End of Course Biology Practice Exam 1 What are the chemical inputs for photosynthesis? LS1A1 o o A. Oxygen and water B. Carbon dioxide and water 2 What is the source of energy for plants to grow? LS1A1 o o A. Water B. Light o o C. Carbon dioxide and oxygen D. Glucose and minerals from the soil o o C. Soil D. Air 3 Where does the carbon found in glucose come from? LS1A2 o o A. Carbon in the air B. Carbon in the soil 4 What is the role of photosynthesis in plants? LS1A3 o o A. To create oxygen for animals B. To become food energy for animals 5 What does photosynthesis provide for animals? LS1A4 o o A. Oxygen and food B. Carbon dioxide and food o o C. Carbon from water D. Carbon from mineral nutrients o o C. To provide chemical energy for plants D. To convert glucose into carbon dioxide o o C. Carbon dioxide and water D. Oxygen and carbon dioxide 6 What are the chemical inputs for cellular respiration? LS1B3 o o A. Oxygen and water B. Glucose and oxygen 7 What are the outputs for cellular respiration? LS1B3 o o A. Glucose, oxygen and water B. Light energy, oxygen and water o o C. Carbon dioxide and water D. Glucose and minerals from the soil o o C. ATP, carbon dioxide and water D. Oxygen, carbon dioxide and water 8 What process provides the energy source for animals? LS1B1 o o A. Photosynthesis B. Fermentation o o C. Cellular respiration D. Facilitated diffusion 9 How are cellular respiration and burning fossil fuels similar? LS1B2 o o A. Both build large carbon molecules from smaller molecules B. Both give off carbon dioxide and energy 10 What is the function of ribosomes? LS1C1 o o A. To make glucose B. To make proteins o o C. Both give off oxygen and water D. Both use carbon dioxide o o C. To regulate diffusion D. To build DNA molecules 11 What part of the cell regulates materials that enter and exit the cell? LS1D1 o o A. Vacuole B. Cell wall o o C. Cytoplasm D. Cell membrane 12 Which cellular process requires energy when moving materials across a cell membrane? LS1D2 o o A. Osmosis B. Active transport 13 What are the subunits of DNA? LS1E1 o o A. Nucleotides B. Amino acids o o C. Passive transport D. Facilitated diffusion o o C. Lipids D. Genes 14 What is the function of the nucleotide sequence in the DNA molecule? LS1E2 o o A. To synthesizes sugar B. To facilitate diffusion 15 Which sequence codes for a gene? LS1E4 o o A. A sequence of fatty acids B. A sequence of amino acids o o C. To encode genetic information D. To regulate movement through membranes o o C. A sequence of simple sugars D. A sequence of enzyme activity 16 What is the result of a change in the genetic sequence? LS1E5 o o A. Formation of a different carbohydrate B. Formation of a phospholipid bilayer o o C. Formation of a different protein D. Formation of a new cell 17 What is the complimentary strand of mRNA for this DNA strand: ATC GAT? LS1E6 o A. UAG CUA o B. TAG CTA o C. GCA CGC o D. AUC GAU 18 What nucleotide sequence determines the sequence of subunits in the mRNA? LS1E7 o A. DNA o B. tRNA 19 What are the subunits of proteins? LS1F1 o o A. Fatty acids B. Amino acids o C. rRNA o o C. Nucleic acids D. Simple sugars o D. RNA 20 What large molecules are made from simple sugars? LS1F2 o o A. Fats B. Proteins o o C. Nucleic acids D. Carbohydrates 21 What regulates reactions that break down and build molecules needed by the cell? LS1F3 o o A. Enzymes B. Hormones o o C. Nucleic acids D. Phospholipid 22 Which molecule contains the chemical energy used by cells? LS1F4 o o A. ATP B. Oxygen 23 What molecules store chemical energy? LS1F5 o o A. ATP, fats and carbohydrates B. Carbon dioxide and water 24 What is the main function of DNA? LS1G1 o o A. To code for lipids B. To code for carbohydrates o o C. Enzymes D. Carbon dioxide o o C. Enzymes and proteins D. Sunlight and oxygen o o C. To code for proteins and enzymes D. To code for steroids and hormones 2 25 Which environmental factor can change the activity of enzymes? LS1G3 o o A. Amount of light B. Purity of water 26 What are carried on chromosomes? LS1H1 o A. Genes o B. Proteins o o C. Relative humidity D. Change in temperature o C. Nucleus 27 How many chromosomes are in a typical animal body cell? LS1H2 o A. One set o B. Two sets o C. Three sets o D. Enzymes o D. Four sets 28 Where does an offspring get their set(s) of chromosomes? LS1H2 o o A. Only from the male parent B. Only from the female parent o o C. From the dominant parent D. From each biological parent 29 Some fruit flies have 6 chromosomes in their body cells. How many chromosomes will be present in each cell when mitosis is completed? LS1H3 o A. 2 o B. 3 o C. 6 o D. 12 30 Some fruit flies have 6 chromosomes in their body cells. How many chromosomes will be present in each sex cell when meiosis is completed? LS1I1 o A. 2 o B. 3 o C. 6 o D. 12 31 What process results in a unique combination of genetic information? LS1I2 o o A. Asexual reproduction B. Segregation of Alleles o o C. Budding D. Mitosis 32 What process restores the original chromosome number? LS1I4 o o A. Meiosis B. Fertilization o o C. Crossing over D. Independent assortment 33 Having dimples is dominant over not having dimples. A female with dimples (Dd) mates with a male without dimples (dd). What is probability of an offspring having dimples? LS1I7 A. 100% __ __ B. 75% __ C. 50% D. 25% __ o o o o 34 Red snapdragon flowers are crossed with white snapdragons and all of the offspring were pink. What type of genetic inheritance explains the pink flowers? LS1I8 o A. Mutation o C. Codominance o B. Genetic drift o D. Incomplete dominance 35 Which processes release carbon into the atmosphere? LS2A1 o o o o A. B. C. D. Breathing, photosynthesis and burning fossil fuels Photosynthesis, burning fossil fuels, and forest fires Cellular respiration, photosynthesis, and forest fires Forest fires, cellular respiration and burning fossil fuels 36 What organism removes carbon from the atmosphere? LS2A1 o o o o A. B. C. D. Plants remove carbon dioxide from the atmosphere Plants remove calcium carbonate from the atmosphere Animals remove carbon dioxide from the atmosphere Animals remove calcium carbonate from the atmosphere 3 Salmonberry Plants Directions: Use the following information to answer questions 37 through 46 on pages 5 through 9. Salmonberry plants can be found all along the Pacific coast. Salmonberry plants are a food source for many animals in Pacific coast ecosystems including hummingbirds, deer, and bear. Scientists conducted a field study to learn about salmonberry plant populations in different habitats in Washington. Field Study Question: How does the salmonberry plant population vary by habitat? Procedure: 1. Go to the salmonberry field study area. Record location, date, time, and temperature. 2. Choose a random location in the forest edge habitat. 3. Measure a 5-meter-by-5-meter plot and label as Plot 1. 4. Count the number of salmonberry plants in Plot 1. Record as Plot 1 for the forest edge habitat. 5. Repeat steps 2 through 4 for Plot 2 and Plot 3, choosing a new location in the forest edge habitat for each plot. 6. Repeat steps 1 through 5 for the stream bank and forest habitats. 7. Calculate and record the average number of salmonberry plants for each habitat. Data Collected: Location: Forest edge, stream bank, and forest habitats Date and Time: May 1, from 11:00 A.M. to 2:00 P.M. Temperature: 10° C to 15° C Habitat vs. Number of Salmonberry Plants Habitat Forest edge Stream bank Forest Number of Salmonberry Plants (in a 5 meter by 5 meter plot) Plot 1 Plot 2 Plot 3 Average 15 18 15 16 11 13 12 12 5 5 2 4 4 Salmonberry Plants 37 How could the validity of this field study be improved? INQF4 o o o o A. Use a fourth habitat type in the field study. B. Count the number of trees in the field study area. C. Use three 1-meter-by-1-meter plots in each habitat. D. Count the salmonberry plants in four plots at each habitat. 38 Which output from bears is used by salmonberry plants? SYSB, LS2A1 o o o o A. Carbon dioxide from bears is used for photosynthesis in plants. B. Oxygen from bears is used for photosynthesis in plants. C. Glucose from bears is used for respiration in plants. D. Water from bears is used for respiration in plants. 39 The results from the field study are shown in The Habitat vs. Number of Salmonberry Plants table. Describe a scientific reason for the results in the forest edge habitat and a scientific reason for results in the forest habitat. INQC1 In your description, be sure to: Describe a scientific reason for the results in the forest edge habitat. Describe a different scientific reason for the results in the forest habitat. Include data from the Habitat vs. Number of Salmonberry Plants table that supports each scientific reason. Forest edge habitat results: Forest habitat results: 5 Salmonberry Plants Write a conclusion for this experiment. In your conclusion, be sure to: Answer the experimental question Include supporting data from the experiment o State the high and low data points Explain how these data points support your conclusion Provide a scientific explanation for the trend in the data o Refer to the because portion of the hypothesis Write your investigative (experimental) question: How does the salmonberry plant population vary by habitat? Conclusion: 6 Salmonberry Plants Write a conclusion for this experiment. In your conclusion, be sure to: Answer the experimental question Include supporting data from the experiment o State the high and low data points Explain how these data points support your conclusion Provide a scientific explanation for the trend in the data o Refer to the because portion of the hypothesis Write your investigative (experimental) question: How does the salmonberry plant population vary by habitat? Conclusion: 7 Salmonberry Plants 40 Blackberry plants are found in forest edge habitats. How could blackberry plants limit the population of salmonberry plants? LS2C1 o A. Blackberry plants increase oxygen in the ecosystem. o B. Blackberry plants lack flowers that attract bees. o C. Blackberry plants produce dark purple berries. o D. Blackberry plants compete for resources. 41 Salmonberry leaf cells contain 14 chromosomes. How many chromosomes will a new leaf cell contain after mitosis? LS1H3 Write your answer in the box. _____ Chromosomes 42 Some bears are getting into trash cans at campgrounds near the forest. The park rangers plan to trap and relocate these bears to solve the problem of these bears getting into the trash. Describe two constraints other than cost that park rangers could encounter while trapping and relocating these bears. APPC1 In your description, be sure to: Identify two constraints on trapping and relocating these bears other than cost. Describe how each constraint is a limitation. One constraint: Another constraint: 43 Which event might be evidence that the forest edge habitat is in equilibrium? SYSD1 o o o o A. A dead tree providing nutrients for a young tree B. A bird species leaving as temperatures increase C. A landslide damming the stream in the habitat D. A flood washing away topsoil from the ground 8 Salmonberry Plants 44 Salmonberry plant roots absorb minerals. What cellular process moves minerals across root cell membranes from an area of low mineral concentration to an area of high mineral concentration?LS1D2 o A. Facilitated diffusion o C. Active transport o B. Passive transport o D. Osmosis 45 Scientists wondered how the presence of the new type of grass could affect the population of salmonberry plants in a forest ecosystem. What kind of investigation would be most appropriate to answer this question? INQB3 o A. A field study because factors that are hard to control could influence the results o B. A research paper because information is available about many kinds of plants o C. A controlled experiment because all the variables can be kept the same o D. A simulation because computers are more reliable than natural systems 46 Plan a field study to answer the question in the box. You may use any materials and equipment in your procedure. INQB2 Be sure your procedure includes: logical steps to do the field study conditions to be compared data to be collected method for collecting data how often measurements should be taken and recorded environmental conditions to be recorded Field Study Question: How does the total rainfall in different years affect the mass of berries produced by a salmonberry plant? Procedure: 9 Items 47-77 are not associated with a scenario. 47 How do worms improve soil quality? LS2A2 o o o o A. B. C. D. Worms breakdown matter for use by other organisms Worms eat all of the nutrients and clean the soil Worms absorb carbon dioxide from the soil Worms remove bacteria from the soil 48 Plants need nitrogen. What is in the soil that makes the nitrogen available to plants? LS2A3 o o A. Bacteria B. Water o o C. Sugar D. Air 49 Where do animals get nitrogen? LS2A3 o o o o A. B. C. D. Animals are born with all the nitrogen they need Animals get nitrogen from eating plants Animals can make their own nitrogen Animals get nitrogen from the air 50 What form of energy does a deer get from eating grass? LS2A4 o o A. Potential B. Chemical o o C. Nuclear D. Light 51 Which condition does not allow populations to increase rapidly? LS2B1 o o A. Food B. Space o o C. Water D. Disease 52 What is the population density of 100 owls living in 10 miles squared? LS2B3 o o A. 1 owl per mile squared B. 10 owls per mile squared o o C. 100 owls per mile squared D. 1000 owls per mile squared 53 What may happen to an owl population if more mice move into the area ? LS2C2 o o o o A. B. C. D. The owl population would increase The owl population would decrease The owl population would stay the same The owl population would react inversely On Isle Royale wolves prey on moose. Use the population table to answer question 54. 54 Predict the changes in the population of the wolf and moose, after the moose population increases? LS2D1 A. The wolf population will increase and then so will the moose population. o B. The wolf population will decrease and then so will the moose population. o C. The wolf population will increase and then the moose population will decrease. o D. The wolf population will decrease and then the moose population will decrease. o 10 55 Which factor accounts for the increase in the biodiversity in a forest ecosystem compared to a desert ecosystem? LS2E1 A. Amount of competition B. Availability of space o o o o C. Availability of water D. Amount of diseases 56 Insecticides can be sprayed on plant to reduce insects in a garden. What effect may the use of insecticides have on the garden ecosystem? LS2E2 A. Removing insects will increase biodiversity because birds will have less food to eat B. Removing insects will increase biodiversity because the growth of plants will increase C. Removing insects will decrease biodiversity because less species will live in the garden D. Removing insects will decrease biodiversity because more species will move to the garden o o o o 57 Which factor contributes to the stability of an ecosystem? LS2E3 o o o o A. B. C. D. Decreasing biodiversity Maintaining biodiversity Increasing the population of one species Introducing competing species to an ecosystem 58 When researching the salmon life cycle scientists learned that salmon need a certain size of gravel in order to spawn. How did this finding impact the removal of the Elwha River Dams? LS2F1 A. Water behind the dam was released quickly to flush all sediment to the mouth of the river B. The sediment trapped behind the dams need to be controlled C. The dam was removed in stages to keep some water behind D. Trees needed to be planted in the old lake bed o o o o 59 How might a builder work to protect forest lands? LS2F2 o o o o A. B. C. D. Buy building materials from Canada Use recycled building materials Harvest his or her own trees Use only old growth timber 60 What causes genetic variability? LS3A1 o o o o A. B. C. D. Geographic isolation and reproductive isolation Mutations and genetic recombination Asexual reproduction Mitosis 61 What can happen to a population if an environment has a finite supply of resources? LS3A2 o o o o A. B. C. D. The population will have an increase in inherited variability of offspring. Some individuals in the population will experience independent assortment. Individuals within the population will evolve faster by the process of natural selection. Some individuals will have a trait that will allow them to survive and reproduce better than others. 11 62 What drives natural selection? LS3A4 o o A. Environmental pressures B. Asexual reproduction o o C. Random fertilization D. Sexual reproduction 63 There are two alleles within a population of bears, thick fur and no fur. What may happen to the bear population if they experience hot weather for 10 generations? LS3A5 A. The allele for no fur will decrease in the population. B. The allele for fur will disappear after 10 generations. C. The allele for thick fur will decrease in the population. D. The allele for no fur will mutate into an allele for thick fur. o o o o 64 What are mutations? LS3B1 o o o o A. B. C. D. Exons that code for nonsense genetic information Random changes in reproductive strategies Random changes in genetic information Intron sequences of genetic information 65 What may cause mutations? LS3B2 o o o o A. B. C. D. Random fertilization of gametes during meiosis Segregation of alleles during sexual reproduction Environmental factors such as UV radiation Chromosomes crossing over during meiosis 66 How can mutations affect organisms within a population? LS3B3 o o o o A. B. C. D. Mutations can cause changes that allow offspring to survive and reproduce. Mutations can cause changes that mimic a bottleneck effect in a population. Mutations can cause alleles to segregate during sex cell formation. Mutations can cause independent assortment of alleles. 67 Which of the following would result in evolutionary adaptation of a mouse population to its environment? LS3B4 A. Several mice leave the area and mate with mice from another area. B. Mice are most likely to mate with close neighbors. C. Mice with thicker fur best survive a cold winter. D. Half the mice are killed by an avalanche. o o o o 68 Based on the diagram on the right, which two organisms are more closely related? LS3C1 o o o o A. B. C. D. Shark and Tuna Human and Whale Ornithischian and Bird Shark and Ornithischian 12 69 How can filling an available niche allow a species to survive? LS3C2 o o o o A. B. C. D. A niche increases competition among organisms in an environment with a lot of biodiversity A niche reduces competition among organisms in an environment with a lot of biodiversity A niche increases the survival of a species because it improves predator/prey relationships A niche increases the survival of a species because it allows organisms to compete 70 Why can two different species have very similar genes? LS3C3 o o o o A. B. C. D. The two species acquire similar genes through patterns of inheritance The two species inherit analogous structures from common ancestors The two species experience mutations on the same chromosomes The two species share a common ancestor 71 What evidence do scientists use to infer evolutionary development of species? LS3D1 o o o o A. B. C. D. Fossil record, genetic sequences, and anatomical structures Niche allocation, protein structure, and analogous structures Fertilization method, biological evolution, and acquired traits Mutation sequences, inheritance patterns, and allele combinations 72 Which two organisms are more closely related? LS3D1 o o o o A. B. C. D. Chimp and Gorilla Human and Chimp Gorilla and Orangutan Human and Orangutan Chimp ATGGGGGGTGATTTCCTAAA Gorilla ATGGGGGTGAATTTCCTAAA Orangutan ATGTGAGTAACTGGAAGATA Human ATGGGGGGTGATTTCCTAAT 73 How do scientists determine the degree of evolutionary relationships between two organisms? LS3E1 o o o o A. B. C. D. Scientists determine if the organisms have similar niches Scientists determine if the two organisms have vestigial structures Scientists determine if the two organisms have analogous characteristics Scientists determine if the two organisms are able to produce fertile offspring 74 Beak length in a population of finches changed from 2 cm to 6 cm after a 3 year drought. What caused the change in the average beak length after the drought? LS3E3 o A. Finches’ beaks grew bigger because of the lack of water o B. Finches with small beaks were able to grow bigger beaks o C. Finches with bigger beaks were unable to leave the island o D. Finches with bigger beaks were able to survive and reproduce 75 What do scientists use to show the evolutionary relationships among organisms? LS3E4 o A. Evolutionary trees o C. Common ancestry graphs o B. Geographic imaging o D. Niche pictographs 13 76 Where would a genetic mutation need to be if it was inherited? o A. Blood Cells o B. Body Cells o C. Cytoplasm o D. Sex Cells 77 People sweat to help maintain body temperature. What type of feedback happens when sweating regulates body temperature? o A. Positive feedback, because sweating can increase body temperature o B. Positive feedback, because sweating can decrease body temperature o C. Negative feedback, because sweating can decrease body temperature o D. Negative feedback, because sweating can increase body temperature 78 Plants use sunlight for a process. During this process what is release into the air? o A. Hydrogen o C. Oxygen o B. Nitrogen o D. Carbon 79 What contains the code of genetic information? o A. Number of amino acids o B. Chloroplasts in the thylakoid o C. Sequence of nucleotides in the DNA o D. Cell membranes surrounding the nucleus 80 What happens during photosynthesis? o A. Plants make glucose to be used to build cell structures o B. Uses amino acids to make cell membranes o C. breaks down fats to produce ATP o D. Burns carbon to produce energy 81 What happens during cellular respiration? o A. Oxygen is released o B. Carbon Dioxide is absorbed by the cells o C. Water is broken down into two compounds o D. Large carbon molecules are broken down into smaller compounds 82 What is the difference between an egg cell and a body cell? o A. Chromosomes are in pairs with one from each parent o B. Body cells have one chromosome from one parent o C. Egg cells have twice the number of chromosomes o D. Egg cells have half the number of chromosomes 83 A sperm contains 4 chromosomes. How many chromosomes will be in a fertilized egg? o A. 8 o C. 1 o B. 2 o D. 4 84 What provides instruction for building protein? o A. sequence of nucleotides found in genes of the organism o B. another type of protein found in the organism o C. the type of carbohydrates in the nucleotides o D. the order of proteases in the nucleus 14 85 What is the relationship between chromosomes and genes? o A. chromosomes assemble proteins from genes o B. chromosomes are the subunits of genes o C. chromosomes contain many genes o D. chromosomes code for genes 86 Proteins are broken down into which molecule during digestion? o A. Lipids o C. Amino Acids o B. Lactic Acids o D. Simple sugars 87 The feeling of hunger is a feedback mechanism attempting to return the body to its nutritional set point. Which type of feedback system does this represent? o A. Negative o C. Neutral o B. Positive o D. Indirect 88 Where must the genetic material be found for a trait to be inherited? o A. sex cells o C. ribosome o B. nucleus o D. blood cells 89 Which cell structure captures light energy? o A. Mitochondria o B. Chloroplast o o C. Ribosome D. Nucleus 90 Which layer is older? o o o A. Layer A B. Layer B C. Not enough information is available to answer the question. 91 What information can an evolutionary tree provide? o A. Crocodylia evolved from Aetosauria. o B. Thalattosuchia turned into crocodylia. o C. Crocodylia has a recent common ancestor with Rauisuchi. o D. Pseudosuchia is a shared common ancestor with crocodylia. 15 92 A male and female had 4 offspring, and they all looked different. What could explain these differences? o A. Cells grew larger in mitosis o B. Each offspring got a dominant trait o C. The offspring chose different genes o D. Resulted in a unique combination of egg and sperm 93 What should be done to check the validity of a given experiment? o o o o A. B. C. D. Average the results Repeat the experiment Do the experiment with a different variable Collect the same measurements with another sample 94 What is the difference between inherited and acquired traits? o o o o A. B. C. D. You lose your inherited traits during your lifetime. You get acquired traits from your biological parents. You get inherited traits from your biological parents. You develop your inherited traits during your lifetime. 95 Which organelle makes ATP? o o A. Chloroplast B. Mitochondria o o C. Nucleus D. Chlorophyll 96 How do plants and animals make ATP? o o o o A. B. C. D. Use light energy during cellular respiration Break down glucose during cellular respiration Break down carbon dioxide during photosynthesis Convert light energy into chemical energy during cellular respiration 97 A fertilized egg has 32 chromosomes? How many chromosomes are in the body cells and sex cells? o o A. 8 & 16 B. 16 & 32 98 What are the subunits of carbohydrates? o o A. Simple sugars (glucose) B. Lipids (fat) 99 Why do plants need to perform cellular respiration? o o A. Make waste B. Make oxygen o o C. 32 & 16 D. 64 & 32 o o C. Nucleic Acids D. Amino Acids o o C. Make energy D. Make carbon dioxide 100 Which process describes the movement of water across a membrane? o o A. Osmosis B. Plasmolysis 101 What is the purpose of lipids? o o A. Store light B. Trap waste o o C. Phagocytosis D. Active Transport o o C. Store energy D. Remove toxins 16
© Copyright 2026 Paperzz