Microbiology (2001), 147, 225–237
Printed in Great Britain
Deletion of the cell-division inhibitor MinC
results in lysis of Neisseria gonorrhoeae
Sandra Ramirez-Arcos,1 Jason Szeto,1 Terry J. Beveridge,2 Charles Victor,1
Finola Francis1 and Jo-Anne R. Dillon1
Author for correspondence : Jo-Anne R. Dillon. Tel : j1 613 562 5459. Fax : j1 613 562 5452.
e-mail : jdillon!uottawa.ca
1
Department of
Biochemistry, Microbiology
and Immunology,
University of Ottawa,
451 Smyth Road, Ottawa,
ON, K1H 8M5, Canada
2
Department of
Microbiology, University of
Guelph, Guelph, ON,
N1G 2W1, Canada
The minCDE genes involved in division site selection in Neisseria gonorrhoeae
were identified using raw data from the N. gonorrhoeae genome project and
are part of a cluster of 27 genes. When gonococcal min genes were
heterologously expressed as a cluster in Escherichia coli, minicells and
filaments were produced, indicating that gonococcal min genes disrupted cell
division in other genera. The insertional inactivation of the minC gene of N.
gonorrhoeae CH811 resulted in a strain (CSRC1) with decreased viability and
grossly abnormal cell division as observed by phase-contrast and electron
microscopy analysis. Western blot analysis of N. gonorrhoeae CSRC1 confirmed
that MinCNg was not produced. Complementation of CSRC1 by integrating a
minC–6WHis tag fusion at the proAB locus by homologous recombination
restored viability and 19 times wild-type levels of MinCNg expression. This
slight increase of expression caused a small percentage of the complemented
cells to divide aberrantly. This suggested that the 6WHis tag has partially
affected the stability of MinC, or that the chromosomal position of minC is
critical to its regulation. Comparison of MinC proteins from different bacteria
showed a homologous region corresponding to residues 135–230 with five
conserved amino acids. Overexpression of MinCNg in wild-type E. coli cells
induced filamentation and an E. coli minC mutant was successfully
complemented with minCNg. Therefore, the evidence indicates that MinC from
N. gonorrhoeae acts as a cell-division inhibitor and that its role is essential in
maintaining proper division in cocci.
Keywords : Neisseria gonorrhoeae, minC, cell-division inhibitor, cell lysis, cocci
INTRODUCTION
Bacterial rods usually divide symmetrically at mid-cell,
in single parallel planes with the formation of the
division septum occurring in DNA-free spaces
(Nanninga, 1998). The key protein that drives the
septation process is considered to be FtsZ (de Boer et al.,
1990 ; Lutkenhaus & Addinall, 1997 ; Salimnia et al.,
2000), a highly conserved protein in bacteria which is
encoded in the division cell wall (dcw) cluster (Ayala et
al., 1994 ; Francis et al., 2000). The poles of bacilli are
also zones where cell division could occur ; however,
.................................................................................................................................................
Abbreviations : Ap, ampicillin ; Cm, chloramphenicol ; GFP ; green
fluorescent protein ; Kan, kanamycin ; RT, reverse transcriptase ; Str,
streptomycin.
septa do not form there under normal circumstances.
Thus, rods are generally considered to have three
potential division sites where FtsZ ring formation
causing cellular constriction could occur, one site at
mid-cell and one at each pole (de Boer et al., 1990).
Recently, it has been shown that FtsZ rings can form
throughout the length of Escherichia coli cells and that
correct placement of the FtsZ ring at the mid-cell is
dependent on the inhibitory effect of the nucleoid as well
as proteins involved in mid-cell site selection (Yu &
Margolin, 1999).
In E. coli (Ec), proteins involved in correct division site
selection are encoded by the minB operon and include
MinCEc, MinDEc and MinEEc (de Boer et al., 1988 ; de
Boer & Crossley, 1989). MinCEc inhibits septum formation, acts as a cell-division inhibitor and is activated by
the ATPase MinDEc (de Boer et al., 1988, 1991). If
0002-4352 # 2001 SGM
225
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
S. R A M I R E Z -A R C O S a n d O T H E R S
MinCEc and\or MinDEc are overexpressed, E. coli cells
form long filaments, an indication that cell division has
been blocked (de Boer & Crossley, 1989). Together,
MinCEc and MinDEc prevent division at all potential
division sites by blocking assembly of FtsZEc (Bi &
Lutkenhaus, 1993 ; de Boer et al., 1992 ; Huang et al.,
1996). However, a recent study showed that MinCEc did
not prevent the oligomerization of FtsZ although it did
prevent the formation of FtsAEc rings (Justice et al.,
2000). The N-terminal domain of MinCEc is responsible
for inhibiting FtsZEc assembly whilst the C-terminal
domain of MinCEc interacts with MinDEc (Hu &
Lutkenhaus, 2000). The Min proteins can be visualized
inside cells by tagging them with green fluorescent
protein (GFP). GFP-tagged MinCEc and MinDEc were
found to oscillate from one pole to the other (Raskin &
de Boer, 1999a, b ; Hu & Lutkenhaus, 1999) and this
oscillation is dependent upon the presence of other Min
proteins. MinEEc provides topological specificity to
division site selection by forming a ring and counteracting the activity of MinCDEc at mid-cell (King et
al., 1999 ; Pichoff et al., 1995 ; Raskin & de Boer, 1997 ;
Zhang et al., 1998 ; Zhao et al., 1995). MinEEc ring
formation is independent of FtsZEc ring formation and
the ring disassembles before, or shortly after, cell
constriction begins (Raskin & de Boer, 1997). When
MinEEc is overexpressed, it prevents MinCDEc from
acting at all potential division sites in E. coli.
These cells divide asymmetrically to form round, anucleate cells, called minicells (Adler et al., 1967 ; de Boer
et al., 1988).
The division site selection process in Bacillus subtilis
(Bs) differs in several respects from E. coli. B. subtilis
contains both minCEc and minDEc homologues but
lacks a minEEc homologue (Varley & Stewart, 1992).
MinC and MinD apparently do not oscillate in this
organism. The topological specificity of the MinCDBs
inhibitor complex in B. subtilis is controlled by the
protein DivIVA which bears neither structural nor
functional similarity to MinEEc (Edwards & Errington,
1997). Inactivation of DivIVA results in minicell formation (Cha & Stewart, 1997 ; Edwards & Errington, 1997 ;
Reeve et al., 1973), and overexpression results in a
filamentous phenotype, not minicell formation, as is
observed with MinEEc (de Boer & Crossley, 1989).
DivIVA–GFP localizes to both the mid-cell and polar
regions and its main role may be to retain MinCDBs at
the cell poles after division (Edwards & Errington,
1997 ; Marston et al., 1998 ; Marston & Errington,
1999). Localization of GFP–MinDBs to the poles is
dependent on DivIVA. However, the targeting of
GFP–MinCBs to the mid-cell and its retention at the
mature cell poles is dependent on FtsZBs, PbpBBs and
MinDBs (Marston et al., 1998 ; Marston & Errington,
1999).
Proteins involved in division site selection in cocci have
not been investigated. A key difference in cell division
between cocci and rods is that division, in some cocci
such as Neisseria gonorrhoeae (Ng), occurs sequentially, in alternating, perpendicular planes (Westling-
Ha$ ggstro$ m et al., 1977). Division in N. gonorrhoeae
comprises an incomplete asymmetric constriction, accompanied by septum formation dividing the cell into
equal-sized daughter cells (Fitz-James, 1964).
In the present study, which was initiated in order to
determine how cocci select their division sites, we report
on the identification of Min homologues in Neisseria
species and have compared their genomic organization
to min clusters in other bacteria. We show that the
gonococcal and meningococcal min genes belong to a
17 kb cluster comprising 27 genes which are transcribed
in the same direction. The transcription of min genes is
linked to the transcription of upstream genes as determined by RT-PCR. Additionally, we have focused on
the role of MinC from N. gonorrhoeae as a model
system. By constructing a minC gene knockout in N.
gonorrhoeae CH811, and by cloning and expressing
minCNg in E. coli backgrounds, we show that the
gonococcal MinC protein acts as a division inhibitor.
The homologous and heterologous functionality of the
gonococcal MinC protein in N. gonorrhoeae and E. coli,
respectively, has been confirmed by complementation
experiments and by Western blot analysis using antigonococcal MinC antibodies. Surprisingly, the deletion
of minCNg causes gross enlargement of the round cells,
leading them to lyse.
METHODS
Bacterial strains, plasmids and growth conditions. The strains
used in this study are listed in Table 1. E. coli DH5α was used
as a host to clone minNg genes. E. coli C43(DE3) (Miroux &
Walker, 1996) was used to express the cloned minCDENg
cluster present on plasmid pSR1 (Table 2). This strain is a
λDE3 lysogen encoding T7 RNA polymerase which can initiate
minCDENg gene expression under the control of the T7
promoter of pSR1. E. coli PB103 was used for minCNg
expression. E. coli DR105 (minC) was used for the complementation studies with minCNg. E. coli M15 and BL21(DE3)
were used for the expression and purification of His-tagged
MinCNg and MinDNg proteins, respectively. All E. coli cells
were grown at 37 mC on Luria–Bertani (LB) medium (Difco).
N. gonorrhoeae CH811 streptomycin-resistant strain (Strr)
was used to generate the minCNg insertional knockout mutant,
N. gonorrhoeae CSRC1. The latter strain was complemented
by inserting a minCNg–6iHis fusion using the suicide vector
pLES94 (Silver & Clark, 1995) inserted at the proAB locus
by homologous recombination generating N. gonorrhoeae
CSRC2. Gonococcal strains were grown on GC medium base
(GCMB) (Difco), supplemented with Kellogg’s defined supplement (GCMBK ; Pagotto et al., 2000), for 18–24 h at 35 mC
in a humid, 5 % CO environment. GCMBK broth cultures of
# 0n04 % NaHCO were incubated with
gonococci containing
shaking at 200–250 r.p.m., at 35 mC $ and 5 % CO .When
#
required, antibiotics were added to media in the following
concentrations : 100 µg ampicillin (Ap) ml−", 25 µg kanamycin
(Kan) ml−" and 25 µg chloramphenicol (Cm) ml−" for E. coli ;
and 1 mg Str ml−", 18 µg Kan ml−" and 5 µg Cm ml−" for N.
gonorrhoeae.
Oligonucleotide primers and PCR. The oligonucleotide pri-
mers used for PCR amplification of the min genes were
designed using Primer Designer (Scientific and Education
Software) and were synthesized by the University of Ottawa
226
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
minC gene of Neisseria gonorrhoeae
Table 1. Bacterial strains used in this study
Strain
Relevant genotype/phenotype
E. coli PB103
dadR1 trpE61 trpA62 tna-5 purB+
E. coli DR105
zcf-117 : : Tn10\dadR1 trpE61 trpA62
tna-5 minC3 tetR
F− dcm ompT hsdSB (r−B m−B) gal
λ(DE3)
F− ompT hsdSB (r−B m−B) gal dcm
∆(srl–recA)306 : : Tn10 (tetR) (DE3)
supE44 ∆lacU169 (80 lacZ∆M15)
hsdR17 recA1 endA1 gyrA96 thi-1
relA1
Nals Strs Rifs Lac− Ara− Gal− Mtl−
F− reca+ Uvr+ Lon+ pREP4
Auxotype (A)\serotype (S)\plasmid
content class (P) : non-requiring\IB2\plasmid free, Smr
CH811 Smr minC : : Cm
E. coli BL21(DE3)
E. coli C43(DE3)*
E. coli DH5α
E. coli M15
N. gonorrhoeae
CH811
N. gonorrhoeae
CSRC1
N. gonorrhoeae
CSRC2
CSRC1 proAB : : minC–HisKan
Source
P. de Boer (Case Western
Reserve University)
P. de Boer (Case Western
Reserve University)
Stratagene
J. E. Walker (MRC,
Cambridge, UK)
Gibco
Qiagen
Our laboratory
This study
This study
* The mutation(s) conferring resistance to toxic products has not been characterized yet, but is believed
to affect the T7 RNA polymerase.
Biotechnology Research Institute (Table 3). All PCR reactions
were carried out in a Gene Amp PCR System 9600 Thermocycler (Perkin Elmer) using the following program : 3 min at
94 mC ; 30 cycles of denaturation for 15 s at 94 mC, annealing
for 15 s at temperatures varying from 47 mC to 51 mC (depending on the primer pair used) and extension at 72 mC for
0n5–3 min (depending on the expected product size) ; and a
final 5 min extension at 72 mC. Reactions were carried out in a
final volume of 100 µl containing the following reagents : 1i
PCR buffer containing 1n5 mM MgCl , 0n2 mM dNTPs, 0n2 µg
each primer and 2n5 U Taq DNA #polymerase (Boehringer
Mannheim). To detect insertions in the chromosome of N.
gonorrhoeae, whole cell suspensions of putative transformants
were used to provide chromosomal DNA templates for PCR.
Cell suspensions were prepared by diluting cells from overnight cultures on GCMBK plates in double-distilled water.
Cell concentrations were adjusted using the McFarland
Equivalence Turbidity Standard 0n5 (Remel).
Genomic analysis of min gene clusters and identification of
minCDENg genes.  analysis of raw sequence data from
the N. gonorrhoeae FA1090 genome project (Roe et al., 2000)
was used to identify and align the minCDENg cluster.
Annotations of the min genes and the order of the min
cluster from N. meningitidis Z2491\serotype A were analysed using information provided at the WIT web site
(http :\\wit.mcs.anl.gov\WIT2\).  searches for min
homologues in other organisms were carried out in their
respective sequence databases provided by the Institute for
Genomic Research (http :\\www.tigr.org\tdb\mdb\mdb.
html). Protein translations were made using PCGene
(IntelliGenetics).
Reverse transcriptase polymerase chain reaction (RT-PCR).
Total RNA was obtained from overnight cultures of N.
gonorrhoeae CH811 using the Qiagen RNeasy Total RNA kit.
RT-PCR was used to determine whether the genes located
between rpoA (upstream of minCNg) and minENg were cotranscribed. Primer CVME38 (Table 3) was used to produce
cDNA using 1 µg total RNA from N. gonorrhoeae CH811 as
a template in a reverse transcriptase reaction using Expand
Reverse Transcriptase (Boehringer Mannheim) according to
the instructions of the manufacturer. Primer pair
CVRA41\CVRA42 (Table 3) was used to amplify a 657 bp
fragment corresponding to rpoA from the RT reaction.
Cloning, expression and complementation of min genes in E.
coli and microscopy. Based on the sequence analysis of the
gonococcal minCDENg gene cluster, primer pair min10\min11
incorporating PstI and KpnI restriction sites, respectively
(Table 3), was used to PCR amplify a 2810 bp fragment from
N. gonorrhoeae CH811 cell suspensions. The PCR product
consisted of minCDE, oxyR and the duplicated gonococcal
uptake sequences at the 3h end. The amplicon was ligated into
pBluescript KS II (j) (Stratagene) under the control of the T7
promoter, opposite to the direction of the lac promoter, to
form pSR1 (Table 2). This plasmid was obtained after
transformation into E. coli DH5α by the CaCl method as
# of 720 bp
described by Sambrook et al. (1989). A fragment
corresponding to minCNg was PCR amplified from cell
suspensions using primer pair min12\min29 into which EcoRI
and BamHI restriction sites, respectively, had been incorporated (Table 3). This amplicon was ligated into pUC18
(Pharmacia) under the control of the lac promoter and
transformed into E. coli DH5α as mentioned above. The
plasmid obtained was named pSR2 (Table 2). Plasmid pSR1
was transformed into E. coli C43(DE3) (wild-type) and pSR2
was transformed into E. coli PB103 (wild-type) and DR105
(minC) for expression and complementation studies. Transformants were selected on LB agar supplemented with Ap. E.
coli DR105 cells carrying pSR2 were transformed with pREP4
(Qiagen) to provide LacIq in trans in order to control the
expression of the gonococcal minC. E. coli DR105 cells
227
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
S. R A M I R E Z -A R C O S a n d O T H E R S
Table 2. Plasmids used in this study
Plasmid
pBluescript KS
II (j)
pET30a
pQE30
pLES94
pEGFP
pSR1
pSR1cat3
pSR1cat4
pSR2
pSR16
pEGFPKan
pSR17
pSR18
pJSHC
pJSHD2
Characteristics
Source
Cloning vector (Apr)
Stratagene
Cloning and expression vector (Kanr) to
produce N- and C-terminal fusions to 6iHis
Cloning and expression vector (Apr) to produce
N-terminal fusions to 6iHis
Shuttle expression vector (Apr) to test activity
of gonococcal promoter regions
Cloning vector expressing GFP (Apr)
pBluescript KS II (j) with a 2810 bp amplicon
containing the minCDENg cluster, oxyRNg and
two uptake sequences
pSR1 with cat inserted into the unique SalI site
of minCNg
pSR1cat3 containing 504 bp upstream minNg
cluster
pUC18 containing minCNg under lac promoter
control
pET30a containing 550 bp upstream of minNg
and minCNg in fusion with 6iHis at its 3h end
pEGFP containing kan (from pET30a)
pEGFPKan containing 550 bp upstream of
minNg, and minCNg–His (from pSR16)
pLES94 where a 3200 bp fragment (lacZ and
part of cat) was replaced by a 2765 bp
fragment containing 550 bp upstream of
minNg, minCNg–His and kan (from pSR17)
pQE30a containing 6iHis–minCNg
pET30a containing 6iHis–minDNg
Novagen
carrying both pSR2 and pREP4, were induced with 1n0 mM
IPTG.
Samples from all E. coli transformants were collected from
exponential-phase cells. These cells were fixed with 0n2 %
glutaraldehyde and 6 % formaldehyde, prior to adhesion to
coverslips pre-coated with 0n01 % polylysine. Coverslips were
then placed onto a slide containing a drop of 50 % (v\v)
glycerol. The morphology of all E. coli transformants was
analysed by phase-contrast microscopy using a Zeiss
Axioskop microscope (ZeissX100 oil immersion objective,
100W HBO lamp).
Construction and complementation of a N. gonorrhoeae
minC knockout mutant. To create an insertional mutant of
minC in N. gonorrhoeae, the chloramphenicol acetyltransferase (cat) cassette from pACYC184 (New England Biolabs)
was PCR amplified using primer pair min21\min22 (Table 3)
and inserted into the unique SalI restriction site 35 bp from the
start site of minCNg in pSR1 to generate pSR1cat3 (Table 2).
To facilitate homologous recombination with the gonococcal
chromosome, a 504 bp BamHI–PstI fragment corresponding
to the region upstream of the translational start site of minCNg
was PCR amplified using primer pair min28\min38 (Table 3)
and cloned into pSR1cat3 to generate pSR1cat4 (Table 2)
which would act as a suicide vector in N. gonorrhoeae. N.
gonorrhoeae CH811 cells were transformed with pSR1cat4 as
described by Janik et al. (1976). A transformant, selected on
GCMBK supplemented with Str and Cm, was designated
Qiagen
V. Clark (University of
Rochester)
Clontech
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
N. gonorrhoeae CSRC1. The insertion of cat into the
chromosomal minCNg was confirmed by PCR analysis.
To complement N. gonorrhoeae CSRC1, plasmid pSR18 was
constructed in several steps. These steps were required because
the plasmid pLES94 (Silver & Clark, 1995), which is a
gonococcal suicide vector, has a restricted number of cloning
sites. A 1390 bp amplicon corresponding to the kan cassette of
pET30a (Novagen) was amplified using the primer pair
SRKan1\SRKan2 (Table 3) incorporating KpnI and NcoI
restriction sites, respectively. Kan selection was required since
the host strain, CSRC1, was resistant to Cm because minCNg
had been insertionally inactivated with a cat cassette. This
amplicon was cloned into pEGFP (Clontech) to produce
pEGFPKan (Table 2). A 1300 bp amplicon containing all of
minCNg and 550 bp upstream was generated using the primer
pair SRpet1\HLC (Table 3) incorporating NdeI and HindIII
restriction sites, respectively, and was cloned into pET30a in
fusion with 6iHis at the C-terminus of MinCNg to generate
pSR16 (Table 2). Using the primer pair min28\SRpet2 (Table
3), which incorporated BamHI and KpnI restriction sites,
respectively, a 1375 bp amplicon containing minCNg–6iHis
and the 550 bp region upstream of minCNg was PCR amplified
from pSR16 and cloned into pEGFPKan to generate pSR17
(Table 2). A fragment containing minCNg–6iHis, a 550 bp
upstream region, and the kan cassette was released from
pSR17 using BamHI and NcoI endonuclease digestion. This
2765 bp fragment was cloned into pLES94 (Silver & Clark,
228
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
minC gene of Neisseria gonorrhoeae
Table 3. Primer sequences used for PCR and RT-PCR
Primer
Sequence (5h–3h ; restriction sites underlined)
Gene(s) of interest
min10
min11
GCGCCTGCAGATGATGGTTTATATAAT
ATGTGGTACCCTGATTGACGGCAAAGA*
minCDE and oxyR
min12
min29
GCGCGCGAATTCATGATGGTTTATATAAT
GCGCGGATCCCAAACAATTACTCTGAGCC*
minC
min21
min22
CCTCTAGTCGACCCGTCAGTAGCTGAACA
ATGCCTGTCGACCATTTGAGAAGCACACG*
cat
min28
min38
GCGCGGATCCACCATCATAGAATTTTTTA
GCGCCTGCAGAGAATTTTTTAATGATGTA*
Upstream minC
SRKan1
SRKan2
GCGCGGTACCTTTCTCATAGCTCACGCTG
GCGCCCATGGTTCAAATATGTATCCGCTC*
kan
SRpet1
HLC
GCGCCATATGTGGGTTCTAAGTTGGAAGC
GCGCAAGCTTCTCTGAGCCAATTGCACTG*
Upstream minC and
minC
min28
SRpet2
GCGCGGATCCACCATCATAGAATTTTTTA
GCGCGGTACCAGCTTCCTTTCGGGCTTTG*
Upstream minC and
minC : : his
JSC1
JSC2
GCGCGGATCCGTTTATATAATGAATGCCT
GCGCCTGCAGCAAACAATTACTCTGAGCC*
minC
minD7pET30
minD2
CATGCCATGGTGGTGGCAAAAATTATTGTAG
GCGCGGATCCACCTTATCCTCCGAACAGA*
minD
CHVE38
CACATCCATACCATCCTGCT*
minE cDNA
CHVA41
CHVA42
TACTGTTGGTGGTGTTCAGG
AGCTCGGTTTCAGTGCGTTG*
rpoA
* Complementary strand.
1995), replacing a 3200 bp BamHI–NcoI fragment which
contained lacZ and part of cat, to create pSR18 (Table 2). The
new insert in pSR18 was flanked by 2400 bp and 800 bp, at the
5h and 3h ends, respectively, with gonococcal proAB gene
sequences to allow for homologous recombination into the
gonococcal chromosome. N. gonorrhoeae CSRC1 cells were
transformed with pSR18 and transformants were selected on
GCMBK plates supplemented with Cm and Kan. A positive
transformant strain, named N. gonorrhoeae CSRC2, was used
for further studies. Confirmation of the insertion of the
2765 bp amplicon from pSR18 into the chromosome of N.
gonorrhoeae CSRC2 was done by PCR and DNA sequence
analysis (University of Ottawa Biotechnology Research Institute).
Microscopic analysis of N. gonorrhoeae. Transmission electron microscopy was performed on N. gonorrhoeae strains
CH811, CSRC1 and CSRC2 as described by Beveridge et al.
(1994). Phase-contrast microscopy analysis was also performed in these strains using a Zeiss Axioskop microscope
(Zeiss i100 oil immersion objective, 100W HBO lamp).
Viability studies. N. gonorrhoeae CH811, CSRC1 and CSRC2
cells were diluted 25-fold from overnight cultures into
GCMBK liquid media to obtain an initial standard inoculum
at OD
of " 0n05 for the three strains. Cultures were
&&! at 35 mC with 5 % CO with agitation (250 r.p.m.).
incubated
One millilitre of culture was #removed at fixed times to
measure the OD and was serially diluted in liquid GCMBK.
&&! selected dilutions was plated, in triplicate,
Then, 0n1 ml from
on GCMBK agar medium supplemented with Str for N.
gonorrhoeae CH811, with Str and Cm for N. gonorrhoeae
CSRC1, and with Cm and Kan for N. gonorrhoeae CSRC2.
The plates were initially incubated for 24 h prior to the first
colony count and then recounted after incubation for an additional 48 h, if required. Viability of the colonies was
confirmed by subculturing them on GCMBK plates and
incubating for a further 24–48 h.
Production of gonococcal anti-MinC and anti-MinD antibodies. His-tagged MinCNg and MinDNg were purified by
nickel affinity chromatography. Using the primer pair
JSC1\JSC2 (Table 3) incorporating BamHI and EcoRI restriction sites, respectively, minCNg was PCR amplified and
cloned into pQE30 (Qiagen), which encodes an N-terminal
6iHis tag, to produce pJSHC (Table 2). Similarly, using the
primer pair minD7pET30\minD2 (Table 3), incorporating
NcoI and BamHI restriction sites, respectively, gonococcal
minD was amplified and cloned into pET30a, generating an
N-terminal fusion to 6iHis in pJSHD2 (Table 2). N.
gonorrhoeae MinC was purified from E. coli M15 expressing
minC from pJSHC and gonococcal MinD was purified from E.
coli BL21(DE3) expressing minD from pJSHD2 after 1 mM
IPTG induction. Inclusion bodies of MinCNg were purified
with 8 M urea lysis buffer and eluted from the nickel affinity
column with a pH 4n5 elution buffer as recommended by
Qiagen. Purified 6iHis–MinCNg was then used to immunize
female New Zealand White rabbits for the production of
polyclonal anti-MinCNg antibodies. Soluble MinDNg was
eluted using a 60 mM imidazole buffer (Novagen).
6iHis–MinDNg was then cut from SDS-PAGE gels and
electroeluted prior to immunization. Each immunization
consisted of 20 µg 6iHis–MinCNg or 80 µg 6iHis–MinDNg
mixed with Gerbu adjuvant, according to the manufacturer’s
instructions (GERBU Biotechnik). Three boosters of MinCNg
and two of MinDNg using the same protein concentrations as
above were administered. Anti-MinCNg sera were fractionated
229
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
S. R A M I R E Z -A R C O S a n d O T H E R S
(a)
S10
L3 L4
L2
S19
S3 L16
L22
L14
S17
L5
S8 L6
S14
S5
L15
secY IF1 S13
L18
S4 rpoA
S11
minC minE
rplQ minD
oxyR
1 2 M
(b)
1 kb
0·5
.................................................................................................................................................................................................................................................................................................................
Fig. 1. The min gene cluster of N. gonorrhoeae. (a) Comparison of the genomic organization of min clusters in different
bacteria. Grey arrows represent the direction of transcription. White arrows show the orientation of the primers used in
RT-PCR. T1, transcriptional terminator consisting of a stem–loop structure containing neisserial uptake sequences (US) ;
T2, rho-independent transcription terminator sequences. (b) Co-transcription of rpoANg–minENg by RT-PCR. Lanes : 1, rpoA
PCR amplicon from cDNA amplified with primer CVME38 ; 2, PCR control, amplicon from chromosomal DNA of N.
gonorrhoeae CH811 ; M, 1 kb DNA ladder.
with 70 % NH SO and concentrated 10 times to obtain an
% (Hebert et al., 1973).
antiserum rich %in IgG
Protein analysis and Western blots. Protein samples from E.
coli PB103 and DR105, and N. gonorrhoeae CH811, CSRC1
and CSRC2 were prepared by resuspending cells recovered
from exponential phase in 1 ml PBS (pH 7n0). Cell suspensions
were lysed by sonication using a SONIFIER cell disruptor 350
and then centrifuged at 4 mC for 30 min at 10 000 g in a Sorvall
MC 12V microcentrifuge or a Sorvall RC 5C Plus centrifuge
(E. I. DuPont de Nemours and Company). Supernatants were
removed and kept as soluble fractions. All protein samples
were separated by SDS-PAGE as described by Sambrook et al.
(1989). The volume of protein loaded onto gels was standardized for each individual sample in order to have similar
concentrations of total protein between samples as determined
by densitometry.
Western blots of protein gels were performed following the
instructions provided in the Mini Trans-Blot Electrophoretic
Transfer Cell Instruction Manual (Bio-Rad) using ImmobilonP transfer membranes (Millipore) with the following modifications : 3 % skimmed milk was used instead of gelatin to
prepare the blocking solution and was eliminated from the
antibody buffer. The concentrated anti-gonococcal MinC
antisera was diluted 1 : 1000. Similarly, the anti-MinDNg
antiserum was diluted 1 : 1000. Alkaline phosphatase conjugated goat anti-rabbit secondary antibody (Bio-Rad) was
diluted 1 : 3000 and detected using Atto Phos Plus kit (JBL
Scientific). Densitometric analysis to compare relative protein
concentration was performed using the Alpha Imager 1220
v5.04 (AlphaEase version 5.00 ; Alpha Innotech).
RESULTS
(a)
(c)
(b)
(d)
(e)
.................................................................................................................................................
Fig. 2. Effects of minC knockout on morphology of N.
gonorrhoeae CSRC1 : (a, b) phase-contrast micrographs ; (c–e)
electron microscopy micrographs. (a, c) Control N. gonorrhoeae
CH811 exhibit wild-type morphology. Cell division results in
equal-sized daughter cells. (b) N. gonorrhoeae CSRC1, minC
knockout mutant, displays lysed (ghost) cells. (d) N.
gonorrhoeae CSRC1, minC knockout mutant, showing
asymmetric division patterns resulting in different-sized
daughter cells (arrows). (e) Ghost cells of N. gonorrhoeae
CSRC1. The scale bar in (a) is 10 µm and (b) is the same
magnification. The scale bar in (c) is 500 nm and (d) and (e) are
the same magnification.
min genes are present in Neisseria species
We identified homologues of minC, D and E from the
raw data of the N. gonorrhoeae genome project (Roe et
al., 2000), which is now complete and with annotation
under way (September, 2000). We determined that the
minNg genes appear to be part of a large 17 kb gene
cluster, with rpoA (α subunit of RNA polymerase), secY
230
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
minC gene of Neisseria gonorrhoeae
Table 4. minCDE homologues in completed prokaryotic genome projects
Species
Aquifex aeolicus
Archaeoglobus fulgidus†
Bacillus subtilis
Borrelia burgdorferi
Chlamydia pneumoniae
Chlamydia trachomatis
Deinococcus radiodurans
Escherichia coli
Haemophilus influenzae
Helicobacter pylori
Methanobacterium
thermoautotrophicum†
Methanococcus jannaschii†
Mycobacterium tuberculosis
Mycoplasma genitalum
Mycoplasma pneumoniae
Neisseria gonorrhoeae
Neisseria meningitidis
Pyrococcus horikoshii†
Rickettsia prowazekii
Synechocystis sp.
Thermotoga maritima
Treponema pallidum
Vibrio cholerae
Annotation* or reference
Identified in this study*
minCD1, minD2
minD1, minD2
minCD (divIVA)‡
minD related genes : ylxH-1,-2, -3
minD
minD
minD, divIVA‡
minCDE
Not present
minCDE (Rothfield et al., 1999)
minD (Rothfield et al., 1999)
minD1, minD2
minD (Rothfield et al., 1999)
Not present
Not present
minCDE§
minCDE
minD
Not present
minCDE
minCD
minD (Rothfield et al., 1999)
minCDE
minC
minCDE
* Last genomic analysis completed in September 2000. Restricted to genomes that have been annotated.
† Species belonging to Archaea.
‡ DivIVA is encoded in a different gene cluster from minCDBs.
§ Partial annotation at htpp :\\wit.mcs.anl.gov\WIT2\.
(secretion protein Y), IF1 (initiation factor 1) and 20
structural ribosomal genes upstream, and with oxyR
(oxidative stress transcriptional regulator) downstream.
All genes are transcribed in the same direction. This
17 kb cluster is flanked by two stem–loop structures
containing neisserial uptake sequences (T1 ; Fig. 1a).
Previous studies have shown that gonococcal gene
clusters are generally separated by stem–loop structures
containing neisserial uptake sequences which act as
transcriptional terminators (Goodman & Scocca,
1988 ; Francis et al., 2000). Interestingly, there are no
stem–loop transcriptional terminator structures between the structural ribosomal gene L3, at the 5h end of
the large cluster, and oxyR located at the 3h end of the
gene cluster. Recently, we have described the Correia
element as another functional transcriptional terminator
(Francis et al., 2000) ; nevertheless, this terminator is
also absent in the 17 kb gene cluster containing the
minNg genes.
Since the genes upstream of the minNg cluster are not
apparently related to cell-division processes and there is
no obvious transcriptional terminator in the 149 bp
silent region upstream of minCNg, we used RT-PCR to
investigate whether the minNg genes could be expressed
from promoters further upstream of the minNg cluster.
Primer CVME38, which annealed at the 3h end of
minENg (Fig. 1a, Table 3), was used to generate cDNA
from total RNA isolated from N. gonorrhoeae CH811.
This cDNA was used as a template for PCR using
primers CVRA41 and CVRA42 (Fig. 1a, Table 3) which
hybridized internally to the rpoA gene upstream of
minCNg. An amplicon of the expected size of 657 bp was
produced from this RT reaction which would only occur
if an mRNA transcript containing at least rpoA to minE
was synthesized (Fig. 1b) ; therefore, the genes rpoA,
rplQ, minC, minD and minE are co-transcribed.
Genomic analysis of the min genes from N. meningitidis Z2491\serotype A using data provided at
http :\\wit.mcs.anl.gov\WIT2\ showed that this bacterium had an identical gene organization to the
gonococcal min cluster. Furthermore, the DNA sequences of the minNg genes were 97 % identical to the
meningococcal min genes. By contrast, min genes in E.
coli are associated within a 1n7 kb gene cluster, whereas
min genes in B. subtilis are contained in a 5 kb gene
cluster (Fig. 1a).
The gonococcal and meningococcal minC, minD and
minE genes encode proteins with the predicted sizes and
molecular masses of 237 aa (26n3 kDa), 271 aa (29n6 kDa)
231
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
S. R A M I R E Z -A R C O S a n d O T H E R S
A minC knockout in N. gonorrhoeae CH811 causes
cell aberrations
An insertional knockout of minC in N. gonorrhoeae
CH811 was created (N. gonorrhoeae CSRC1). If
MinCNg acts as a division inhibitor, gonococcal cells
lacking this protein should appear as having uncontrolled cell division, not the sequential cell division
along perpendicular planes, found in wild-type cells. We
show by phase-contrast and electron microscopy (Fig. 2)
that, in stark contrast to the wild-type CH811 cells (Fig.
2a, c), the phenotype of the minCNg mutant (CSRC1)
cells included clusters of cells of differing sizes and a
large number of lysed cells (Fig. 2b, d, e). From 50
randomly counted cells of wild-type N. gonorrhoeae
CH811, 48 had a normal cell-division phenotype and
two cells showed asymmetric cell division (i.e. one cell
larger than the other). By contrast, of 50 cells in N.
gonorrhoeae CRSC1, 6 were normal, 16 were aberrant
(i.e. multi-lobed cells) and 28 were ghost cells (i.e. empty
cells). Under electron microscopy analysis, these abnormal morphologies in N. gonorrhoeae CSRC1 appeared as multi-lobed cells having bulges at the septa,
incomplete divisions and ghost cells (Fig. 2d, e). These
observations are consistent with cell division occurring
along several planes other than the characteristic perpendicular planes described for the wild-type strain
(Fig. 2c).
In addition to its gross phenotypic alterations, the N.
gonorrhoeae minC mutant CSRC1 grew slowly and
formed colonies of quite different sizes (0n5–4n0 mm
diameter). The number of c.f.u. ml−" of the minCNg
10
log10 c.f.u. ml–1
and 87 aa (10n0 kDa), respectively. In both the minCDE
gene clusters minC and minD are separated by 28 bp
whereas minD and minE are separated by 3 bp. MinCNg
shows 98 %, 36 % and 22 % identity to MinC from N.
meningitidis, E. coli and B. subtilis, respectively, whereas MinDNg is 98 %, 73 % and 39 % identical to the N.
meningitidis, E. coli and B. subtilis MinD proteins,
respectively. Gonococcal MinE shares 97 % and 42 %
identity to the N. meningitidis and E. coli MinE proteins,
respectively. Comparison between MinC proteins from
different Gram-positive and Gram-negative bacteria
indicates that there are only five amino acids conserved
in all sequences, corresponding to residues R , G ,
"$' "$)
G , G and G of gonococcal MinC.
"&( "'%
"(%
Analyses of other genomes indicated that all three min
genes are not ubiquitously present in different organisms
(Table 4). Some bacteria such as Chlamydia trachomatis
have only one min gene (minD), whilst others, such as
Thermotoga maritima, have two (minCD). Interestingly, some species have multiple copies of a particular min
gene. The archaeon Methanococcus jannaschii contains
two copies of minD, whilst Borrelia burgdorferi has
three minD-related genes (Table 4). Thus far, the entire
minCDE cluster appears to be present only in Gramnegative bacteria. A few species of bacteria (e.g. Mycoplasma spp.) do not contain any min homologues
(Table 4).
(a)
8
6
4
2
1
(b)
3
1
5
Time (h)
2
7
9
3
27 kDa
(c)
1
2
3
33 kDa
30 kDa
.................................................................................................................................................
Fig. 3. Comparison of the viability of the wild-type,
minCNg mutant and complemented N. gonorrhoeae strains.
(a) Colony counts of wild-type N. gonorrhoeae CH811
(squares), minC mutant N. gonorrhoeae CSRC1 (triangles) and
minC-complemented strain N. gonorrhoeae CSRC2 (circles).
Colonies could be counted after 24 h incubation for CH811 and
CSRC2 and only after 72 h incubation for CSRC1. (b)
Western blot using anti-MinCNg. Soluble fractions of :
lanes 1, N. gonorrhoeae CH811 ; 2, N. gonorrhoeae
minC mutant, CSRC1 ; 3, complemented minC mutant, N.
gonorrhoeae CSRC2. (c) Western blot using anti-MinDNg. Lanes :
1, purified 6iHis–MinDNg as a control ; 2, N. gonorrhoeae CH811 ;
3, N. gonorrhoeae CSRC1.
mutant was significantly lower than the wild-type strain
(Fig. 3a), despite similar initial inoculum sizes. The
initial viable counts of N. gonorrhoeae CSRC1, which
required 72 h incubation before colonies were observed,
averaged 10& c.f.u. ml−". The initial viable count for N.
gonorrhoeae CH811, in which colonies were observed
within the normal incubation time of 18–24 h, was 10(
c.f.u. ml−" (Fig. 3a). This 100-fold difference between
the two strains was maintained over 9 h. Western blot
analysis using anti-MinCNg antisera on cell extracts
(Fig. 3b, lane 2) indicated that MinCNg was not
expressed in the mutant N. gonorrhoeae strain (CSRC1)
compared to the wild-type strain CH811 (Fig. 3b, lane
1).
Reversal of mutant minC phenotype in
N. gonorrhoeae CSRC1 by complementation
N. gonorrhoeae CSRC1 was complemented by the
insertion of one copy of a C-terminal 6iHis-tagged
minCNg into the gonococcal chromosome at the proAB
locus using the suicide plasmid pSR18 (see Methods).
Expression of MinCNg in the complemented strain, N.
gonorrhoeae CSRC2, was confirmed by Western blot
232
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
minC gene of Neisseria gonorrhoeae
(a)
(b)
.....................................................................................................
(c)
(d)
1
2
3
4
5
27 kDa
analysis (Fig. 3b, lane 3). Densitometry analysis indicated that the expression of MinCNg in CSRC2 was
" 1n9 times greater than in the wild-type strain N.
gonorrhoeae CH811 (Fig. 3b, lane 1). However, the
viability of N. gonorrhoeae CSRC2 was similar to that
of CH811 (Fig. 3a) and different-sized colonies were not
observed in this strain, unlike the minCNg knockout
mutant CSRC1. In addition, colonies from N. gonorrhoeae CSRC2 were obtained after 24 h incubation and
not after 72 h as observed within CSRC1. Phase-contrast
examination of CSRC2 indicated that the majority of
the cells had a wild-type phenotype, as exemplified by
the appearance of diplococci and cell tetrads (data not
shown). From 50 randomly counted cells, 41 appeared
to be dividing normally whereas 6 were dividing
abnormally (i.e. multilobed) and 3 burst\ghost cells
were seen. Since the wild-type phenotype was not
completely recovered on complementation, we investigated whether the minCNg mutation exerted a polar
effect on MinDNg expression in N. gonorrhoeae CSRC1.
Western blots using anti-MinDNg antibodies showed
that MinDNg is expressed in N. gonorrhoeae CSRC1
(Fig. 3c, lane 3) at similar levels as the wild-type CH811
(Fig. 3c, lane 2).
Heterologous expression of MinNg proteins in E. coli
To determine whether Min proteins from cocci would
disrupt cell division in a rod, the gonococcal minCDE
cluster, encoded on pSR1, was overexpressed in E. coli
C43(DE3). A large number of short filaments and
minicells was produced (Fig. 4b). This phenotype was
easily differentiated from the wild-type morphology of
the same E. coli strain transformed with pBluescript KS
II (j) as a control (Fig. 4a). The appearance of the
minicell phenotype suggested that gonococcal Min
proteins disrupt cell-division site selection in E. coli,
producing a phenotype similar to that observed from
Fig. 4. Expression of minNg in E. coli.
(a) Control. E. coli C43(DE3) transformed
with pBluescript KS II (j) exhibiting
wild-type morphology. (b) E. coli C43(DE3)
cells transformed with pSR1 (minCDENg)
exhibit a minicell phenotype : minicells and
short filaments. (c) E. coli PB103 cells
transformed with pSR2 (minCNg) exhibit long
filaments. The scale bar in (a) is 10 µm and all
other figures are the same magnification.
(d) Western blot using anti-MinCNg.
Lanes : 1, purified 6iHis–MinCNg ; 2, wildtype E. coli PB103 transformed with pUC18 ; 3,
E. coli PB103 overexpressing MinCNg from
pSR2 ; 4, E. coli DR105 (minC) expressing
MinCNg from pSR2 under in trans control
of LacIq from pREP4 ; 5, E. coli DR105
(minC) overexpressing MinCNg from pSR2.
overexpression of all three E. coli Min proteins (de Boer
& Crossley, 1989).
Since overexpression of E. coli MinC produces filamentation (de Boer & Crossley, 1989), which is
indicative of cell-division inhibition, we investigated
whether gonococcal MinC alone produced a similar
phenotype when overexpressed in E. coli. Transformation of pSR2 (minCNg) into E. coli PB103 produced a
high percentage of filamentous cells (Fig. 4c). Western
blot experiments indicated that E. coli PB103 transformed with pSR2 overexpressed MinCNg (Fig. 4d, lane
3) compared to the same strain transformed with pUC18
as a control, which only showed the background signal
which would correspond to the cross-reacting resident
E. coli MinC (Fig. 4d, lane 2).
Heterologous complementation of an E. coli minC
mutant with minCNg
The previous experiments suggested that gonococcal
MinC had a similar function to E. coli MinC, possibly
acting synergistically with the E. coli homologues to
produce characteristic phenotypes when overexpressed.
Therefore, one would expect that the gonococcal minC
should complement E. coli minC mutants. E. coli DR105
(minC) was co-transformed with pSR2 (minCNg) and
pREP4 in order to control the expression of the
gonococcal minC by providing LacIq in trans. Most of
the transformants exhibited a wild-type phenotype after
2 h of 1 mM IPTG induction (Fig. 5b) compared to the
minicell phenotype characteristic of the E. coli minC
mutant cells (Fig. 5a). MinCNg expression in the
complemented E. coli strain was confirmed by Western
blot analysis. E. coli DR105 transformed only with
pSR2, which displayed filamentation (data not shown),
expressed three times MinCNg levels (Fig. 4d, lane 5) in
comparison to the same strain co-transformed with
233
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
S. R A M I R E Z -A R C O S a n d O T H E R S
bination of min genes in various genera (Table 4), other
mechanisms or proteins for selecting division sites must
exist. Based on our genomic analysis, it became evident
that MinD is the most ubiquitously distributed Min
protein amongst bacteria. This may be due to its ATPase
activity and its other possible functions in the cell, aside
from its activation of MinC (de Boer et al., 1991). In
addition, it is interesting that of all bacteria sequenced to
date, only Gram-negative bacteria have complete
minCDE clusters. The absence of MinE in Grampositive organisms may indicate that fundamental differences in wall structure, which contribute to septation,
may require different proteins for controlling celldivision site selection. It is also suspected that none of
the α-Proteobacteria have Min systems (Margolin,
2000).
(a)
(b)
Neisserial min genes belong to a 17 kb gene cluster
.................................................................................................................................................
Fig. 5. Complementation of E. coli DR105 (minC) with minCNg.
(a) E. coli DR105 (minC) transformed with pUC18, as a control,
exhibit a minicell phenotype. The generation time is 50 min. (b)
E. coli DR105 (minC) co-expressing pSR2 (minCNg) and pREP4
(lacIq) after 2 h 1 mM IPTG induction. The generation time is
2 h. Most cells present wild-type phenotype and normal mid-cell
division (arrow).The scale bar in (a) is 10 µm and both figures
are the same magnification.
pSR2 and pREP4 (Fig. 4d, lane 4). These results
demonstrated that, under strict expression control,
MinCNg can restore the wild-type phenotype and
division pattern in the E. coli minC mutant, DR105.
DISCUSSION
We have shown that a minCDE gene cluster is present in
a pathogenic Neisseria species and that the genes are
involved in cell-division site selection. This is the first
study that addresses the function of min genes from
cocci. The division pattern in some cocci, such as N.
gonorrhoeae, alternates in perpendicular planes, differing substantially from rods, which divide along parallel
planes (Westling-Ha$ ggstro$ m et al., 1977 ; Nanninga,
1998). Models for division site selection in rods may not
adequately explain division site selection in cocci because : (a) there is no obvious mid-cell location in cocci
and therefore the manner in which a spherical cell
defines its middle for division must be determined ; (b) it
is not intuitively clear how the concept of ‘middle’
would be maintained in cells that divide in perpendicularly alternating, and not parallel, planes. In addition,
due to the differences in the presence and the com-
The min homologues in N. gonorrhoeae and N.
meningitidis are part of a large (17 kb) cluster of genes,
which have the same transcriptional polarity and are
flanked at the 5h and 3h ends by paired neisserial uptake
sequences that presumably act as transcriptional terminators. This large gene cluster is somewhat surprising
since neisserial gene clusters are normally shorter,
reflecting the fact that the gonococcus has a series of
mechanisms for frequent recombination and horizontal
gene transfer, which lead to high genetic variability
(Goodman & Scocca, 1988 ; Koomey, 1998). Even the N.
gonorrhoeae dcw cluster is distributed into five transcriptional units, whilst E. coli dcw genes belong to one
long transcriptional unit (Ayala et al., 1994 ; Francis et
al., 2000). However, there were no apparent transcriptional terminators in the neisserial min gene clusters, including the Correia element which has recently
been found to act in this manner (Francis et al., 2000). In
addition, experimental evidence of the co-transcription
of the minNg genes with at least two upstream genes,
rpoA and rplQ, suggests that the minNg genes are part of
a longer transcript. This indicates that the neisserial min
gene cluster must be stable, and that it is conserved in
pathogenic Neisseria species. Although a homologue to
the E. coli Rho termination factor gene has been detected
in N. gonorrhoeae (Miloso et al., 1999), it remains to be
determined whether its gene product could act to
terminate transcription in N. gonorrhoeae as it does in
E. coli (Platt & Richardson, 1992). In addition, it is
interesting to note that the gene content of min gene
clusters is not conserved between bacteria, perhaps
indicative of differing transcriptional regulation
amongst genera.
MinC is required for correct cell division in
N. gonorrhoeae
In this study, we have shown that MinC from N.
gonorrhoeae acts as a cell-division inhibitor. We have
also shown that in its absence, gonococci can lyse, a
phenotype not observed before. The absence of MinCNg
in N. gonorrhoeae CSRC1 generated uncontrolled cell
234
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
minC gene of Neisseria gonorrhoeae
division, which occurred along many planes rather than
along perpendicular planes characteristic of the wildtype cells. This uncontrolled division resulted in the
formation of abnormal cell clusters possessing cells of
varying size and shape, with some cells having multiple,
and sometimes incomplete, septa. We also frequently
observed large ghost cells characterized by cell-wall
structures lacking any obvious internal components.
The lower viability of the minCNg mutant is probably
due to the lysis observed in these cells or to improper
nucleoid segregation within the numerous ‘daughter’
cells generated.
Crossley, 1989), by assuming that the overexpression of
MinENg would be dominant over the effects of increased
MinCNg and MinDNg. The appearance of filamentous E.
coli PB103 cells overexpressing MinCNg and the successful complementation of an E. coli minC mutant with
minCNg showed that gonococcal MinC is able to retain
its function as a cell-division inhibitor across species.
Interestingly, ours is the first report of a heterologous
complementation of a min mutant. However, other celldivision mutants, such as E. coli thermosensitive ftsZ
mutants, have been heterologously complemented
(Gaikwad et al., 2000).
The cell lysis observed in enlarged gonococci when
MinCNg is depleted may be an indirect result of an
increase of the surface tension of these cells. Based on
the surface stress theory of Koch (1985), where T l
Pr\2 (T, surface tension ; P, hydrostatic pressure ; and r,
radius) for cocci, any increase in internal pressure is
accompanied by an increase in cell-wall tension that
ultimately leads to cell-wall enlargement during normal
growth of bacteria. However, a significant increase in
cell size may upset this balance as cell-wall tension
mounts and increases the stress of the peptidoglycan
bonds, making them more susceptible to splitting. The
tension may be sufficiently large such that the peptidoglycan may be hydrolysed without any enzymic aid.
Alternatively, peptidoglycan bonds under stress are
more susceptible to hydrolysis since autolytic enzymes
increase their rate of action under stress conditions
(Koch, 1985). Since cocci need only half the hydrostatic
pressure required in rods to increase their surface tension
by the same amount (Koch, 1985), round cells may be
more susceptible to the effects of any change in normal
cell growth or division, such as the one caused by the
depletion of MinC.
Comparison of MinC proteins from different bacteria
revealed a single homologous region, containing one
arginine and four glycines that are completely conserved.
Arginine and glycine domains have been previously
implicated in essential protein functions (Lee et al.,
1999 ; Li & Rosen, 2000 ; Thoden et al., 1999 ; Saitoh et
al., 1999). The conserved residues in MinC may be
involved in its activity as a division inhibitor, perhaps in
protein–protein interactions with MinD or FtsZ, which
have been described for E. coli MinC (Huang et al.,
1996 ; Hu et al., 1999). Recently, Hu & Lutkenhaus
(2000) showed that the C-terminal domain of MinCEc is
responsible for its interaction with MinDEc. It is also
possible that the conserved region in MinC proteins is
responsible for its stability, as has been reported for
MinC from E. coli, where mutations in the C-terminal
region of the protein cause an increase in protease
susceptibility (Sen & Rothfield, 1998).
The gonococcal minC mutant was complemented when
a wild-type copy of minCNg, tagged to 6iHis at its C
terminus, was inserted into the chromosomal proAB
locus. A minority of cells showed an aberrant phenotype,
possibly because the complemented strain expressed
higher levels of MinCNg than the wild-type strain
CH811. Since the C-terminal region of MinCEc has been
shown to be responsible for the stability of the protein
(Sen & Rothfield, 1998), it may be possible that the
6iHis tag at the C terminus of MinCNg renders the
protein more resistant to proteases, thereby maintaining
a higher amount of MinCNg in complemented cells.
Alternatively, the activity of MinCNg in the complemented strain may be affected due to the 6iHis residues
tagged to its C terminus, since altered biological function
has been observed in other His-tagged proteins (Wu &
Filutowics, 1999).
MinC from N. gonorrhoeae acts as a cell division
inhibitor in E. coli
Transformation of E. coli C43 with a plasmid containing
all three minNg genes resulted in the formation of
minicells and filaments. This phenotype might be
explained, as has been done in E. coli (de Boer &
Concluding remarks
Most of our current knowledge of bacterial cell division
has been assembled from studies based on rod-shaped
organisms. However, even in rods that have similar Min
proteins, the mechanism by which they act can be very
different. For example, whilst MinC and MinD from
both E. coli and B. subtilis are proposed to act as celldivision inhibitor complexes, their localization within
cells, using GFP fusions, show important differences.
Observations on cell-division site selection can now be
extended into those cocci containing min genes. Coccal
cells can lyse when MinC is not expressed, whereas in
rods, deletion of MinC leads to a minicell phenotype.
The present report is the first study to explore division
site selection in Gram-negative cocci. We have shown
that MinCNg is a cell-division inhibitor and that its role
is essential to maintain proper site selection in dividing
coccal cells.
ACKNOWLEDGEMENTS
This project was partially funded by the Canadian Bacterial
Diseases Network (Centers of Excellence) through grants to
J. R. Dillon and to T. J. Beveridge and through an operating
grant from the Medical Research Council to J. R. Dillon.
Electron microscopy was performed in the NSERC Guelph
Regional SDM Facility, which is partially funded by a Major
Facilities Access Grant from NSERC to T. J. Beveridge. We
thank Dr W. Margolin for helpful comments and suggestions
235
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
S. R A M I R E Z -A R C O S a n d O T H E R S
regarding this manuscript. We also thank Dr P. de Boer and Dr
J. E. Walker for providing the E. coli strains used in expression
studies, and Dr V. Clark for supplying the cloning vector
pLES94. We are grateful to D. Moyles (University of Guelph)
for her technical expertise in the EM studies and to Dr A.
Krantis (University of Ottawa) for providing the phasecontrast microscope.
REFERENCES
Adler, H. I., Fisher, W. D., Cohen, A. & Hardigree, A. A. (1967).
Miniature Escherichia coli cells deficient in DNA. Proc Natl Acad
Sci U S A 57, 321–326.
Ayala, J. A., Garrido, T., de Pedro, M. A. & Vicente, M. (1994).
Molecular biology of bacterial septation. In Bacterial Cell Wall,
pp. 73–102. Edited by J. M. Ghuysen & R. Hakenbeck. Amsterdam : Elsevier.
Beveridge, T. J., Popkin, T. J. & Cole, R. M. (1994). Electron
microscopy. In Methods for General and Molecular Microbiology, pp. 44–70. Edited by P. Gerhardt, R. G. E. Murray,
W. A. Woods & N. R. Krieg. Washington, DC : American Society
for Microbiology.
Bi, E. & Lutkenhaus, J. (1993). Cell division inhibitors SulA and
MinCD prevent formation of the FtsZ ring. J Bacteriol 175,
1118–1125.
de Boer, P. & Crossley, R. (1989). A division inhibitor and a
topological specificity factor coded for by the minicell locus
determine proper placement of the division septum in Escherichia
coli. Cell 56, 641–649.
de Boer, P., Crossley, R. & Rothfield, L. (1988). Isolation and
properties of minB, a complex genetic locus involved in correct
placement of the division site in Escherichia coli. J Bacteriol 170,
2106–2112.
de Boer, P., Cook, W. & Rothfield, L. (1990). Bacterial cell division.
Annu Rev Genet 24, 249–274.
de Boer, P., Crossley, R. E., Hand, A. R. & Rothfield, L. (1991). The
MinD protein is a membrane ATPase required for the correct
placement of the Escherichia coli division site. EMBO J 10,
4371–4380.
de Boer, P., Crossley, R. & Rothfield, L. (1992). Roles of MinC and
MinD in the site-specific septation block mediated by the
MinCDE system of Escherichia coli. J Bacteriol 174, 63–70.
Cha, J. & Stewart, G. (1997). The divIVA minicell locus of B.
subtilis. J Bacteriol 179, 1671–1683.
Edwards, D. & Errington, J. (1997). The Bacillus subtilis DivIVA
protein targets to the division septum and controls the site
specificity of cell division. Mol Microbiol 25, 905–915.
Fitz-James, P. (1964). Thin sections of dividing Neisseria gonorrhoeae. J Bacteriol 87, 1477–1482.
Francis, F., Ramirez-Arcos, S., Salimnia, H., Victor, C. & Dillon,
J. R. (2000). Organization and transcription of the division cell
wall (dcw) cluster in Neisseria gonorrhoeae. Gene 251, 141–151.
Gaikwad, A., Babbarwal, V., Pant, V. & Mukherjee, S. K. (2000).
Pea chloroplast FtsZ can form multimers and correct the
thermosensitive defect of an Escherichia coli ftsZ mutant. Mol
Gen Genet 263, 213–221.
Goodman, S. D. & Scocca, J. J. (1988). Identification and arrangement of the DNA sequences recognized in specific transformation of Neisseria gonorrhoeae. Proc Natl Acad Sci U S A 85,
6982–6986.
Hebert, G. A., Pelham, P. L. & Pittman, B. (1973). Determination
of the optimal ammonium sulfate concentration for the frac-
tionation of rabbit, sheep, horse and goat antisera. Appl
Microbiol 25, 26–36.
Hu, Z. & Lutkenhaus, J. (1999). Topological regulation of cell
division in Escherichia coli involved rapid pole to pole oscillation
of the cell division inhibitor MinC under the control of MinD and
MinE. Mol Microbiol 34, 82–90.
Hu, Z. & Lutkenhaus, J. (2000). Analysis of MinC reveals two
independent domains involved in interaction with MinD and
FtsZ. J Bacteriol 182, 3965–3971.
Hu, Z., Mukherjee, A., Pichoff, S. & Lutkenhaus, J. (1999). The
MinC component of the division site selection system in
Escherichia coli interacts with FtsZ to prevent polymerization.
Proc Natl Acad Sci U S A 96, 14819–14824.
Huang, J., Cao, C. & Lutkenhaus, J. (1996). Interaction between
FtsZ and inhibitors of cell division. J Bacteriol 178, 5080–5085.
Janik, A., Juni, E. & Heym, G. A. (1976). Genetic transformation as
a tool for detection of Neisseria gonorrhoeae. J Clin Microbiol 4,
71–81.
Justice, S. S., Garcia-Lara, J. & Rothfield, L. I. (2000). Cell division
inhibitors SulA and MinC\MinD block septum formation at
different steps in the assembly of the Escherichia coli division
machinery. Mol Microbiol 37, 410–423.
King, G. F., Rowland, S. L., Pan, B., Mackay, J. P., Mullen, G. P. &
Rothfield, L. I. (1999). The dimerization and topological specificity
functions of MinE reside in a structurally autonomous C-terminal
domain. Mol Microbiol 31, 1161–1169.
Koch, A. (1985). How bacteria grow and divide in spite of internal
hydrostatic pressure. Can J Microbiol 31, 1071–1084.
Koomey, M. (1998). Competence for natural transformation in
Neisseria gonorrhoeae : a model system for studies of horizontal
gene transfer. APMIS Suppl 84, 56–61.
Lee, S. J., Gray, M. C., Guo, L., Sebo, P. & Hewlett, E. L. (1999).
Epitope mapping of monoclonal antibodies against Bordetella
pertussis adenylate cyclase toxin. Infect Immun 67, 2090–2095.
Li, J. & Rosen, B. P. (2000). The linker peptide of the ArsA ATPase.
Mol Microbiol 35, 361–367.
Lutkenhaus, J. & Addinall, S. (1997). Bacterial cell division and the
Z ring. Annu Rev Biochem 66, 93–116.
Margolin, W. (2000). Self-assembling GTPases caught in the
middle. Curr Biol 10, R328–R330.
Marston, A. L. & Errington, J. (1999). Selection of the midcell
division site in Bacillus subtilis through MinD-dependent polar
localization and activation of MinC. Mol Microbiol 33, 84–96.
Marston, A. L., Thomaides, H. B., Edwards, D. H., Sharpe, M. E. &
Errington, J. (1998). Polar localization of the MinD protein of
Bacillus subtilis and its role in selection of the mid-cell division
site. Genes Dev 12, 3419–3430.
Miloso, M., Limauro, D., Alifano, P., Rivellini, F., Lavitola, A.,
Gulleta, E. & Bruni, C. B. (1999). Characterization of the rho genes
of Neisseria gonorrhoeae and Salmonella typhimurium. J Bacteriol 175, 8030–8037.
Miroux, B. & Walker, J. E. (1996). Overproduction of proteins in
Escherichia coli : mutant hosts that allow synthesis of some
membrane proteins and globular proteins at high levels. J Mol
Biol 260, 289–298.
Nanninga, N. (1998). Morphogenesis of Escherichia coli. Microbiol Mol Biol Rev 62, 110–129.
Pagotto, F., Aman, A. T., Ng, L.-K., Yeung, K.-H., Brett, M. &
Dillon, J. R. (2000). Sequence analysis of the family of
penicillinase-producing plasmids of Neisseria gonorrhoeae. Plasmid 43, 24–34.
236
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38
minC gene of Neisseria gonorrhoeae
Pichoff, S., Vollrath, B., Touriol, C. & Bouche! , J. (1995). Deletion
analysis of gene minE which encodes the topological specificity
factor of cell division in Escherichia coli. Mol Microbiol 18,
321–329.
Platt, T. & Richardson, J. P. (1992). Escherichia coli Rho factor :
protein and enzyme of transcription termination. In Transcriptional Regulation, pp. 365–388. Edited by S. L. McKnight &
K. R. Yamamoto. Cold Spring Harbor, NY : Cold Spring Harbor
Laboratory.
Raskin, D. M. & de Boer, P. A. J. (1997). The MinE ring : an FtsZindependent cell structure required for selection of the correct
division site in E. coli. Cell 91, 685–694.
Raskin, D. M. & de Boer, P. A. J. (1999a). Rapid pole-to-pole
oscillation of a protein required for directing division to the
middle of Escherichia coli. Proc Natl Acad Sci U S A 96,
4971–4976.
Raskin, D. M. & de Boer, P. A. J. (1999b). MinDE-dependent poleto-pole oscillation of division inhibitor MinC in Escherichia coli.
J Bacteriol 181, 6419–6424.
Reeve, J. N., Mendelson, N. H., Coyne, S. I., Hallock, L. L. & Cole,
R. M. (1973). Minicells of Bacillus subtilis. J Bacteriol 114,
860–873.
Roe, B. A., Lin, S. P., Song, L., Yuan, X., Clifton, S., Ducey, T.,
Lewis, L. & Dyer, D. W. (2000). Gonococcal Genome Sequencing
Project (Funded by USPHS\ NIH grant AI 38399). University of
Oklahoma.
Rothfield, L., Justice, S. & Garcı! a-Lara, J. (1999). Bacterial cell
division. Annu Rev Genet 33, 423–448.
Rowland, S. L., Fu, X., Sayed, M. A., Zhang, Y., Cook, W. R. &
Rothfield, L. I. (2000). Membrane redistribution of the Escherichia
coli MinD protein induced by MinE. J Bacteriol 182, 613–619.
Saitoh, F., Kawamura, S., Yamasaki, N., Tanaka, I. & Kimura, M.
(1999). Arginine-55 in the beta-arm is essential for the activity of
DNA-binding protein HU from Bacillus stearothermophilus.
Biosci Biotechnol Biochem 63, 2232–2235.
expression and localization in E. coli and N. gonorrhoeae. Arch
Microbiol 173, 10–20.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular
Cloning : a Laboratory Manual, 2nd edn. Cold Spring Harbor,
NY : Cold Spring Harbor Laboratory.
Sen, M. & Rothfield, L. I. (1998). Stability of the Escherichia coli
division inhibitor protein MinC requires determinants in the
carboxy-terminal region of the protein. J Bacteriol 180, 175–177.
Silver, L. E. & Clark, V. L. (1995). Construction of a translational
lacZ fusion system to study gene regulation in Neisseria gonorrhoeae. Gene 166, 101–104.
Thoden, J. B., Kappock, T. J., Stubbe, J. & Holden, H. M. (1999).
Three-dimensional structure of N5-carboxyaminoimidazole ribonucleotide synthetase : a member of the ATP grasp protein
superfamily. Biochemistry 38, 15480–15492.
Varley, A. & Stewart, G. (1992). The divIVB region of the Bacillus
subtilis chromosome encoded homologs of E. coli septum
placement (MinCD) and cell shape (MreBCD) determinants. J
Bacteriol 174, 6729–6742.
Westling-Ha$ ggstro$ m, B., Elmros, T., Normark, S. & Winblad, B.
(1977). Growth pattern and cell division in Neisseria gonorrhoeae.
J Bacteriol 129, 333–342.
Wu, J. & Filutowics, M. (1999). Hexahistidine (His6)-tag dependent protein dimerization : a cautionary tale. Acta Biochim
Pol 46, 591–599.
Yu, X. & Margolin, W. (1999). FtsZ ring clusters in min and
partition mutants : role of both the Min system and the nucleoid
in regulating FtsZ ring localization. Mol Microbiol 32, 315–326.
Zhang, Y., Rowland, S., King, G., Braswell, E. & Rothfield, L.
(1998). The relationship between hetero-oligomer formation and
function of the topological specificity domain of the Escherichia
coli MinE protein. Mol Microbiol 30, 265–273.
Zhao, C., de Boer, P. & Rothfield, L. (1995). Proper placement of
the Escherichia coli division site requires two functions that are
associated with different domains of the MinE protein. Proc Natl
Acad Sci U S A 92, 4313–4317.
Salimnia, H., Radia, A., Bernatchez, S. & Dillon, J. R. (2000).
.................................................................................................................................................
Characterization of the ftsZ cell division gene of N. gonorrhoeae :
Received 26 June 2000 ; accepted 11 October 2000.
237
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 20:54:38