN3 AM235738
AM489417
427
528
269
4
3,613
5
4
0
36
534
340
3
5,610
5
4
0
32
555
232
7
2,022
5
4
0
IFN expression in rainbow trout
For in vitro expression studies of the three trout IFN genes, RTG-2 cells or
head kidney leukocytes isolated from rainbow trout were stimulated for 4 h
with 0.1, 1, 10, and 100 ␮g/ml poly(I:C). Total RNA was extracted using
the RNA-STAT60 reagent (AMS Biotechnology (Europe)) according to
the manufacturer’s instructions. The first-strand cDNA was synthesized
using oligo(dT)12–18 primer (Invitrogen Life Technologies) and Bioscriptase (Bioline). The cDNA samples were diluted with TE buffer and
used for PCR. Expression of the housekeeping gene, GAPDH, was measured by PCR using primers GAP-EF2 and GAP-ER2 and used as an
internal control, to allow equal amounts of template to be used for detecting
IFN expression. The IFN primers used for expression studies are listed in
Table I. The PCR program was as follows: 1 cycle of 94°C for 3 min;
25–38 cycles of 94°C for 15 s, 62°C for 15 s, and 72°C for 20 s; followed
by a cycle of 72°C for 5 min.
To examine where the rtIFN genes are expressed in vivo, tissues including brain, gill, gut, kidney, liver muscle, skin, spleen, and ovary were
taken from two healthy female fish for RNA extraction. Testis was taken
from two male fish. RT-PCR was then performed to determine the tissue
distribution of rtIFN gene expression as described previously.
IFN expression in vivo after VHSV infection
VHSV (strain 0771), an enveloped double-stranded RNA virus belonging
to the rhabdovirus family, was propagated in an epithelioma papulosum
cyprinid cell line (25). Cells were cultured at 18°C in L-15 medium supplemented with 10% FCS, containing P/S. Virus was inoculated on epithelioma papulosum cyprinid cells in L-15 plus P/S and 2% FCS at 14°C.
When the cytopathic effect was extensive, the supernatant was harvested
and centrifuged to eliminate cell debris. Clarified supernatants were used
for the experiments.
For in vivo challenge, rainbow trout of ⬃8 –10 cm (9 –12 g, 7 mo old)
were obtained from Centro de Acuicultura El Molino (Madrid, Spain),
located in a VHSV- and infectious pancreatic necrosis virus-free zone. Fish
were maintained at the Centro de Investigaciones en Sanidad Animal
(CISA-INIA) laboratory at 14°C and fed daily with a commercial diet
(Trouw). Before the challenge experiments, fish were acclimatized to lab-
175
151
17,998
2
1
177
154
18,532
2
3
184
161
18,572
4
1
oratory conditions for 2 wk, and during this period no clinical signs of
disease were observed.
For the challenge with VHSV, trout were divided into 2 groups of 20
fish. One group was infected by i.p. injection with VHSV (100 ␮l of 1 ⫻
107 TCID50/ml per fish). The other group was mock-infected with the same
volume of L-15 medium. At days 1, 2, 3, and 7 postinfection, five fish from
each group were killed for collection of head kidney, spleen, and liver
tissue, and RNA was extracted from tissue pools.
Production and purification of recombinant IFNs
The putative mature peptide of the trout IFNs was predicted by the SignalP
program (24) and confirmed by the multiple alignment generated using the
CLUSTAL W program (version 1.83; Ref. 21 and Fig. 1A). The cDNA
fragments encoding the putative mature peptide of rtIFN1 and rtIFN3 were
inserted into the pQE30 expression vector (Qiagen) at the restriction enzyme sites of BamHI and HindIII, respectively, and the cDNA fragment
encoding the putative mature rtIFN2 peptide was cloned into the pQE30
vector at the restriction enzyme sites of SphI and HindIII due to the presence of an internal BamHI site in the sequence. The resultant plasmids were
termed pQE30-rtIFN1, pQE30-rtIFN2 and and pQE30-rtIFN3, respectively, and were sequenced to verify the reading frame. The N terminus of
all three recombinant proteins contained a 6-histidine tag, and the N-terminal sequences were as follows: MRGSHHHHHHGS(6His-tag)-CDW
for rtIFN1; MRGSHHHHHHGSAC(6His-tag)-CDW for rtIFN2; and
MRGSHHHHHHGS(6His-tag)-CRW for rtIFN3. To allow expression of
soluble proteins, the pQE30-IFN plasmids were retransformed into E. coli
M15 cells (Qiagen). Induction and purification of the recombinant proteins
under native conditions were performed as described previously (26). To
eliminate the potential contamination of bacterial endotoxins such as LPS
during protein preparation, the purified recombinant protein was loaded
onto a polymyxin B column (Sigma-Aldrich) and the flow-through fraction
collected. The protein samples were stored at ⫺80°C before use. Purity of
the recombinant proteins was checked on a 4 –12% precast SDS-PAGE gel
(Invitrogen Life Technologies) stained with Brilliant Blue G (SigmaAldrich) and concentration measured by comparing the protein band density with a standard protein (trypsin inhibitor; Sigma-Aldrich) in the same
SDS-PAGE gel using an Ultra Violet Products gel imaging system and
Ultra Violet Products gelworks ID advanced software.
Biological activities of rIFNs
Biological activities of the recombinant rtIFNs (rrtIFN1, 2, and 3) were
tested in the trout RTG-2 cells, RTS-11 cells, and head kidney primary
cultures where Mx gene expression was analyzed after stimulation. The Mx
gene is up-regulated by type I IFNs and was used here as a marker gene to
assess the biological activity of the recombinant trout IFNs. The RTG-2
cells were passaged into 25-cm2 flasks and cultured at 20°C. When the cells
reached 80% confluence (⬃2 days), the culture medium was removed, and
fresh medium added into the flasks. Before IFN stimulation, cycloheximide
Table III. Homology of trout IFNs with other known fish type I IFNs
rtIFN1
rtIFN2
rtIFN3
Salmon
IFN1
Salmon
IFN2
Fugu
IFN
Tetraodon
IFN
Catfish
IFN1
Catfish
IFN2
Goldfish
IFN
Zebrafish
IFN1
Zebrafish
IFN2
Zebrafish
IFN3
94.3
90.4
51.6
94.9
91
50.5
56.7
56.7
52.7
57.4
57.6
50.5
51.4
52.5
40.8
50.0
52.1
42.8
59.4
61.7
48.4
57.5
58.7
52.7
45.6
45.6
51.1
50
46.7
50
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
24). The theoretical molecular mass of the proteins was calculated using
the tools listed on www.expasy.ch/tools.
The IFN contig sequences were retrieved by BLAST analysis from the
genome databases for zebrafish (D. rerio), medaka (Oryzias latipes),
threespine stickleback (Gasterosteus aculeatus), fugu (T. rubripes), African frog (Xenopus tropicalis), platypus (Ornithorhynchus ananitus, and
opossum (Monodelphis domestica); see www.ensembl.org. The putative
IFN contig sequences were scanned for IFN sequences using
GenScan (http://genes.mit.edu/GENSCAN.html). The predicted IFN sequences were deposited in the GenBank/EMBL database as third-party
annotated sequences.
Molecular
Mass
Glycosylation
(Da)
Cysteines
Sites
3864
EVOLUTION OF TYPE I IFNs
Table IV. Homology of trout IFNs with type I IFNs, IFN-␭, and IL-10
rtIFN1
rtIFN2
rtIFN3
IFN-␣
IFN-␤
IFN-␬
IFN-␶
IFN-␻
Overall Type I
IFN-␭
IL-10
40.4 ⫾ 2.3
39.4 ⫾ 3.5
46.1 ⫾ 4.1
42.1 ⫾ 2.4
42.2 ⫾ 2.3
45.7 ⫾ 2.7
41.6 ⫾ 0.1
41.1 ⫾ 0.6
43.6 ⫾ 2.5
41.4 ⫾ 1.6
43.4 ⫾ 3.1
48.2 ⫾ 2.9
41.3 ⫾ 1.7
43.4 ⫾ 1.0
49.7 ⫾ 4.9
40.9 ⫾ 2.0
43.1 ⫾ 2.7
46.9 ⫾ 3.6
37.1 ⫾ 1.0
36.3 ⫾ 1.2
36.5 ⫾ 3.5
41.0 ⫾ 2.6
39.8 ⫾ 2.7
38.9 ⫾ 1.5
Results
Cloning of trout IFN genes
Three trout IFN genes (rtIFN1, rtIFN2, and rtIFN3) have been
identified in this study, and features of the nucleotide and deduced
amino acid sequences are described in Table II. They share some
common features: 1) they encode peptides with similar length and
a predicted signal peptide; 2) the putative mature peptides contain
glycosylation sites; 3) the genomic gene contains 5 exons and 4
introns; and 4) multiple ATTTA instability motifs are present in
the AT-rich 3⬘-UTR. Compared with the rtIFN2 and rtIFN3 molecules, the rtIFN1 gene has an unexpectedly long 5⬘-UTR region
where 7 start codons (ATG) are present, all of which have a downstream in-frame stop codon. The rtIFN1 and rtIFN2 share significant homology: 82.0% identity at the nucleotide level for the coding region; and 88.8% similarity at the protein level. However,
they have rather limited homology with rtIFN3, 51.1 and 48.9% at
the protein level, respectively, suggesting that they belong to two
different subgroups. Furthermore, the rtIFN3 molecule possesses
four cyteines in the mature peptide, potentially forming two disulfide bridges to stabilize its structure, whereas in the rtIFN1 and
rtIFN2 peptides only two cysteines are present as in other fish IFNs
known to date. As a consequence of the presence or absence of
these cysteines, a conserved CAWE motif at the C-terminal region
of the higher vertebrate type I IFNs is apparent in rtIFN3 but absent in the other two trout IFNs.
Homology analysis of the trout IFN proteins with different
classes of type I IFNs, IFN-␭s and IL-10s is summarized in Tables
III and IV. Within the salmonids, the rtIFN1 has ⬃94% similarity
with the two IFNs cloned previously in Atlantic salmon, and the
rtIFN2 has a slightly lower similarity of ⬃91%, indicating they are
closely related homologs. Conversely, rtIFN3 shares much lower
similarity (⬃51%) with the salmon IFNs and perhaps represents a
new class of IFN in trout (designated as group II). Comparison of
Table V. Summary of type I IFN genes in nonmammalian species, platypus, and opossum reported in this study
Animal
No. of Genes Present
Intron Number
Genomic Location
a
Danio rerio
3
4
Chro 3
BX500440
Oncorhynchus mykiss
3
4
Unknown
Oryzias latipes
3
3
Gasterosteus aculeatus
Takifugu rubripes
Xenopus tropicalis
Ornithorhynchus anatinus
3
2
5
6
4
4
4
0
Monodelphis domestica
9
0
BAAF03097565.1
BAAF03125320.1
BAAF03063981.1
AANH01006384.1
Scaffold 134
Scaffold 48
AAPN01027751.1
AAPN01027751.1
AAPN01027751.1
AAPN01027751.1
AAPN01437888.1
AAPN01206298.1
Chro 6
AAFR03027363.1
AAFR03027364.1
AAFR03027366.1
AAFR03027456.1
a
Chro, Chromosome.
Accession Number
AJ544820
BN001102
BN001103
AJ580911
AJ582754
AY788890
AM235738
AM489415-7
BN001095
BN001087
AJ583023
BN001167-171
BN001096-101
BN001104-112
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
was added to the cells to achieve a final concentration of 10 ␮g/ml to
inhibit synthesis of endogenous IFN. After 0.5 h of incubation, the cells
were stimulated with trout IFNs at doses of 0.1, 1, 10, or 100 ng/ml for 6 h
when they were then harvested for RNA extraction. Mx expression was
determined by RT-PCR with primers Mx-EF1 and Mx-ER1 (Table I) using
the PCR conditions for detecting IFN expression except for the cycling
number, which was kept at 32.
Antiviral activities of the recombinant IFNs were tested in the RTG-2
cells. Cells cultured at 18°C in L-15 medium supplemented with 10% FCS
and P/S were trypsinized and plated into 96-well plates. After an overnight
incubation at 18°C, the culture medium was removed, and cells were
treated with 50 ␮l of L-15 plus 2% FCS and P/S containing 1, 10, 50, or
100 ng/ml each rrtIFN. After 4 h of incubation at 18°C, cells were challenged with 50 ␮l of culture medium containing serial VHSV dilutions.
Triplicates were always performed for each viral dilution. After 5–7 days
of incubation at 14°C, the plates were observed under an inverted microscope for cytopathic effects (27). Viral titers were calculated according to
the method of Reed and Muench (28).
To investigate whether rrtIFN1 and rrtIFN3 bind to the same receptor
complex, the RTG-2 cells were incubated with 10 ␮g/ml cycloheximide for
0.5 h and subsequently stimulated with only rrtIFN3 or costimulated with
both rrtIFN1 and rrtIFN3 for 6 h. For rtIFN3 stimulation, cells were incubated with 0.1, 1, 10, and 100 ng/ml rrtIFN3. For costimulation, 2.5 ng/ml
rrtIFN1 and various doses of rrtIFN3 (1, 10, 100, and 300 ng/ml) were
used. The cells were then harvested for RNA extraction, and Mx expression
was determined by RT-PCR with primers Mx-EF1 and Mx-ER1 (Table I)
as described previously.
The Journal of Immunology
3865
the trout group I (rtIFN1 and rtIFN2) and group II (rtIFN3) IFNs
with other known fish IFNs containing two cysteines revealed 50 –
62% and 41–53% similarity, respectively. Similar homology
(50%) was seen within the fish group II IFNs (rtIFN3, and zebrafish IFN2 and 3; see below) which have 4 cysteines in the
mature peptide region. Homology of the two groups of trout IFNs
with mammalian type I IFNs does not vary significantly, ranging
from 39.4 to 50%, whereas homology to the IFN-related cytokines
such as IFN-␭s and IL-10s was 36.3– 41%.
In silico analysis of vertebrate IFN genes
With the knowledge that two groups of IFN exist in trout, we
undertook a comparative study of the IFN family in vertebrates to
establish whether the situation held in other fish species/groups,
to confirm the types of IFN gene(s) present in amphibians, and to
examine the appearance of other subgroups in early mammals. To
this end, the genomes of several fish species, including zebrafish,
medaka, threespine stickleback, pufferfish, and of Xenopus, platypus, and opossum were analyzed by BLAST using known fish or
chicken IFN protein sequences, and the homologous contigs were
retrieved for prediction of IFN transcripts. The transcripts of the
retrieved contigs were predicted using the GenScan program
(http://genes.mit.edu./GENSCAN) and in some cases were edited
manually. The IFN sequences obtained from genome analysis were
deposited as third-party annotated sequences in the GenBank/
EMBL database and are summarized in Table V. In the zebrafish
genome, three copies of IFN genes, including the one reported by
Altmann et al. (14), and two new genes (IFN2 and IFN3) have
been found in chromosome 3 (www.ensembl.org, assembly version 6). In the EMBL nucleotide database, the zebrafish IFN2 and
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 2. Phylogenetic tree analysis of type I IFNs in vertebrates. The IFN precursor sequences were used to construct the phylogenetic tree with the
neighbor-joining method within the Mega3.1 program. The accession numbers of IFN sequences used for phylogenetic tree analysis (excluding those listed
in Table V) are as follows. IFN-␣: human, NP_000596; cow, NP_776510; horse, P05003; mouse, NP_034633; sheep, CAA41790; pig, NP_999558; bat,
BAF37102; wallaby, AAO37656, AAO37657; echidna, AY194919. IFN-␤: human, NM_002176; cow, NM_174350; cat, AB021707; horse, M14546;
mouse, NM_010510; rat, NP_062000; pig, M86762; bat, BAF37103; wallaby, AY165862; echidna, AY194920; IFN-␬, human, NM_020124; mouse,
NM_199157. IFN-␶: cow, AY996048; sheep, DQ149979; goat, AAA30907. IFN-␦: human, P37290. IFN-␻: human, CAH70158; cow, AAG14167; horse,
P05001; dog, XP_538690. IFN-␧: human, NM_176891; mouse, NM_177348; cow, XP_586616; IFN-␭: human, EAW56869, EAW56870, EAW56871;
mouse, AAX58714; rat, XP_001078329; cat, NP_001035770; dog, BAE94318. Avian IFN: goose, AAS57787; duck, P51526; turkey, P51527; quail,
BAD05037; chicken IFNs were retrieved from chicken chromosome Z in the Ensemble genome database (www.ensemble.org).
3866
FIGURE 3. Tissue distribution of IFN genes in healthy fish. Tissues
studied included brain, gill, gut, kidney, liver, muscle, skin, spleen, and
ovary collected from two female fish and testis from two male fish. The
results from one female and one male individual are shown. GAPDH was
amplified as a positive control.
Comparative and phylogenetic analysis
Analysis of all the sequences obtained shows that based on the
cysteine numbers and position in the alignment, the fish IFNs can
be classified into two groups as seen in rainbow trout, group I with
one pair of cysteines (C1/C3) and group II having an extra pair
(C2/C4; Fig. 1), with the presence of C4 contributing to the CAWE
motif as in mammalian IFN-␣ and -␤. Fish group I IFNs were
present in all teleost species examined. whereas group II IFNs
were found in only rainbow trout and zebrafish and perhaps are
limited to particular teleost species. The two cysteines seen in fish
group I IFNs align well and are conserved among teleosts, but the
position of the cysteines is unique and does not match any of the
cysteine arrangements seen in the known subclasses of IFNs in
mammals (Fig. 1B). Mammalian IFN-␤s and IFN-␧s also contain
one pair of cysteines but they are at different locations and equivalent to C2 and C4 of IFN-␣. It has been demonstrated by structural analysis that in human IFN-␣ the four cysteines form two
disulfide bonds, whereas in murine IFN-␤ a single bond is formed
from the two cysteines present (29, 30). In both cases, these disulfide bridges are important to stabilize the molecular structure. In
FIGURE 4. Expression of trout IFN genes in primary cultures of head
kidney leukocytes and fibroblasts (RTG-2 cells), after stimulation with
poly(I:C). The cells were stimulated with different doses of poly(I:C) for
6 h and total RNA was extracted for RT-PCR analysis of gene expression.
GAPDH was amplified as a positive control. Values represent results from
three independent experiments.
contrast, three pairs of cysteines are relatively conserved in most
IFN-␭s, two of the cysteines are at the C-terminal region (data not
shown). The four cysteines seen in fish group II IFNs match well
with those seen in Xenopus except for Xenopus IFN1 and avian
and mammalian type I IFNs except IFN-␤␧s (Fig. 1). Curiously,
despite the presence of C4 in Xenopus IFNs, they lack a CAWE
motif, with various conservative substitutions in the last three
positions.
Phylogenetic tree analysis of the IFN sequences supports fish
IFNs being classified into two distinct groups (Fig. 2). Two major
groups of type I IFNs are also apparent in Xenopus and chicken but
their relationship with mammalian subtypes is not clear, suggesting the IFN proteins diverged into various subtypes after emergence of these vertebrate groups. Within the fish group I IFN,
three main branches representing salmonids, cyprinids, and advanced fish species that belong to the acanthopterygii (medaka,
pufferfish, and threespine stickleback) are obvious. The rtIFN1
has a closer relationship with salmon IFN-␣1 and IFN-␣2 than
with rtIFN2, indicating that the rtIFN1 is an equivalent homolog of the two salmon genes and the rtIFN2 represents a
distinct duplicated gene.
The phylogenetic tree (Fig. 2) also shows that in mammals several major branches exist. The eutherian IFN-␣ branch contains
IFN-␣, -␦, -␶, and -␻. Neighboring this branch is the marsupial
IFN-␣ cluster and the IFN-␬ cluster. The final cluster contains the
monotreme IFN-␣ group, the IFN-␧ group, and the IFN-␤ group,
with this third branch containing the monotreme, marsupial, and
eutherian mammal IFN-␤ genes. This supports the prediction of
previous studies that IFN-␤ and -␬ diverged earlier in evolution
than other mammalian subclasses such as IFN-␦, -␧, -␶, and -␻ (2).
Lastly, inclusion of IFN-␭ in the tree shows that this group of IFNare evolutionary very distant from the type I IFN identified to date.
IFN expression in trout tissues and cells
With multiple IFN genes present in trout, and particularly with the
presence of a newly identified IFN subgroup (rtIFN3), expression
and functional studies were next performed to gain an insight into
how these genes may differ. Ten fish tissues including brain, gill,
gut, kidney, liver, muscle, skin, spleen, ovary, and testis were
examined for rtIFN gene expression (Fig. 3). The expression of
rtIFN1 was not detected in any of the tissues analyzed, whereas
rtIFN2 was constitutively expressed in all. Constitutive expression of rtIFN3 was observed mainly in reproductive organs such
as ovary and testis, although a low level of transcript expression
was detected in brain, gut, muscle, and skin. The rtIFN3 transcript level in ovary and testis was much lower than that of
rtIFN2.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
IFN3 are linked in a tail-to-tail arrangement in a ⬃9.1-kb region in
a single contig (BX005440). Both medaka and threespine stickleback possess three almost identical copies of IFN genes within a
small chromosomal region, 12.0 kb in medaka and 8.3 kb in
threespine stickleback (www.ensembl.org). Fish type I IFN genes
identified to date contain 5 exons and 4 phase 0 introns except for
the medaka IFN genes which contain 4 exons and 3 introns due to
absence of the third intron. Analysis of the Ensemble database
identified 5 copies of Xenopus IFN genes (scaffold 48), which have
the same genomic organization as their fish counterparts. Alignment of the IFN sequences containing introns indicates that the
exon size is generally comparable and the position of the introns is
well conserved (Fig. 1A). Genomes from two mammalian species,
platypus O. ananitus and opossum M. domestica, a monotreme and
marsupial, respectively, were also examined for IFN genes. As
in other mammals, multiple IFN genes lacking introns are present in
both species with 6 copies in platypus and 9 copies in opossum. In
the EMBL WGS database, four of the six platypus genes (IFN1– 4)
are located in one contig (accession number AAPN01027751) and
the other two (IFN5 and IFN6) are located in two separate contigs
under the accession numbers AAPN01027751 and AAPN
01206298. The opossum IFN genes were found in four contigs,
AAFR03027363 (IFN1), AAFR03027366 (IFN2– 6), AAFR0302
7364 (IFN7 and IFN8), and AAFR03027456 (IFN9).
EVOLUTION OF TYPE I IFNs
The Journal of Immunology
3867
FIGURE 5. Expression of trout IFN genes in tissues
after viral challenge. Two groups of rainbow trout
(9 –12 g) were injected i.p. with 100 ␮l of 1 ⫻ 107
TCID50/ml per fish or L-15 medium. At days 1, 2, 3, and
7 postinjection, five fish from each group were killed for
collection of head kidney, spleen, and liver. Tissues
were pooled for extraction of total RNA and RT-PCR
analysis. GAPDH was amplified as a positive control.
pattern of the trout IFN genes was different (Fig. 4). The rtIFN1
was not expressed in control cells and cells stimulated with 0.1
␮g/ml poly(I:C) but was induced after incubation with 1, 10, or 100
␮g/ml poly(I:C), although the IFN1 transcriptional level remained
constant. Similar to that seen in the head kidney cells, rtIFN2 was
constitutively expressed in control RTG-2 cells, but the cells were
more sensitive to poly(I:C) exposure, with 0.1 ␮g/ml having a large
effect on rtIFN2 expression. Surprisingly, the rtIFN3 transcripts were
not detected by RT-PCR in both control and stimulated RTG-2 cells.
The same expression pattern for the three trout IFN genes was also
observed in RTS-11 cells, a macrophage cell line, after stimulation
with poly(I:C) (data not shown).
FIGURE 6. Characterization of biological activities of the recombinant trout IFNs produced in E. coli. A, SDS-PAGE analysis of rrtIFN proteins under
reducing conditions. The rrtIFN proteins were purified from E. coli M15 cells under native conditions. Lanes 1–3, 0.5 ␮g of rrtIFN1, rrtIFN2, and rrtIFN3
respectively. B, Mx expression in RTG-2 cells stimulated with rrtIFNs. The RTG-2 cells were preincubated with 10 ␮g/ml cycloheximide for 0.5 h and then
stimulated with different doses of rrtIFNs for 6 h. Elution buffer used to elute IFN proteins during purification was used as a negative control, with GAPDH
amplified as a positive control. Values are representative of the results from three independent experiments. C, antiviral activities of rrtIFNs. The RTG-2
cells were incubated with varying doses of the rrtIFNs for 4 h and then challenged with VHSV. After 5–7 days, the cells were observed under an inverted
microscope for cytopathic effects and viral titers were calculated according to the method of Reed and Muench (27).
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
To establish expression profiles of the trout IFN genes in vitro,
freshly isolated head kidney cells and RTG-2 cells were treated
with double-stranded poly(I:C) known to be a potent stimulus for
IFNs. In primary cultures of head kidney leukocytes, no expression
was detected for rtIFN1 and rtIFN3 in the control cells or cells
stimulated with low doses (0.1 and 1 ␮g/ml) of poly(I:C), whereas
constitutive expression of the rtIFN2 was observed (Fig. 4). Weak
induction of the rtIFN2 and rtIFN3 was detected after stimulation
with 10 ␮g/ml poly(I:C), whereas stimulation with 100 ␮g/ml
poly(I:C) led to a significant increase of the transcripts for all three
genes, with rtIFN2 being the highest followed by rtIFN3 and
rtIFN1. In RTG-2 cells, a fibroblast-like cell line, the expression
3868
EVOLUTION OF TYPE I IFNs
cells were incubated simultaneously with 2.5 ng/ml rrtIFN1 and
various doses of rrtIFN3 for 6 h (Fig. 7). This experiment showed
that rrtIFN1-induced Mx expression was not decreased by incubation with rrtIFN3, suggesting that rrtIFN3 failed to bind to the
receptor complex used by rrtIFN1.
FIGURE 7. RT-PCR analysis of Mx expression in RTG-2 cells after
costimulation with rrtIFN1 and rrtIFN3 purified under native conditions.
The RTG-2 cells were incubated with 10 ␮g/ml cycloheximide for 0.5 h
and subsequently stimulated with only rrtIFN3 or costimulated with
rrtIFN1 and rrtIFN3 for 6 h. For costimulation, 2.5 ng/ml rrtIFN1 and
various doses of rrtIFN3 (1, 10, 100, and 300 ng/ml) were used. As a
control, cells were stimulated with only rrtIFN3 at doses of 0.1, 1, 10, and
100 ng/ml. The cells were harvested for RNA extraction, and Mx expression was determined by RT-PCR. GAPDH was amplified as a positive
control. EB, Elution buffer.
In vivo IFN expression in response to viral challenge
Biological activities of bacterially expressed recombinant trout
type I IFNs
To test the biological activities of the identified IFN molecules,
rrtIFN proteins were produced in E. coli and purified under native
conditions (Fig. 6A). The three recombinant trout IFNs with a
6-histidine tag at the N terminus migrate at the size of ⬃18 –20
kDa, consistent with the theoretical molecular mass calculated by
PeptideMass program (www.expasy.ch): 19.4 kDa for rrtIFN1;
20.1 kDa for rrtIFN2; and 20.0 kDa for rrtIFN3. The Mx protein,
known to be up-regulated by type I IFNs (14 –16), was studied
initially to determine the activities of the recombinant proteins. To
exclude the interference of endogenous IFN proteins constitutively
produced in the RTG-2 cells, the cells were incubated with medium containing 10 ␮g/ml cycloheximide for 0.5 h before stimulation with the rrtIFNs. Then, in the presence of cycloheximide, the
cells were cultured with the rrtIFNs for 6 h at doses of 0.1, 1, 10,
and 100 ng/ml, respectively. Fig. 6B shows there was a clear dosedependent effect on Mx gene expression after stimulation with the
rrtIFN1 and rrtIFN2. However, rrtIFN3 purified under native conditions was ineffective at up-regulating Mx gene expression at
doses of 0.1, 1, and 10 ng/ml, although at 100 ng/ml the protein
elicited a weak induction. Similar results were found with both
RTS-11 cells and primary cultures of head kidney leukocytes (data
not shown).
The IFN biological activity was studied further in antiviral experiments conducted in RTG-2 cells and showed that both rrtIFN1
and rrtIFN2 were potent in inducing a cellular antiviral state but
that rrtIFN3 had no impact (Fig. 6C). Thus, both rrtIFN1 and
rrtIFN2 resulted in a decrease in the VHSV titer in a dose-dependent manner, whereas rrtIFN3 was not capable of significantly
inhibiting viral replication at the doses used.
A further experiment was performed to investigate whether
rrtIFN1 and rrtIFN3 bind to the same receptor complex. RTG-2
In this report, three type I IFN homologues, belonging to two distinct groups, have been characterized in rainbow trout Oncorhynchus mykiss. All of the genes have a predicted signal peptide, suggesting they are secreted, have a similarly sized mature peptide
(151–161 aa) and a common gene structure of 5 exons and 4 introns. However, the presence/absence of key cysteine residues and
overall homology allow the categorization into the two subgroups,
which expression studies confirm are different in terms of the cells
and tissues the produce them. The trout group I IFNs (rtIFN1 and
rtIFN2) are equivalent to other fish type I IFN molecules sequenced to date and structurally and functionally resemble type I
IFN family members in higher vertebrates. They are induced by
poly(I:C) and virus, and themselves can induce an antiviral state
and up-regulation of antiviral proteins (e.g., Mx). Although both
proteins had similar potency, rtIFN2 was the dominant transcript
and was constitutively expressed in a wide range of tissues from
healthy fish (Fig. 3) and cell lines. In contrast, trout group II IFN
(rtIFN3) appears to have a more restricted expression pattern with
expression detected in reproduction organs such as testis and ovary
from healthy fish (Fig. 3), and upon appropriate stimulation is
detectable in mixed leukocyte cell suspensions but not cell lines.
The antiviral activity of rrtIFN3 also appears minimal, although it
cannot be excluded at this time that incorrect folding of the purified rrtIFN3 hampered binding of rrtIFN3 to its receptor or the
cells used for these functional studies (cell lines and head kidney
leukocytes) could lack an appropriate receptor to respond to
rtIFN3.
It is not unusual for particular type I IFNs to have differential
expression patterns. In mammals, IFN-␣, is mainly produced by
viral infected leukocytes while IFN-␤ is synthesized by most cell
types but especially in fibroblasts (31, 32). Recently it has been
shown in humans and mice that the main IFN-␣ producer is a
subtype of dendritic cell which accounts for ⬍1% of blood leukocytes (6). These dendritic cells, that play a crucial role in presenting viral Ags to Th cells and CTLs, are capable of synthesizing
⬎100-fold higher amounts of IFN-␣ than any other cell types upon
viral infection. Recent evidence suggests that dendritic cells may
be present in fish (33), so whether the same situation exists in fish
and whether particular cell types express only some of the IFN
isoforms now known will be particularly interesting to determine
in future studies.
Although previous studies have investigated the functional activity of fish type I IFNs, they have used culture medium derived
from cells transfected with expression plasmids containing the
cloned fish IFN genes (14 –16). Thus, this is the first study to use
purified recombinant fish IFNs for biological studies. The above
studies used eukaryotic cells for transfection, and so this is also
the first report that E. coli derived fish rIFN is active, and that
glycosylation may not be essential for biological activity although
putative N-linked glycosylation sites are present in the mature peptides of the trout molecules. However, one explanation for the poor
activity of rrtIFN3 could be that it does require glycosylation to be
active. There is no clear reason why this might be the case, and the
protein does not have more potential glycosylation sites than seen
in the other trout isoforms. Indeed, rtIFN2 has the largest number
of potential sites (3) relative to the other two isoforms (which have
1 each). As stated above, perhaps it is more likely that folding is
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
VHSV is a widespread infectious pathogen in rainbow trout. To
investigate the IFN expression profiles during VHSV infection,
fish were exposed to VHSV by i.p injection with the virus and
tissues, including head kidney, spleen, and liver, were sampled for
RT-PCR analysis. As observed in the in vitro studies, rtIFN2 was
constitutively expressed in these tissues (Fig. 5), and infection resulted in increased expression most notable at day 3 in the kidney
and spleen. For rtIFN1, no constitutive expression was seen but
expression was apparent at day 2/3 in spleen or 3 in the kidney
postinfection. With rtIFN3, a similar result was seen at day 2 in
spleen and days 2 or 3 in kidney. Weak expression of rtIFN3 was
also seen in the liver at days 1 and 7.
Discussion
The Journal of Immunology
3869
an issue, and that the majority of the recombinant rrtIFN3 molecules are not folded correctly, leading to failure of binding to its
receptor. The rtIFN3 molecule possesses four cysteines, two more
than that in rtIFN1 and rtIFN2, and pairing of such cysteines could
be crucial to maintain the correct structure. Finally, it cannot be
excluded that rrtIFN3 may bind to a different receptor from that
used by rtIFN1 and rtIFN2, thus leading to a distinct cellular
response.
The discovery of a second group of type I IFN in trout encouraged the search for equivalent molecules in other fish species, and
species for which a genome is available for in silico analysis were
studied. This analysis showed that while fish group I IFNs appear
to be present universally in teleosts, fish group II IFNs were found
only in more primitive species such as rainbow trout and zebrafish.
In addition, this bioinformatics analysis of other vertebrate genomes (for Xenopus, chicken and mammals) confirmed the absence of homologues equivalent to fish group I IFNs. The analysis
of the Xenopus genome identified for the first time type I IFN
genes in amphibians, and confirmed that they are of the four cysteine type although they could also be divided into two main subgroups, and are intron containing genes, with the now typical 5
exon-4 intron organization. In mammals, particular attention was
given to the platypus and opossum genomes, where 6 and 9 copies
of intronless type I IFN genes were found respectively. Their linkage was not entirely clear, but multiple genes within contigs were
apparent. That relatively few IFN genes were found in platypus
supports the argument put forward in recent papers that
monotremes have fewer IFN genes compared with marsupial and
eutherian mammals (2, 34), with expansion of IFN subclasses during evolution in higher mammals perhaps associated with the transition from egg-laying into fetus based reproduction (5).
All of these new genes were added to other known mammalian,
chicken and fish type I IFN genes for phylogenetic tree analysis. It
is evident from this analysis that fish, amphibians and birds do not
have the equivalent subclasses of type I IFNs seen in mammals,
such as IFN-␣, ␤, ␦, ␧, ␬, ␶ and ␻, although two distinct groups
appear to be present within such vertebrate species. Thus both
amphibian and avian type I IFNs could be divided into two subgroups, although in all cases they were 4 cysteine containing molecules. The previously classified chicken IFN-␣ and IFN-␤ appear
to be homologous isoforms because they are within the same clade
consisting of chicken IFN1– 4, and so are not true orthologs of
mammalian IFN-␣ and IFN-␤ as stated previously (35). However,
chicken IFN5 represents a quite disparate chicken IFN subgroup.
Similarly in monotreme mammals such as platypus and echidna,
only two major isoforms of type I IFN exist, suggesting expansion
of the mammalian subclasses is a recent evolutionary event. These
two groups of monotreme IFNs are probably the prototypes of the
␣ and ␤ subgroups, despite their clustering with IFN-␤␧s, based on
the fact that one group, including platypus IFN1– 4 and echidna
IFN-␣, contain four cysteines as seen in IFN-␣ whereas the second
group, containing platypus IFN5 and IFN6 and echidna IFN-␤,
have only two cysteines that share the same cysteine pattern (i.e.,
C2 and C4) as in IFN-␤␧s (Fig. 1B). The phylogenetic tree analysis
of the opossum IFN genes also showed that IFN-␬ possibly appeared in marsupials after divergence of IFN-␤, by duplication of
an IFN progenitor with four cysteines, because one of the opossum
genes clusters well with the IFN-␬s. Although this is the first finding of an IFN-␬ in marsupials, it had been predicted in previous
studies that IFN-␬ diverged early from other type I IFNs in mammals (2). The phylogenetic tree has also demonstrated that the
IFN-␧s, also containing the same cysteine pairing pattern (C2C4)
with IFN-␤, are likely to have been duplicated from IFN-␤ possibly at a later stage in evolution because to date no IFN-␧ s have
been identified in noneutheria vertebrate species (3).
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 8. Schematic model proposed for the evolution of type I IFN family members in vertebrates.
3870
terns. In fish, amphibians, and birds, type I IFN genes are confined
in a single chromosomal locus. Evolution of the type I IFN genes
can be divided into two major phases possibly separated by a genome retroposition event that occurred between the emergence of
amphibians and birds/mammals, resulting in loss of the unique IFN
locus containing intronic IFN genes and introduction of intronlacking genes. Expansion within species due to gene or genome
duplication is apparent. The four-cysteine-containing IFNs exist in
every order of vertebrates, and we postulate that they are the ancestors of the type I IFN family. The two-cysteine-containing
IFN-␤s and IFN-␧s evolved from a four-cysteine-containing progenitor by deletion of two cysteines (C1 and C3) and are present
in mammals. An isoform of IFN that also contains two cysteines is
present uniquely in fish and retained C1 and C3 in contrast to
IFN-␤ and IFN-␧. This isoform may have superceded the fourcysteine-containing isoform in advanced teleosts. The results from
this study on IFN molecules in a lower vertebrate species (rainbow
trout) suggests that as in mammals, different groups of IFNs may
have arisen with distinct physiological and/or immune functions in
nonmammalian species.
Disclosures
The authors have no financial conflict of interest.
References
1. Samuel, C. E. 2001. Antiviral actions of interferons. Clin. Microbiol. Rev. 14:
778 – 809.
2. Harrison, G. A., L. J. Young, C. M. Watson, K. B. Miska, R. D. Miller, and
E. M. Deane. 2003. A survey of type I interferons from a marsupial and
monotreme: implications for the evolution of the type I interferon gene family in
mammals. Cytokine 21: 105–119.
3. Hardy, M. P., C. M. Owczarek, L. S. Jermiin, M. Ejdeback, and P. J. Hertzog.
2004. Characterization of the type I interferon locus and identification of novel
genes. Genomics 84: 331–345.
4. Roberts, R. M., L. Liu, Q. Guo, D. Leaman, and J. Bixby. 1998. The evolution
of the type I interferons. J. Interferon Cytokine Res. 18: 805– 816.
5. Demmers, K. J., K. Derecka, and A. Flint. 2001. Trophoblast interferon and
pregnancy. Reproduction 121: 41– 49.
6. Siegal, F. P., N. Kadowaki, M. Shodell, P. A. Fitzgerald-Bocarsly, K. Shah,
S. Ho, S. Antonenko, and Y. J. Liu. 1999. The nature of the principal type 1
interferon-producing cells in human blood. Science 284: 1835–1837.
7. van Pesch, V., H. Lanaya, J. C. Renauld, and T. Michiels. 2004. Characterization
of the murine ␣ interferon gene family. J. Virol. 78: 8219 – 8228.
8. Coulombel, C., G. Vodjdani, and J. Doly. 1991. Isolation and characterization of
a novel interferon-␣-encoding gene, IFN-␣ 11, within a murine IFN cluster. Gene
104: 187–195.
9. Kotenko, S. V., G. Gallagher, V. V. Baurin, A. Lewis-Antes, M. Shen,
N. K. Shah, J. A. Langer, F. Sheikh, H. Dickensheets, and R. P. Donnelly. 2003.
IFN-␭s mediate antiviral protection through a distinct class II cytokine receptor
complex. Nat. Immunol. 4: 69 –77.
10. Sheppard, P., W. Kindsvogel, W. Xu, K. Henderson, S. Schlutsmeyer,
T. E. Whitmore, R. Kuestner, U. Garrigues, C. Birks, J. Roraback, et al. 2003.
IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat. Immunol. 4: 63– 68.
11. Lutfalla, G., C. H. Roest, N. Stange-Thomann, O. Jaillon, K. Mogensen, and
D. Monneron. 2003. Comparative genomic analysis reveals independent expansion of a lineage-specific gene family in vertebrates: the class II cytokine receptors and their ligands in mammals and fish. BMC Genomics 4: 29.
12. Robertsen, B. 2006. The interferon system of teleost fish. Fish Shellfish Immunol.
20: 172–191.
13. Schultz, U., B. Kaspers, and P. Staeheli. 2004. The interferon system of nonmammalian vertebrates. Dev. Comp. Immunol. 28: 499 –508.
14. Altmann, S. M., M. T. Mellon, D. L. Distel, and C. H. Kim. 2003. Molecular and
functional analysis of an interferon gene from the zebrafish, Danio rerio. J. Virol.
77: 1992–2002.
15. Long, S., M. Wilson, E. Bengten, L. Bryan, L. W. Clem, N. W. Miller, and
V. G. Chinchar. 2003. Identification of a cDNA encoding channel catfish interferon. Dev. Comp. Immunol. 28: 97–111.
16. Robertsen, B., V. Bergan, T. Rokenes, R. Larsen, and A. Albuquerque. 2003.
Atlantic salmon interferon genes: cloning, sequence analysis, expression, and
biological activity. J. Interferon Cytokine Res. 23: 601– 612.
17. Zou, J., S. Bird, and C. Secombes. 2005. Fish cytokine gene discovery and linkage using genomic approaches. Marine Biotech. 6: S533–S539.
18. Berga, V., S. Steinsvik, H. Xu, O. Kileng, and B. Robertsen. 2006. Promoters of
type I interferon genes from Atlantic salmon contain two main regulatory regions.
FEBS J. 273: 3893–3390.
19. Sharp, G. J. E., A. W. Pike, and C. J. Secombes. 1991. Leukocyte migration in
rainbow trout (Oncorhynchus mykiss Walbaum): optimization of migration conditions and responses to host and pathogen (Diphyllobothrium dendriticum
Nitzsch) derived chemoattractants. Dev. Comp. Immunol. 15: 295–305.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
It is still not known what selection advantage multiple copies of
type I IFNs give. It may be that during evolution vertebrates had
to produce a repertoire of IFNs to combat increasing numbers of
pathogens or in response to other immune/physiological changes.
In contrast, lack of introns restrained variation of the IFN isoforms
because splicing of intron sequences at the RNA level at least can
provide the possibility to generate different proteins. Indeed, IFN
variants derived from alternative RNA splicing have been reported
in catfish (15), rainbow trout (GenBank accession number
AJ580911), Atlantic salmon (18), and more recently zebrafish
(36).
The type I IFN genes are clustered in the genomes of all vertebrate groups in which they have been discovered (i.e., fish, amphibians, birds, mammals), providing a map to analyze gene/genome duplications or other events in evolution. A single IFN locus
with multiple tandemly linked IFN genes exists in most vertebrates, although the IFN-␬ genes are located at a chromosomal
locus distant from the main IFN locus (3, 37). That amphibian as
well as fish type I IFN genes contain 5 exons and 4 introns supports the concept that a retroposition event occurred between the
emergence of amphibians and birds/mammals, which led to replacement of the single type I IFN gene locus by an IFN transcript.
No evidence for an intron containing an intron lacking IFN genes
coexisting in any vertebrate species has been found, and it is unlikely that an IFN transcript was introduced into a different locus
while the whole IFN locus was simultaneously deleted. Future
sequencing of the IFN genes in reptiles should help determine the
time of this retroposition event and whether it was a random event
or potentially coincident with the appearance of major physiological changes (e.g., perhaps the emergence of warm bloodedness).
The presence of introns in primordial IFN genes gives clues to
even earlier origins of this cytokine family, with clear relatedness
to other four ␣ helix cytokines such as IL-10 family members and
IFN-␭ molecules, suggesting that they arose from a common ancestor (11). This is supported by the fact that they have similar
predicted protein structure, although divergent in the primary protein sequences, and exactly the same gene organization with 4
introns at phase 0. In addition, one of the two chains forming the
receptor complex that is shared by IL-10 and IFN-␭ (IL-10R2), is
within the chromosomal locus where type I IFN receptors are located, providing an example of coevolution of ligands and receptors after gene/genome duplication. Gene synteny of the IFN receptor locus is known to be conserved in chickens (38). It could
be argued that fish type I IFN are perhaps more closely related to
the intron containing IFN-␭; recent work to characterize candidate
IFNR chains in zebrafish suggest just this, as the receptor identified
is similar to the IFN-␭ receptor based on some elegant knockdown
studies (36). However, these studies did not use recombinant or
purified IFN and were not aware of the multiple isotypes of type I
IFN in fish; thus, the jury must remain out for the time being. On
the basis of homology alone, fish type I IFNs appear closer to the
known type I IFNs (e.g., average 41– 47%, trout IFNs vs type I
IFNs) than to IFN-␭s (e.g., average ⬃37%, trout IFNs vs IFN-␭s)
and homology analysis (e.g., BLAST) of the primary nucleotide
and protein sequences indicates that fish IFNs are closer to mammalian type I IFNs than IFN-␭s (14 –17). Moreover, fish IFNs
possess distinct cysteine patterns (two or four cysteines) comparable with known type I IFNs and different from IFN-␭s, which
contains six cysteines. Finally, and most notably, fish group II
IFNs contain a CAWE motif conserved among mammalian
IFN-␣s.
In summary (Fig. 8), this study has demonstrated that there exist
multiple copies of type I IFN genes from fish to mammals, which
can be classified into three different groups based on cysteine pat-
EVOLUTION OF TYPE I IFNs
The Journal of Immunology
30. Klaus, W., B. Gsell, A. M. Labhardt, B. Wipf, and H. Senn. 1997. The threedimensional high resolution structure of human interferon ␣-2a determined by
heteronuclear NMR spectroscopy in solution. J. Mol. Biol. 274: 661– 675.
31. Derynck, R., J. Content, E. DeClercq, G. Volckaert, J. Tavernier, R. Devos, and
W. Fiers. 1980. Isolation and structure of a human fibroblast interferon gene.
Nature 285: 542–547.
32. Goeddel, D. V., D. W. Leung, T. J. Dull, M. Gross, R. M. Lawn, R. McCandliss,
P. H. Seeburg, A. Ullrich, E. Yelverton, and P. W. Gray. 1981. The structure of
eight distinct cloned human leukocyte interferon cDNAs. Nature 290: 20 –26.
33. Ohta, Y., E. Landis, T. Boulay, R. B. Phillips, B. Collet, C. J. Secombes,
M. F. Flajnik, and J. D. Hansen. 2004. Homologs of CD83 from elasmobranch
and teleost fish. J. Immunol. 173: 4553– 4560.
34. Harrison, G. A., K. A. McNicol, and E. M. Deane. 2004. Type I interferon genes
from the egg-laying mammal. Tachyglossus aculeatus (short-beaked echidna).
Immunol. Cell Biol. 82: 112–118.
35. Sick, C., U. Schultz, and P. Staeheli. 1996. A family of genes coding for two
serologically distinct chicken interferons. J. Biol. Chem. 271: 7635–7639.
36. Levraud, J., P. Doudinot, I. B. A. Colin, N. Peyrieras, P. Herbomel, and
G. Lutfalla. 2007. Identification of the zebrafish IFN receptor: implications for
the origin of the vertebrate IFN system. J. Immunol. 178: 4385– 4394.
37. LaFleur, D. W., B. Nardelli, T. Tsareva, D. Mather, P. Feng, M. Semenuk,
K. Taylor, M. Buergin, D. Chinchilla, V. Roshke, et al. 2001. Interferon-␬, a
novel type I interferon expressed in human keratinocytes. J. Biol. Chem. 276:
39765–39771.
38. Reboul, J., K. Gardiner, D. Monneron, G. Uze, and G. Lutfalla. 1999. Comparative genomic analysis of the interferon/interleukin-10 receptor gene cluster. Genome Res. 9: 242–250.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
20. Ganassin, R. C. 1998. Development of a monocyte/macrophage-like cell line,
RTS11, from rainbow trout spleen. Fish Shellfish Immunol. 8: 457– 476.
21. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673– 4680.
22. Kumar, S., K. Tamura, and M. Nei. 1994. Mega-molecular evolutionary genetics
analysis software for microcomputers. Comput. Appl. Biosci. 10: 189 –191.
23. Needleman, S. B., and C. D. Wunsch. 1970. A general method applicable to the
search for similarities in the amino acid sequence of two proteins. J. Mol. Biol.
48: 443– 453.
24. Nielsen, H., J. Engelbrecht, S. Brunak, and G. von Heijne. 1997. A neural network method for identification of prokaryotic and eukaryotic signal peptides and
prediction of their cleavage sites. Int. J. Neural Syst. 8: 581–599.
25. Fijan, N., D. Sulimanovic, M. Bearzotti, D. Mizinic, L. O. Zwillenberg,
S. Chilmonczyk, J. F. Vautherot, and P. de Kinkelin. 1983. Some properties of the
epithelioma papulosum cyprini (EPC) cell line from carp Cyprinus carpio. Ann.
Virol. 134: 207–220.
26. Hong, S., J. Zou, M. Crampe, S. Peddie, G. Scapigliati, N. Bols, C. Cunningham,
and C. J. Secombes. 2001. The production and bioactivity of rainbow trout (Oncorhynchus mykiss) recombinant IL-1␤. Vet. Immunol. Immunopathol. 81: 1–14.
27. Beales, L. P., D. J. Wood, P. D. Minor, and J. A. Saldanha. 1996. A novel
cytopathic microtitre plate assay for hepatitis A virus and anti-hepatitis A neutralizing antibodies. J. Virol. Methods 59: 147–154.
28. Reed, L., and H. Muench. 1938. A simple method of estimating fifty percent end
points. Am. J. Hyg. 27: 493– 497.
29. Karpusas, M., M. Nolte, C. B. Benton, W. Meier, W. N. Lipscomb, and S. Goelz.
1997. The crystal structure of human interferon ␤ at 2.2-A resolution. Proc. Natl.
Acad. Sci. USA 94: 11813–11818.
3871