Synchrony of High Endothelial Venules and
Lymphatic Vessels Revealed by
Immunization
This information is current as
of June 15, 2017.
Subscription
Permissions
Email Alerts
J Immunol 2006; 177:3369-3379; ;
doi: 10.4049/jimmunol.177.5.3369
http://www.jimmunol.org/content/177/5/3369
This article cites 43 articles, 17 of which you can access for free at:
http://www.jimmunol.org/content/177/5/3369.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2006 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
References
Shan Liao and Nancy H. Ruddle
The Journal of Immunology
Synchrony of High Endothelial Venules and Lymphatic Vessels
Revealed by Immunization1
Shan Liao and Nancy H. Ruddle2
T
wo vascular systems maintain homeostasis in lymph
nodes (LNs)3: blood vessels and lymphatic vessels (LVs).
High endothelial venules (HEVs) are specialized postcapillary venules that allow the entrance of naive L-selectinhigh cells
into the LN parenchyma. This is mediated in part through characteristic HEV adhesion molecules, including peripheral node addressin (PNAd), an L-selectin ligand that is determined by posttranslational modification of a variety of core proteins, including
Sgp200, GlyCAM-1, and CD34, by several enzymes, including
FucT-IV, FucT-VII, and HEC-GlcNAc6ST (1, 2) (also called
LSST, GST-3, GlcNAC6ST-2, gene name Chst4), here called
HEC-6ST. The latter enzyme, which is located in the Golgi of high
endothelial cells, is regulated by the lymphotoxin (LT)␣␤ complex, and its activity is crucial for the expression of PNAd on the
HEV luminal surface during development and chronic inflammation (3– 6). MAdCAM-1 is expressed on HEVs of mesenteric LNs
(MLNs) and Peyer’s patches in adult mice; it is only apparent in
early development on HEVs of peripheral LNs (PLNs) and thus is
a marker of immature HEVs in those nodes (7). HEVs also display
CCL19 and CCL21, which are instrumental in encouraging the
entrance of naive T cells and directing dendritic cell (DC) traffic in
Department of Epidemiology and Public Health and Section of Immunobiology, Yale
University School of Medicine, New Haven, CT 06520
Received for publication April 14, 2006. Accepted for publication June 15, 2006.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by the Anna Fuller Fund (to S.L.) and National Institutes
of Health Grants CA16885 and DK57731 (to N.H.R.).
2
Address correspondence and reprint requests to Dr. Nancy H. Ruddle, P.O. Box
208034, 815 Laboratory of Epidemiology and Public Health, 60 College Street, New
Haven, CT 06520-8024. E-mail address: [email protected]
3
Abbreviations used in this paper: LN, lymph node; LT, lymphotoxin; PLN, peripheral LN; ILN, inguinal LN; MLN, mesenteric LN; LV, lymphatic vessel; HEV, high
endothelial venule; PNAd, peripheral node addressin; OX, oxazolone; SRBC, sheep
RBC; WT, wild type.
Copyright © 2006 by The American Association of Immunologists, Inc.
the LN. Lymphatic vessels, distinguished by LYVE-1 (8), play
important roles in fluid regulation and immune responses. Afferent
LVs allow entrance of soluble Ag and APCs into LNs and efferent
LVs return lymphocytes back to the blood circulation. The effects
of immunization on LVs and their functions and the consequences
of these alterations have not been thoroughly investigated.
LVs and HEVs are maintained in homeostasis in LNs during the
steady state. Early after immunization by skin painting with oxazolone (OX), injection of sheep RBC (SRBC) in adjuvant, or
bacterial or viral infection, LNs undergo remodeling, with complex kinetics of lymph flow, cell content in lymph, blood flow, and
HEV gene expression. Lymph flow and lymph cell content increase soon after an initial inflammation and eventually return to a
normal level (9). Blood flow and lymphocyte migration into LNs
peak at 72–96 h (10 –13), accompanied by an increase in HEV
number and dilation (14, 15). These factors account for the significant LN enlargement apparent at 72–96 h (16, 17). In contrast,
during earlier times after immunization with OX or SRBC, there is
an interesting pattern of HEV gene regulation that apparently contradicts LN enlargement. An initial down-regulation of genes that
contribute to L-selectin ligand, including FucT-VII, GlyCAM-1,
and Sgp200, is followed by a recovery, indicating HEV plasticity
(18, 19). The mechanism of HEV remodeling after immunization
has not been elucidated.
Data from studies in which afferent LVs are severed support the
concept that LV function is necessary for HEV maintenance. After
afferent LVs are severed, dramatic effects are apparent in HEVs.
These include morphological changes, a decrease in the uptake of
[35S]sulfate (an indication of HEC-6ST function) (20, 21), a reduction of lymphocyte adherence to the vessels (22–24), and decreased expression of PNAd, GlyCAM-1, and Fuc-TVII (19, 23,
24). However, an increase in MAdCAM-1 expression (23) suggests that these events are not simply due to a general downregulation of blood vessel gene expression and indicate that continual accumulation of afferent lymph factor(s) in LNs is necessary
0022-1767/06/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
The mature phenotype of peripheral lymph node (LN) high endothelial venules (HEVs), defined as MAdCAM1lowPNAdhighLT␤Rhigh HEC-6SThigh, is dependent on signaling through the lymphotoxin-␤ receptor (LT␤R). Plasticity of PLN
HEVs during immunization with oxazolone was apparent as a reversion to an immature phenotype (MAdCAM1highPNAdlowLT␤Rlow HEC-6STlow) followed by recovery to the mature phenotype. The recovery was dependent on B cells and
was inhibited by LT␤R-Ig treatment. Concurrent with HEV reversion, at day 4 following oxazolone or OVA immunization,
reduced accumulation of Evans blue dye and newly activated DCs in the draining LNs revealed a temporary afferent lymphatic
vessel (LV) functional insufficiency. T cell priming to a second Ag was temporarily inhibited. At day 7, lymphangiogenesis peaked
in both the skin and draining LN, and afferent LV function was restored at the same time as HEV phenotype recovery. This
process was delayed in the absence of B cells. LV and HEV both express the LT␤R. During lymphangiogenesis in the draining LN,
HEV, and LV were directly apposed; some vessels appeared to express both PNAd and LYVE-1. Pretreatment with LT␤R-Ig
drastically reduced the number of PNAdⴙLYVE-1ⴙ vessels, suggesting a reduction in LV and HEV cross-talk. The concordance
in time and function and the close physical contact between LVs and HEVs in the remodeling process after immunization indicate
that the two vascular systems are in synchrony and engage in cross-talk through B cells and LT␤R. The Journal of Immunology,
2006, 177: 3369 –3379.
3370
for HEV maintenance. The nature of such lymph factor(s) and the
signaling events that they induce are unknown.
Because LVs and HEVs are crucial for LN function, we wondered whether these two systems interact during an immune response. In this study, we present the results of studies designed to
1) characterize the effects of immunization on HEVs by quantitation of expression of genes characteristic of mature or immature
HEVs; 2) identify cells and cytokines that contribute to changes in
HEV gene expression after immunization; and 3) determine
whether the plasticity of HEVs is due to changes in LV.
Materials and Methods
Mice
C57BL/6, TNFR1⫺/⫺(p55⫺/⫺), and ␮MT mice were purchased from The
Jackson Laboratory. nu/nu mice were purchased from Taconic. RAG⫺/⫺
mice were obtained from Dr. R. Flavell (Yale University, New Haven, CT).
All mice were studied under a protocol approved by the Yale University
Institution Animal Care and Use Committee.
OX and FITC Painting and OVA immunization
Flow cytometry analysis
Staining for flow cytometry analysis was performed by conventional procedures using PE-conjugated Ab to CD11c (BD Pharmingen). The stained
cells were subjected to flow cytometry with a FACSCalibur instrument
(BD Biosciences).
Immunofluorescence and immunohistochemistry
LNs were embedded and frozen in OCT (Sakura), and 7-␮m (LN) or 5-␮m
(skin) cryocut sections were fixed with cold acetone. Blocking buffer was
either 3% BSA (Sigma-Aldrich) and 5% mouse serum (Zymed) in PBS or
5% BSA and 4% goat serum (Sigma-Aldrich) in PBS. The following Abs
were used: hamster anti-mouse LT␤R, rat anti-mouse MAdCAM-1, rat
anti-mouse PNAd MECA-79 (BD Pharmingen); rat anti-mouse LT␤R
(Apotech); and rabbit anti-human LYVE-1 (cross-reactive with mouse
LYVE-1) (Upstate Biotechnology). In one experiment, rat anti-mouse
LYVE-1 (R&D Systems) was used. Rabbit anti-mouse HEC-6ST Ab was
developed in our laboratory (3, 5). Biotin-conjugated secondary Abs were
goat anti-rat IgG (Caltag Laboratories), goat anti-hamster IgG, goat antirabbit IgG (Jackson ImmunoResearch Laboratories), and anti-mouse MHC
class II (I-Ab). For immunofluorescence, Cy3-goat anti-rat IgM, Cy3-goat
anti-rat IgG, and Cy2-streptavidin (Jackson ImmunoResearch Laboratories) were used as detecting reagents. Immunohistochemistry was conducted with alkaline phosphatase and alkaline phosphatase substrate kits
(Vector Laboratories).
Quantitative real-time RT-PCR
PLNs collected from each individual mouse were pooled and pressed between two slides, washed with a large volume of PBS, and run through a
40-␮m cell strainer (BD Falcon). The stromal material retained in cell
strainer was immediately placed into lysis buffer for RNA extraction. For
RNA extraction after LT␤R-Ig treatment, the isolated individual PLNs were
placed immediately in lysis buffer for RNA extraction (RNeasy kit; Qiagen). The extracted RNA was treated with RNase-free DNase I kit (Qiagen), and cDNA was reverse transcribed using Superscript II kit (Invitrogen Life Technologies). Real-time PCR was performed in ABI Prism 7000
sequence detection system (Applied Biosystems) using SYBR Green PCR
master mix (Qiagen). GAPDH cDNA was measured simultaneously in all
reactions as internal control. Data were normalized based on the expression
of GAPDH. Primer sequences for real-time PCR are as follows: GAPDH,
(forward) 5⬘-CTGCACCACCAACTGCTTAG; (reverse) 5⬘-GATGGCA
TGGACTGTGGTCAT; GlyCAM-1, (forward) 5⬘-CCTGCCTGGGTC
CAAAGATGAAC, (reverse) 5⬘-CTGGTGTAGCTGGTGGGAGTGGAC;
MAdCAM-1, (forward) 5⬘-GTCCTGCACGGCCCACAACAT, (reverse)
5⬘-CCAGTAGCAGGGCAAAGGAGAG; CD34, (forward) 5⬘-AAACG
GCCATTCAGCAAGACAACA, (reverse) 5⬘-TCGCCACCCAACCAA
ATCACAAG; FucTIV, (forward) 5⬘-TGCACCGCGTTGACCACCTTC,
(reverse) 5⬘-AGCCGCCGCGCCCCCTAAA; FucTVII, (forward) 5⬘GGACCTCCTCGGGCCACCTACG, (reverse) 5⬘-CGCCAAGCAAAG
AAGCCACGATAA; HEC-6ST, (forward) 5⬘-TGCCCCACCTCCAAA
CAT, (reverse) GACCAACGCCACGCCTGAGA; SLC, (forward) 5⬘ACTCTAAGCCTGAGCTATGTGCAA, (reverse) 5⬘-GGCGGCGCATC
AGGT; LT␤R, (forward) 5⬘-TGGTGCTCATCCCTACCTTCA, (reverse)
5⬘-TTCTCTCTATCCTCTCCCCCAG.
Injection of LT␤R-Ig and control-Ig (LFA3-Ig)
Five-week-old C57BL/6 mice were injected i.p. once with 100 ␮g of either
LT␤R-Ig or LFA3-Ig (a gift from J. Browning, Biogen Idec). PLNs were
analyzed 7 days later. These experiments were performed twice with comparable results. To identify the role of LT␤R in HEV gene recovery, 5-wkold mice were immunized with OX, and 4 days later injected i.p. with 100
␮g of either LT␤R-Ig or LFA3-Ig. PLNs were analyzed 3 days after the
injection (i.e., OXd7). For the role of LT␤R in LV and HEV cross-talk
after immunization, LT␤R-Ig or control-Ig were injected i.p. 24 h before
OX immunization. PLNs were analyzed at OXd4.
Evans blue dye accumulation in ILNs
Thirty microliters of 1% Evans blue dye (Eastman Kodak) was injected s.c.
into each of the rear footpads. Dye accumulation in skin and in inguinal
LNs was evaluated 6 h later.
Cell proliferation experiments
Seven days after immunization with OVA in CFA as above, draining PLN
cells were isolated, and 2 ⫻ 105 cells per well were cultured with 1 mg/ml
OVA for 2 days. 3[H]Thymidine (1 ␮Ci) (Amersham Biosciences) was
added to each well and cultured for an additional 20 h. All proliferation
assays were performed in triplicate in 96-well flat-bottom plates (BD Biosciences), and the incorporation of 3H was evaluated by standard liquid
scintillation (Wallac). Results are expressed as the stimulation index of
cpm obtained with cells plus Ag divided by cpm of cells in medium alone.
Results
LT␤R and HEC-6ST (mature HEV markers) are down-regulated
and then recover after OX; converse regulation of MAdCAM-1
(immature HEV marker)
HEV plasticity is apparent after skin painting with OX or immunization with SRBC in adjuvant (18, 19). The pattern of HEV gene
regulation after Ag exposure, apparent as a decrease in the expression of some genes, but not of others, is puzzling. We adopted the
OX skin painting model to analyze the plasticity that had been
revealed in previous studies because OX is a standard reagent for
investigating LN remodeling (25, 26). We analyzed protein and
mRNA expression, concentrating on three important HEV genes:
HEC-6ST, MAdCAM-1, and LT␤R. These genes respectively represent a mature HEV marker, an immature HEV marker, and the
critical receptor in their development. PNAd expression also was
evaluated as the MECA-79 epitope, but the data for this particular
series of experiments are not reported in this study because the
changes in the cellular pattern and intensity of staining are the
product of several genes, including HEC-6ST. Furthermore, because PNAd is a product of several genes, it cannot be evaluated
at the mRNA level. Mice were immunized with OX (in acetone),
and axillary, brachial, and inguinal LNs (PLNs) from a minimum
of five mice per time point were harvested at several different times
after the single immunization and analyzed by immunohistochemistry and quantitative RT-PCR. Several changes were seen in
HEVs after OX, but not after vehicle-alone (acetone) treatment.
LT␤R and HEC-6ST were regulated in a similar pattern. An initial
decrease was apparent by 2 days (OXd2, data not shown). The
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
OX immunization was performed as skin painting of 50 ␮l per LN area of
4% OX (Sigma-Aldrich) in acetone. Mice were anesthetized by injection
i.p. of ketamine/xylazine. OX was applied on shaved skin on the abdomen
at the inguinal LN (ILN) and brachial LN areas. In all the experiments, OX
was painted only once. LNs were harvested at different time points after
OX (n ⱖ 5 per time point). OX was applied on flanks for skin angiogenesis
analysis. For FITC skin painting, 200 ␮l of 2% FITC (Sigma-Aldrich) in
1:1 (v/v) acetone/dibutylphthalate mixture was applied on shaved skin on
flanks. FITC⫹ DCs were analyzed in draining LNs 24 h after FITC
painting.
In other experiments, mice were immunized with a total of 250 ␮g/
mouse OVA (Sigma-Aldrich) in CFA with 375 ␮g of Mycobacterium tuberculosis (Difco) in CFA divided between two flanks and tail.
COORDINATION OF LVs AND HEVs
The Journal of Immunology
Neither T nor B cells are required for the initiation of HEV
remodeling, but B cells are necessary for optimal HEV recovery
after OX
To identify the mechanism of the changes in HEVs, we next investigated which cells and cytokines were responsible for these
effects. First, we asked whether the remodeling of HEVs was the
consequence of lymphocyte activity by evaluating HEV gene regulation in LNs of RAG⫺/⫺ mice. Although these mice have no
mature T or B cells, they exhibit HEV networks, although the level
of constitutive HEC-6ST expression was considerably lower than
in wild-type (WT) PLNs, and many of the vessels exhibited abluminal PNAd staining (Fig. 2A). The initial down-regulation of
HEC-6ST still occurred at OXd4 (Fig. 2B, a– c). Therefore, the
down-regulation of HEC-6ST after OX was not due to LN enlargement subsequent to infiltrating Ag-specific cells. However,
the rebound of HEV gene expression at OXd7 was not as vigorous
as in WT mice (Fig. 2B, a– c; compare with Fig. 1A, e– g), indicating a requirement for T and/or B cells for this later stage. The
results indicate that the mature HEV phenotype and the optimal
rebound of HEV gene expression after OX require T and/or B
cells.
Next, we investigated the individual role of T and B cells in
HEV remodeling. Either T or B cells were sufficient to maintain
the mature HEV phenotype, because HEC-6ST expression was
present in both ␮MT mice (B cell deficient) and nu/nu mice (T cell
deficient) PLNs (Fig. 2A). The initial down-regulation of HEC6ST occurred in both ␮MT and nu/nu LNs (Fig. 2B, e and h), again
suggesting that an Ag-specific immune response is not necessary
for the initiation of HEV remodeling after OX. However, the rebound of HEC-6ST expression after OX was delayed in ␮MT (Fig.
2Bf), although not in nu/nu LNs (Fig. 2Bi). These data suggest that
B cells are required for optimal HEV gene rebound after OX.
Given the importance of TNFR1 in inflammation and its somewhat less prominent role in secondary lymphoid organ development, we asked whether HEV gene expression after OX also was
FIGURE 1. LT␤R and HEC-6ST (mature HEV markers) are initially down-regulated after OX, and then recover; converse regulation of MAdCAM-1
(immature HEV marker). A, LT␤R (a– d), HEC-6ST (e– h), and MAdCAM-1 (i–l) expression after immunization was analyzed by immunohistochemistry;
original magnification, ⫻20. To avoid variation between experiments, immunohistochemistry was conducted on sections from mice from different time
points (n ⱖ 5 mice per group) at the same time with identical camera settings and repeated at least twice. Counterstaining was not used to better reveal
the changes. B, MAdCAM-1 (red) expression was localized to those individual high endothelial cells with low HEC-6ST (green) expression; a typical HEV
is circled by dashed line; original magnification ⫻100. C, Real-time RT-PCR of mRNAs isolated from PLN stromal material. The nontreated control group
expression level was designated as 100% (n ⱖ 5). Nontreated (䡺), OXd4 (f), OXd7 (u), OXd14 (t).
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
lowest level was seen at 4 days (OXd4; Fig. 1A, b and f). A rebound was apparent by 7 days (OXd7; Fig. 1A, c and g), with full
recovery by 14 days (OXd14) (Fig. 1A, d and h). Surprisingly and
importantly, in contrast with these two genes, MAdCAM-1 expression, which is normally very low in PLNs (Fig. 1Ai), increased
after OX immunization. There was an increase not only in the
number of MAdCAM-1-expressing vessels (from 4 ⫾ 2 to 21 ⫾ 7
per 7-␮m LN section, apparent from counting 12 random LN sections from five mice), but also in the level of MAdCAM-1 expression
on those vessels (Fig. 1A, j and k). By OXd14, MAdCAM-1 returned
to the normal very low level seen in PLN HEVs (Fig. 1Al). Interestingly, at OXd7, MAdCAM-1 expression was localized to those individual high endothelial cells that expressed low HEC-6ST (Fig. 1B),
consistent with a generally reciprocal relationship of these proteins as
has been noted in mesenteric LN HEVs (5).
When PLN stromal material was isolated and analyzed for
mRNA by quantitative real-time RT-PCR, a pattern similar to that
obtained after staining for protein was apparent. Expression of
LT␤R, HEC-6ST, and GlyCAM-1, proteins that contribute to PNAd,
was decreased at OXd4 and then rebounded. MAdCAM-1 mRNA
exhibited a converse pattern (Fig. 1C). Thus, HEV plasticity after
immunization was evident as reversion to an immature phenotype,
and then a recovery. Because HEC-6ST is a selective HEV gene
and its regulation represents HEV remodeling, we use HEC-6ST as
a mature HEV marker in the remainder of this communication.
3371
3372
COORDINATION OF LVs AND HEVs
regulated through this pathway. We investigated HEV gene expression in LNs of three TNFRI (p55) knockout mice after OX.
The pattern of HEV gene regulation after OX was similar to that
seen in WT mice (Fig. 2B, j–l). Therefore, the TNFR1 signal is not
important in HEV gene regulation after OX.
Mature HEV phenotype recovery from OX is dependent on
LT␤R and B cells
The critical importance of LT␤R signaling for HEV gene expression in development and chronic inflammation was shown in our
previous experiments conducted in gene knockout and transgenic
mice (3). Furthermore, HEVs express LT␤R (27), suggesting that
the effect of LT␤R ligands was directly on the vessels themselves.
In a recent publication, Browning et al. (29) found that long-term,
repeated treatment with LT␤R-Ig, an inhibitory fusion protein of
the LT␤R with human Ig Fc region (28), reduced the expression of
HEV genes. In agreement with their observations, we found that
by 7 days after even a single i.p. injection of 100 ␮g of LT␤R-Ig,
expression of several HEV genes was dramatically down-regulated. Quantitative real-time RT-PCR revealed down-regulation of
mRNAs of several HEV genes, including the posttranslational
modifying enzymes HEC-6ST, FucT-IV, FucT-VII, HEV core glycoprotein, GlyCAM-1, and MAdCAM-1 (Fig. 3A). Interestingly
and importantly, this treatment also resulted in ⬃65% reduction of
the LT␤R itself (Fig. 3A) (n ⫽ 6) suggesting, for the first time,
feedback regulation of the LT␤R.
We then asked whether the rebound of HEV gene expression
that occurred after HEV remodeling also was dependent on LT␤R
activity. Mice were preimmunized with OX 4 days before (OXd4)
and then injected i.p. with 100 ␮g of LT␤R-Ig or control LFA3-Ig.
PLNs were harvested 3 days later (i.e., OXd7) and analyzed by
immunofluorescent double staining for PNAd and HEC-6ST expression. The rebound of HEC-6ST expression occurred in HEVs
of mice injected with LFA3-Ig (Fig. 3Bb), but not in those of mice
injected with LT␤R-Ig (Fig. 3Be). In fact, some HEVs of LT␤R-Ig
treated mice appeared to express only abluminal PNAd (Fig. 3B, d
and e) (n ⫽ 3 mice per group). Because we had determined that B
cells were crucial for the recovery of mature HEVs, we then asked
whether this B cell activity was through LT␤R. In OXd7 LN,
HEC-6SThigh HEVs were located in the interfollicular region and
in isolated B cell clusters (Fig. 3Bc). After LT␤R-Ig treatment,
some HEVs and B cells still colocalized, but HEC-6ST did not
recover (Fig. 3B, e and f), suggesting that B cell-regulated HEV
gene recovery is mediated through the LT␤R. Taken together,
these data strongly support the concept that the role of the LT␤R
ligand on HEVs is direct and crucial, not only for initiation and
maintenance of HEVs, but also for the recovery of the mature
phenotype.
Because B cells play such an important role in HEV gene regulation, we next investigated the cell number and composition in
the draining LN after immunization. There was an increase in total
cell number, and interestingly, a disproportionate increase in B
cells (Fig. 3C). The proportion of B cells in the draining LN drastically increased from 17.8 ⫾ 1.1% at steady state to 49.4 ⫾ 0.1%
at day 4 and remained at 40.4 ⫾ 3.8% at day 7.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 2. T and/or B cells contribute to mature
HEVs but not the initiation of HEV remodeling after
OX; B cells contribute to recovery; no effect of TNFR1
deficiency. A, Immunofluorescent double staining of
HEC-6ST (green) and PNAd (red) in RAG⫺/⫺, ␮MT and
nu/nu mice. Abluminal PNAd staining is indicated by
arrows. B, The regulation of HEC-6ST after immunization in RAG⫺/⫺ (a– c) or ␮MT mice (d–f), nu/nu mice
(g–i), and TNFR1⫺/⫺ (j–l). Original magnification ⫻40,
n ⫽ 3 mice per group.
The Journal of Immunology
Afferent LV function is impaired at day 4 and recovers at day 7
after OX skin painting
The above data indicate two stages of HEV plasticity after immunization: reversion to an immature phenotype and then recovery
(Fig. 1). They also suggest that HEV recovery after immunization
requires B cells and LT␤R signaling (Figs. 2 and 3). However,
neither B cells nor cytokine signals explain the initiation of HEV
remodeling after immunization. The early effects on HEV gene
regulation after OX appeared to mimic those in previous reports of
severed afferent lymphatic vessels (19, 23, 24). This caused us to
wonder whether HEV phenotypic reversion after OX was due to
the exclusion of factor(s) arriving through the afferent LVs.
In this study, we investigated the effect of OX treatment on the
accumulation of lymph and cells arriving from afferent lymph in
the draining LNs. Afferent lymph access was investigated by monitoring Evans blue dye accumulation in draining inguinal LNs
(ILNs). Mice were preimmunized with OX for either 4 or 7 days
(OXd4 or OXd7). Evans blue was injected s.c. into the rear footpads of these and control nontreated mice. Although Evans blue
can be visualized in ILNs within 2 h and is apparent in efferent
lymph within 4 h, we found that 6 h after dye injection was the
optimal time point to distinguish the accumulation pattern in ILNs
and the surrounding skin. Six hours after Evans blue injection, dye
accumulated in the ILNs of control mice (Fig. 4A, a and d), and the
surrounding skin was only slightly blue, indicating normal LV
function. In contrast, much less dye accumulated in OXd4 ILNs
(Fig. 4A, b and e) and, in fact, it collected in the skin around the
nodes, which appeared edematous (Fig. 4Ab). This indicates an
insufficiency in afferent LV function at this time point. Blood vessel angiogenesis and efferent LV dilation was apparent, consistent
with the previous observations regarding blood and efferent lymph
flow after immunization (Fig. 4Ab). In OXd7 mice, the amount of
dye that accumulated in ILN was nearly normal (Fig. 4A, c and f)
and the edema subsided, indicating that LV function had recovered
(Fig. 4Ac). ILNs were sectioned and evaluated microscopically to
take advantage of Evans blue autofluorescence (red). In nontreated
ILNs, a dense fluorescence was apparent encircling the medullary
area, the site of the highest lymphatic vessel density; the fluorescence was much fainter in the OXd4 ILNs and recovered in OXd7
ILNs (Fig. 4A, d and f) (n ⫽ 5).
Previous studies had shown similar effects on HEVs of immunization with either OX or SRBC, and we extended these observations to OVA. Mice were preimmunized with OVA⫹CFA by s.c
injection in flanks and tail 4 or 7 days previously, and Evans blue
was injected s.c. into the rear footpads and evaluated as above. The
pattern of dye accumulation was identical with that seen after OX
immunization: it was reduced at day 4 (Fig. 4B, b and e) and
recovered at day 7 (Fig. 4B, c and f). Although edema was less
apparent in skin surrounding the LN, compared with OX (Fig. 4,
Ab and Bb), the dye collected at the Ag injection site (Fig. 4B, b
and c, circled with white dashed line). Thus, the effects on afferent
LV function after immunization are not unique to OX.
Afferent LV function, evaluated as DC access and T cell
priming, is impaired at day 4 and recovers at day 7 after
immunization with OX
Having shown that LV function impairment is a consequence of
immunization, we next asked whether there was an immunologic
consequence to the reduction in lymph access. We investigated
whether the accumulation of cells arriving from afferent lymph
was reduced. By FITC skin painting, the number of newly activated DC in draining LNs can be evaluated by FACS. Individual
mice were preimmunized with OX at different time points (day 0,
1, 2, etc., accordingly OXd0, OXd1, OXd2, etc.) on the abdomen,
and then painted on the flanks with FITC. Twenty-four hours after
FITC painting, the accumulation of FITC-labeled DCs was evaluated in ILNs. In non-OX-treated mice, 1.3% of the cells in ILNs
were FITC⫹CD11c⫹ DCs. A comparable proportion was obtained
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 3. Maintenance of mature HEV phenotype and recovery from
OX depend on LT␤R signaling mediated by B cells. A, Real-time RT-PCR
of mRNAs isolated from PLNs after LT␤R-Ig treatment. Control LFA3-Ig
(䡺) or LT␤R-Ig (f) (n ⫽ 6 LNs per group). B, LT␤R-Ig suppresses the
recovery of HEC-6ST after OX. Mice were immunized with OX, and 4
days later injected i.p. with LT␤R-Ig. Three days after LT␤R-Ig injection
(i.e., OXd7), PLNs were analyzed. a– c, Control-Ig treatment; d–f,
LT␤R-Ig treatment. PNAd (red); a and d, HEC6ST (green); b and e, Insets
show representative HEVs with merged HEC-6ST and PNAd expression;
original magnification ⫻20; c and f, B220 (red) and HEC6ST (green) double staining; original magnification ⫻10; n ⫽ 3 mice per group. C, Total
cell number per PLN and the proportion of B cells per LN after OX immunization (data are the average of ILNs from five mice per time point).
3373
3374
COORDINATION OF LVs AND HEVs
Lymphangiogenesis in the skin after immunization is associated
with recovery of afferent lymphatic vessel function
FIGURE 4. Afferent LV function is impaired at days 2–5 after OX or
OVA immunization, and recovering at day 7. A, Mice were immunized
with OX. Evans blue was s.c. injected in rear footpads and evaluated 6 h
later. The injected dye appears blue (a– c), or red autofluorescent under UV
(d–f). Whole tissue (a– c) and the sectioned ILNs (g–j), original magnification ⫻5. n ⱖ 5 mice per group. B, Mice were immunized with
OVA⫹CFA. Dye accumulation is reduced in day 4 ILNs (b and e) and
recovered at day 7 (c and f). The blue dye accumulated in the OVA⫹CFA
injection site at both days 4 and 7 (b and c, circled by white dashed line).
n ⫽ 4 mice per group.
in ILNs of vehicle-only (acetone)-treated mice (Fig. 5A). A lower
proportion of FITC⫹CD11c⫹ cells was obtained from ILNs of
OXd0 mice, with an even greater decrease in OXd1 ILNs, reaching
a nadir in OXd2 and OXd3 ILNs (0.2%). Recovery to the levels
found in nodes of nonimmunized mice was apparent in OXd5, and
the restored/enhanced accumulation of newly activated DCs continued to OXd14 (Fig. 5A). Thus, the accumulation of newly activated APCs in sensitized LNs was transiently reduced between
days 2 and 5 after OX, even though the total number of CD11c⫹
cells was actually increased after immunization (Fig. 5A and inset).
Fig. 5A shows representative results (n ⱖ 3). The decrease in access of afferent lymph to the immunized LNs and/or the increase
of efferent lymph output could explain the reduction of Evans blue
accumulation in OXd4 ILNs. However, because APCs are rare in
efferent lymph (9), the reduction of FITC⫹CD11c⫹ cell accumu-
Because afferent LV function was impaired after immunization,
we next investigated whether the vessels were disrupted at the
skin-painting site. We quantified LV number by counting the number of CD31⫹ or LYVE-1⫹ vessels under fluorescent microscopy
per entire ⫻40 field. Twenty-five random fields were counted in
skin sections in the epidermal and dermal area, excluding s.c. tissue (20 random skin sections per mouse, two mice per group). The
number of CD31⫹ vessels increased, reaching a peak at OXd4
( p ⬍ 0.001), and was maintained at OXd7, indicating angiogenesis. The number of LYVE-1⫹ vessels was comparable in OXd4
skin and nontreated skin but almost doubled in OXd7 skin ( p ⬍
0.001), indicating that lymphangiogenesis in the skin occurred and
peaked at day 7 after immunization (Fig. 6A).
LT␤R and B cells mediate HEV and LV cross-talk after
immunization
Because afferent LV biological function is transiently impaired at
day 4 after immunization and then recovers and correlates with the
recovery of the mature HEV phenotype, we next investigated
whether there was an effect on LVs in the draining LNs. First, we
evaluated LV and HEV morphology in LNs by LYVE-1 and
PNAd double staining at various times after immunization. Lymphangiogenesis in the LN was apparent as early as day 4, even
before lymphangiogenesis occurred in the skin, and peaked at day
7 after OX immunization. Dramatically, HEVs were located in the
area surrounded by the LV network (Fig. 6B, b and c). Several LVs
appeared to interact directly with HEVs (Fig. 6B, d–f, arrowhead),
suggesting the possibility of LV-HEV cross-talk. Specifically, in
OXd4 LNs, vessels appearing to express both PNAd and LYVE-1
were frequently observed, especially in those individual LVs that
were some distance away from the major LV network, suggesting
a very close interaction between these two vessels (Fig. 6Be). This
observation provides another mechanism for the recruitment of
immature blood-borne DCs via HEV in the immunized LN (30),
indicating that HEV plasticity after immunization has important
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
lation in OXd4 ILNs is likely due to impaired afferent LV access
to the LN.
The decreased accumulation of newly activated DCs in the
draining ILN also could be due to a reduced number of DCs in the
skin after immunization because of their rapid egress from that
site. However, no obvious difference in the number of MHC class
II-expressing cells was apparent in nonimmunized, OXd4 (nonimmunized side), OXd7 (nonimmunized side) skin (Fig. 5B).
Because the accumulation of newly activated APCs was transiently reduced in draining LNs, we asked whether T cells could be
primed to another Ag during this period. Nontreated, OXd2,
OXd4, and OXd7 mice were immunized with OVA in CFA in both
flanks and in the tail. Seven days later, PLNs were removed and
evaluated for T cell recall proliferation to OVA. OVA-specific
proliferation was reduced when cells were obtained from OVAOXd2 mice, compared with those from OVA-only immunized
control mice. The proliferative response of cells from OVA-OXd4
mice approached that of non-OX-treated mice and was actually
over compensated in OVA-OXd7 cells (Fig. 5B). This overcompensation which is apparent in LNs from mice treated with OX,
immunized with OVA 7 days later and then analyzed after an
additional 7 days is likely due in part to the recovery of DC arrival
and is probably also influenced by the remodeled HEVs and lymphatic vessels (see below). These results indicate that inhibition of
T cell priming to a second Ag occurs after immunization, is transient, and correlates in time with the effects on LV vessel function.
The Journal of Immunology
3375
functional consequences. These double-positive vessels were rare
in control and OXd7 LNs (n ⫽ 3 mice per group).
Because HEV gene recovery was contingent on B cells, we then
asked whether B cells also contribute to the lymphangiogenesis in
the draining LNs. No LN lymphangiogenesis occurred in OX day
4 or 7 ␮MT LNs (Fig. 6C, a– c), indicating that B cells are important in triggering lymphangiogenesis in the early time after immunization, confirming a previous observation (31). However, at
day 14 after immunization, lymphangiogenesis occurred even in
the absence of B cells, indicating that factors in addition to those
derived from B cells contribute to this process (Fig. 6Cd). Furthermore, during the extended period before lymphangiogenesis
occurred in the LNs of ␮MT mice, the effects on HEV gene expression regulation were exaggerated; PNAd expression was extremely low and MAdCAM-1 expression was dramatically increased, compared with WT mice (Fig. 6C, e– h, compare with Fig.
1A, i–l). By day 14, lymphangiogenesis occurred, PNAd recovered, and MAdCAM-1 was reduced to its normal low level (Fig.
6C, e– h). The correlation between lymphangiogenesis and HEV
phenotype regulation after immunization in ␮MT mice emphasizes
the synchrony between LV and HEV.
We previously found that LT␤R is expressed on PNAd-positive
HEVs (27). In this study, we extended these findings and also
found coexpression of LYVE-1 and LT␤R on HEVs from LNs of
unimmunized mice (Fig. 6D, a and b). Thus, both HEVs and LVs
express the LT␤R.
We next asked whether LV and HEV cross-talk is mediated by
LT␤R. Mice were injected i.p. with 100 ␮g/mouse of either
LT␤R-Ig or control-Ig 24 h before OX immunization. PLNs were
analyzed 4 days after OX (OXd4). PNAd⫹LYVE-1⫹ vessels are
yellow in the merged image (arrowhead) (Fig. 6Ea). Pretreatment
with LT␤R-Ig did not significantly affect the number of vessels
that stained individually with MECA-79 or anti-LYVE-1 but did
drastically reduce the number of vessels positive for both markers
( p ⬍ 0.001) (Fig. 6Eb), indicating that signaling through the
LT␤R mediates LV and HEV cross-talk.
Discussion
Data in this communication describe the regulation and plasticity
of HEVs and the regulation and plasticity of LVs and thus reveal
the intimate functional relationship between these vascular systems. They confirm the previous observations of our group (3, 27)
and others (29) that the LT␤R is crucial for regulation of HEV
gene expression. We extend these observations to situations of
immunization, demonstrate the significant role of B cells in recovery of HEV maturity after immunization, and, importantly, reveal
that control of the LT␤R itself, is a crucial aspect of HEV regulation. Next, we show the plasticity of LVs with loss of function
and subsequent lymphangiogenesis in the course of immunization,
with remodeling in both the skin and the LN. The LT␤R is again
implicated in its expression on LVs, and B cells are seen as important, but not the sole, players in the remodeling of LVs. There
is a temporal concordance in the function of LVs and the maturity
of HEVs. The concordance in time, function, LT␤R expression,
the importance of B cells, and the close physical contact between
LVs and HEVs in the remodeling process provide insight into the
nature of the cross-talk and synchrony of HEVs and LVs.
Remodeling after immunization reveals HEV plasticity and
involves the LT␤R
The plasticity of HEVs during an immune response is evidenced
by the HEV remodeling process, which involves down-regulation
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 5. Preimmunization affects LN function with regard to DC accumulation and T cell priming. A, Accumulation of newly activated DCs
(FITC⫹CD11c⫹) in LNs from preimmunized mice. Mice were preimmunized with OX (in acetone) or acetone (only) on the abdomen at the indicated time
points (OXd0, OXd1, OXd2, etc.). FITC was painted on flanks of these or control mice and analyzed 24 h later. Inset, Total cell number per ILN after FITC
painting. n ⱖ 3 mice per group. B, MHC class II staining in skin from control (nonimmunized), OXd4 (nonimmunized side), and OXd7 (nonimmunized
side) mice. C, Nontreated, OXd2, OXd4, or OXd7 mice (immunized once with OX on the abdomen 2, 4, or 7 days previously) were immunized with
OVA⫹CFA and PLN were harvested 7 days later for T cell recall proliferation to OVA. Medium only 䡺, OVA 1.0 mg/ml f, n ⫽ 3 mice per group.
3376
COORDINATION OF LVs AND HEVs
of mature HEV genes on existing HEVs, and, most likely, generation of new HEVs. This remodeling process is a common phenomenon after immunization with a variety of Ags: contact allergens, OX as reported in this study, and 2, 4-dinitrofluorobenzene
(32), SRBC (18, 19), and OVA (Ref. 29 and data not shown). The
initiation of HEV remodeling does not require an adaptive immune
response, because it occurs in the absence of T and/or B cells
(RAG⫺/⫺, ␮MT, and nu/nu mice). Our data provide evidence that
the LT␤R is not only crucial for induction of HEV gene expression
and maintenance, but also plays a critical role during the HEV
remodeling period. Continuous LT␤R signaling is required to
maintain HEVs; LT␤R signaling is required for HEV recovery
after OX; the LT␤R itself requires LT␤R activity to maintain its
expression; the LT␤R is down-regulated at OXd4, which impairs
LT␤R signaling activity on HEVs. Finally, B cells, a likely source
of LT␣1␤2, were found to be essential for HEV recovery. Treatment with LT␤R-Ig results in down-regulation of MAdCAM-1,
whereas immunization initially results in an increase in expression
of that adhesion molecule, and then a reversion. This difference
suggests that HEV remodeling after OX is more complicated than
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 6. LT␤R and B cells mediate LV and HEV cross-talk after immunization. A, The number of CD31⫹ and LYVE-1⫹ vessels after OX were
counted in skin. Results are the average number of CD31⫹ or LYVE-1⫹ vessels under fluorescent microscopy per entire ⫻40 field. Twenty-five random
fields from 40 random skin sections, two mice per group. B, PNAd (red) and LYVE-1 (green) staining demonstrate the kinetics of lymphangiogenesis in
LNs. HEVs were surrounded by LVs after immunization. Direct interaction between LV and HEV is indicated by arrowhead. d–f, Hematoxylin counter
staining is shown. C, No lymphangiogenesis in ␮MT mice in the first 7 days after immunization (a– d), original magnification ⫻5. e– h, MAdCAM-1
expression was exaggerated and protracted in ␮MT mice. n ⫽ 3 mice per group, original magnification ⫻20. D, LT␤R is expressed on HEVs and lymphatic
vessels (a). Coexpression of LT␤R (red) and LYVE-1 (green) on lymphatic vessels in medullary area of LN from an unimmunized mouse (b), the circled
areas show LYVE-1 negative vessels (HEVs) that express LT␤R, original magnification ⫻40, n ⫽ 3 mice. E, The occurrence of vessels positive for both
LYVE-1 and PNAd is apparent after immunization and depends on the LT␤R. Mice were pretreated with control-Ig or LT␤R-Ig 24 h before OX
immunization. PLNs were analyzed at OXd4. a. representative merged pictures of PNAd and LYVE-1 immunofluorescence double staining, the doublepositive vessel show in yellow (arrowhead); pictures were taken at areas of HEV-rich but away from the major LV network, original amplification ⫻20.
b, The number of vessels per ⫻20 image as described above, 10 random images were counted (ⴱ, p ⫽ 0.23; ⴱⴱ, p ⫽ 0.21; ⴱⴱⴱ, p ⬍ 0.001, n ⫽ 2 mice
per group).
The Journal of Immunology
3377
simply blocking LT␤R signaling. MAdCAM-1 might respond differently to the transient down-regulation of LT␤R after OX treatment than to the sustained blockage of LT␤R signaling following
LT␤R-Ig treatment.
Remodeling of LVs after immunization
Between 2 and 5 days after immunization, the function of afferent
LVs, but not LNs or efferent LVs, is severely compromised, as
demonstrated by restricted access of Evans blue and FITC⫹ DCs;
a later rebound occurs. The fact that Angeli et al. (31) did not
observe the transient insufficiency but did see the later rebound is
most likely due to difference in immunization regimens. Several
nonexclusive mechanisms most likely contribute to the early functional insufficiency. First, the steady-state function of LVs is probably inadequate to offset the increased interstitial fluid induced by
vasodilation at OXd4. The fact that insufficiency also was induced
by OVA immunization, a condition that results in less edema, suggests that fluid accumulation is not the sole explanation for these
effects. Second, OX immunization might impair the LVs themselves. The strong acute inflammation might disrupt LVs and/or
the increased afferent lymph cell content might obstruct LVs. The
enlarged LNs also might increase LN internal pressure, causing the
collapse of the afferent LVs. A third possibility is that in the course
of lymphangiogenesis in the skin, immature LVs might not facilitate APC travel to the LNs. The increased numbers of LYVE-1⫹
vessels observed in OXd7 skin suggests that lymphangiogenesis
occurs at the immunization site. The increased numbers of LVs
thereby offset the increased interstitial fluid, and the skin edema
subsides by OXd7.
As noted above, LV insufficiency at day 4 after a single immunization is not restricted to OX immunization, because the reduced
accumulation of Evans blue also was seen in the draining ILNs of
mice immunized with OVA⫹CFA. Even though there was no obvious edema observed at day 4 after OVA immunization, the dye
actually accumulated in the OVA injection site and not in the LN.
Therefore, the edema observed in OXd4 skin is the result of LV
insufficiency rather than the cause of impaired LV function. Nevertheless, OX might be an extreme situation with regards to LV
insufficiency at day 4 after immunization, because immunization
with OX (in acetone), presumably toxic, affects a much wider area
of skin than does OVA s.c. injection. Lymphangiogenesis also was
observed in OVA⫹CFA injection site at day 7 (data not shown),
indicating that immunization-induced lymphangiogenesis in skin
is not limited to OX immunization.
Lymphangiogenesis occurs in LNs after immunization and, as in
HEV regulation, is influenced by B cells (Ref. 31 and Fig. 6B).
The expression of LT␤R on LVs, as on HEVs, suggests that signaling through that receptor could contribute to these events. The
important role of B cells in the early time point after immunization
also was indicated by the dramatic influx of B cells in the draining
LN. However, lymphangiogenesis occurred in ␮MT mice in the
absence of B cells, albeit at a slower pace, indicating that factors
in addition to B cells contribute to lymphangiogenesis. Lymphangiogenesis has been noted in chronic inflammation (33, 34)
and even in acute inflammation in which macrophages have been
implicated.
LVs and HEVs are tightly coordinated
Mature HEVs are maintained by LT␤R and factors arriving
through afferent LV. Severing afferent LVs prevents the accumulation
of afferent lymph factor(s) in LNs; immunization temporarily impairs
afferent LV function, resulting in the transient reduction of lymph
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 7. The mechanism of LV and HEV remodeling after immunization. HEV gene regulation after immunization is in synchrony with the
alterations in lymphatic vessel morphology and function through B cells and LT␤R.
3378
Acknowledgments
We thank Cheryl Bergman for her invaluable technical assistance, Werner
Lesslauer for helpful comments, and Jeffrey Browning (Biogen Idec) for
the gift of LT␤R-Ig and control-Ig.
Disclosures
The authors have no financial conflict of interest.
References
1. Bistrup, A., S. Bhakta, J. K. Lee, Y. Y. Belov, M. D. Gunn, F. R. Zuo,
C. C. Huang, R. Kannagi, S. D. Rosen, and S. Hemmerich. 1999. Sulfotransferases of two specificities function in the reconstitution of high endothelial cell
ligands for L-selectin. J. Cell Biol. 145: 899 –910.
2. Hiraoka, N., B. Petryniak, J. Nakayama, S. Tsuboi, M. Suzuki, J. C. Yeh,
D. Izawa, T. Tanaka, M. Miyasaka, J. B. Lowe, and M. Fukuda. 1999. A novel,
high endothelial venule-specific sulfotransferase expresses 6-sulfo sialyl
Lewis(x), an L-selectin ligand displayed by CD34. Immunity 11: 79 – 89.
3. Drayton, D. L., X. Ying, J. Lee, W. Lesslauer, and N. H. Ruddle. 2003. Ectopic
LT␣␤ directs lymphoid organ neogenesis with concomitant expression of peripheral node addressin and a HEV-restricted sulfotransferase. J. Exp. Med. 197:
1153–1163.
4. Ying, X., K. Chan, P. Shenoy, M. Hill, and N. H. Ruddle. 2005. Lymphotoxin
plays a crucial role in the development and function of nasal associated lymphoid
tissue through regulation of chemokines and peripheral node addressin.
Am. J. Pathol. 166: 135–146.
5. Bistrup, A., D. Tsay, P. Shenoy, M. S. Singer, N. Bangia, S. A. Luther,
J. G. Cyster, N. H. Ruddle, and S. D. Rosen. 2004. Detection of a sulfotransferase
(HEC-GlcNAc6ST) in high endothelial venules of lymph nodes and in high endothelial venule-like vessels within ectopic lymphoid aggregates: relationship to
the MECA-79 epitope. Am. J. Pathol. 164: 1635–1644.
6. Baddoura, F. K., I. W. Nasr, B. Wrobel, Q. Li, N. H. Ruddle, and F. G. Lakkis.
2005. Lymphoid neogenesis in murine cardiac allografts undergoing chronic rejection. Am. J. Transplant 5: 510 –516.
7. Mebius, R. E., P. R. Streeter, S. Michie, E. C. Butcher, and I. L. Weissman. 1996.
A developmental switch in lymphocyte homing receptor and endothelial vascular
addressin expression regulates lymphocyte homing and permits CD4⫹CD3⫺
cells to colonize lymph nodes. Proc. Natl. Acad. Sci. USA 93: 11019 –11024.
8. Hong, Y. K., J. W. Shin, and M. Detmar. 2004. Development of the lymphatic
vascular system: a mystery unravels. Dev. Dyn. 231: 462– 473.
9. Randolph, G. J., V. Angeli, and M. A. Swartz. 2005. Dendritic-cell trafficking to
lymph nodes through lymphatic vessels. Nat. Rev. Immunol. 5: 617– 628.
10. Hay, J. B., and B. B. Hobbs. 1977. The flow of blood to lymph nodes and its
relation to lymphocyte traffic and the immune response. J. Exp. Med. 145: 31– 44.
11. Ottaway, C. A., and D. M. Parrott. 1979. Regional blood flow and its relationship
to lymphocyte and lymphoblast traffic during a primary immune reaction. J. Exp.
Med. 150: 218 –230.
12. He, C., A. J. Young, C. A. West, M. Su, M. A. Konerding, and S. J. Mentzer.
2002. Stimulation of regional lymphatic and blood flow by epicutaneous oxazolone. J. Appl. Physiol. 93: 966 –973.
13. Soderberg, K. A., G. W. Payne, A. Sato, R. Medzhitov, S. S. Segal, and
A. Iwasaki. 2005. Innate control of adaptive immunity via remodeling of lymph
node feed arteriole. Proc. Natl. Acad. Sci. USA 102: 16315–16320.
14. Myking, A. O. 1980. Morphological changes in paracortical high endothelial
venules to single and repeated application of oxazolone to mouse skin. Virchows.
Arch. B. Cell Pathol. Incl. Mol. Pathol. 35: 63–71.
15. Mebius, R. E., J. Breve, A. M. Duijvestijn, and G. Kraal. 1990. The function of
high endothelial venules in mouse lymph nodes stimulated by oxazolone. Immunology 71: 423– 427.
16. Hay, J. B., M. G. Johnston, P. Vadas, W. Chin, T. Issekutz, and H. Z. Movat.
1980. Relationships between changes in blood flow and lymphocyte migration
induced by antigen. Monogr. Allergy 16: 112–125.
17. Oort, J., and J. L. Turk. 1965. A histological and autoradiographic study of lymph
nodes during the development of contact sensitivity in the guinea-pig. Br. J. Exp.
Pathol. 46: 147–154.
18. Hoke, D., R. E. Mebius, N. Dybdal, D. Dowbenko, P. Gribling, C. Kyle,
S. Bamhueter, and S. R. Watson. 1995. Selective modulation of the expression of
L-selectin ligands by and immune response. Current Biol. 5: 670 – 678.
19. Swarte, V. V., R. E. Mebius, D. H. Joziasse, D. H. Van den Eijnden, and G. Kraal.
1998. Lymphocyte triggering via L-selectin leads to enhanced galectin-3-mediated binding to dendritic cells. Eur. J. Immunol. 28: 2864 –2871.
20. Drayson, M. T., and W. L. Ford. 1984. Afferent lymph and lymph borne cells:
their influence on lymph node function. Immunobiology 168: 362–379.
21. Hendriks, H. R., and I. L. Eestermans. 1983. Disappearance and reappearance of
high endothelial venules and immigrating lymphocytes in lymph nodes deprived
of afferent lymphatic vessels: a possible regulatory role of macrophages in lymphocyte migration. Eur. J. Immunol. 13: 663– 669.
22. Hendriks, H. R., A. M. Duijvestijn, and G. Kraal. 1987. Rapid decrease in lymphocyte adherence to high endothelial venules in lymph nodes deprived of afferent lymphatic vessels. Eur. J. Immunol. 17: 1691–1695.
23. Mebius, R. E., P. R. Streeter, J. Breve, A. M. Duijvestijn, and G. Kraal. 1991. The
influence of afferent lymphatic vessel interruption on vascular addressin expression. J. Cell Biol. 115: 85–95.
24. Mebius, R. E., D. Dowbenko, A. Williams, C. Fennie, L. A. Lasky, and
S. R. Watson. 1993. Expression of GlyCAM-1, an endothelial ligand for L-selectin, is affected by afferent lymphatic flow. J. Immunol. 151: 6769 – 6776.
25. Myking, A. O. 1979. Dose dependency of the responses in draining lymph nodes
and skin to repeated applications of oxazolone: a quantitative and histological
study in mice. Virchows. Arch. B. Cell Pathol. Incl. Mol. Pathol. 32: 21–31.
26. Myking, A. O. 1979. Responses of the thymus and the paracortex of draining
lymph nodes to repeated applications of oxazolone to mouse skin. Virchows.
Arch. B. Cell Pathol. Incl. Mol. Pathol. 32: 11–20.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
factor(s) accumulation in the draining LNs. Both procedures result
in HEV reversion to an immature phenotype (MAdCAM-1high),
suggesting that HEV remodeling is actually the consequence of
LV functional inefficiency after immunization.
We propose a model for LV and HEV remodeling after immunization (Fig. 7). After an immunization-priming period (day 0 –2),
HEVs undergo remodeling. During the remodeling period (day
2–5), angiogenesis in the skin peaks at day 4 and the number of
HEVs increases. The efferent LV function remains elevated. B
cells trigger early lymphangiogenesis in the LN. In contrast, afferent LVs are functionally insufficient, resulting in accumulation
of fluid at the immunization site. Consequently, the accumulation
of afferent lymph factors (lymph and cells) is reduced in draining
LNs. T cell priming to a second Ag also is inhibited at this time
point. HEVs are thus exposed to a reduced amount of newly arrived lymph factors. Meanwhile, LT␤R expression on HEVs is
diminished. HEVs therefore lack continuous stimulator(s) arriving
from LVs and reduce their LT␤R activity and display an immature
HEV phenotype (MAdCAM-1highHEC-6STlow), the same gene expression pattern observed after severing afferent LVs. After the
remodeling period (days 7–10), lymphangiogenesis peaks at day 7
in both LNs and the immunization site (skin) and LV function
recovers. HEVs are surrounded by LV network. LT␤R also is restored. Sufficient lymph factors arrive in the LN to stimulate HEVs
and LT␤R activity, and the mature phenotype is recovered (Fig. 7).
The expression of LT␤R on LVs and HEVs is consistent with
the notion that LT␤R signaling coordinates these two vascular systems, and we suggest that, in addition to B cells, LT␤R signal
activator(s) are delivered by afferent lymph. It is likely that cells in
lymph, expressing or capable of inducing the LT␤R ligands,
LT␣1␤2 or LIGHT, are these LT␤R signal activator(s). During the
steady state, immature DCs continually migrate into LNs through
afferent LV and die locally within several days (35–37). Because
immature DCs express LIGHT (38), they could migrate to HEVs
to directly activate the LT␤R signal, although it has been reported
that activated DCs do not contact HEVs (39). DCs also express
LT␤R, and signaling through that receptor is important in their
homeostasis (40). The activated DCs line up around HEVs to interact with newly homed T cells (41), and thus they might interact
with T cells and activate them to increase expression of LT␣␤ or
LIGHT and thus indirectly signal LT␤R on HEVs. The tight interaction between LVs and HEVs in the remodeling period suggests the intriguing possibility that factors may directly diffuse
from LVs to HEVs and influence gene expression. Support for this
hypothesis is provided by the observations of Gretz et al. (42) and
Sixt and colleagues (43), who noted the presence of tracer in the
lumen of HEVs after s.c. injection of labeled dextran.
What could be the purpose of the extensive remodeling of HEVs
and LVs after immunization? The reduction in Ag access and HEV
maturity may serve to prevent an immune response from escalating
out of control and may reduce the possibility of an inappropriate
response to self Ags in a highly activated environment. We have
found that the transient reduction in LN access does have functional consequences when mice are immunized in that period (S.
Liao and N. H. Ruddle, manuscript in preparation). In contrast, in
the later time after immunization, the generation of new LVs, the
maturation of HEVs, and the overcompensated response to a second immunization may set the scene for the generation of memory.
COORDINATION OF LVs AND HEVs
The Journal of Immunology
36.
37.
38.
39.
40.
41.
42.
43.
dritic cell function in vivo during the steady state: a role in peripheral tolerance.
Ann. NY Acad. Sci. 987: 15–25.
Kamath, A. T., S. Henri, F. Battye, D. F. Tough, and K. Shortman. 2002. Developmental kinetics and lifespan of dendritic cells in mouse lymphoid organs.
Blood 100: 1734 –1741.
Wilson, N. S., D. El-Sukkari, G. T. Belz, C. M. Smith, R. J. Steptoe, W. R. Heath,
K. Shortman, and J. A. Villadangos. 2003. Most lymphoid organ dendritic cell
types are phenotypically and functionally immature. Blood 102: 2187–2194.
Tamada, K., K. Shimozaki, A. I. Chapoval, Y. Zhai, J. Su, S. F. Chen,
S. L. Hsieh, S. Nagata, J. Ni, and L. Chen. 2000. LIGHT, a TNF-like molecule,
costimulates T cell proliferation and is required for dendritic cell-mediated allogeneic T cell response. J. Immunol. 164: 4105– 4110.
Lindquist, R. L., G. Shakhar, D. Dudziak, H. Wardemann, T. Eisenreich,
M. L. Dustin, and M. C. Nussenzweig. 2004. Visualizing dendritic cell networks
in vivo. Nat. Immunol. 5: 1243–1250.
Kabashima, K., T. A. Banks, K. M. Ansel, T. T. Lu, C. F. Ware, and J. G. Cyster.
2005. Intrinsic lymphotoxin-␤ receptor requirement for homeostasis of lymphoid
tissue dendritic cells. Immunity 22: 439 – 450.
Mempel, T. R., S. E. Henrickson, and U. H. Von Andrian. 2004. T-cell priming
by dendritic cells in lymph nodes occurs in three distinct phases. Nature 427:
154 –159.
Gretz, J. E., C. C. Norbury, A. O. Anderson, A. E. Proudfoot, and S. Shaw. 2000.
Lymph-borne chemokines and other low molecular weight molecules reach high
endothelial venules via specialized conduits while a functional barrier limits access to the lymphocyte microenvironments in lymph node cortex. J. Exp. Med.
192: 1425–1440.
Sixt, M., N. Kanazawa, M. Selg, T. Samson, G. Roos, D. P. Reinhardt, R. Pabst,
M. B. Lutz, and L. Sorokin. 2005. The conduit system transports soluble antigens
from the afferent lymph to resident dendritic cells in the T cell area of the lymph
node. Immunity 22: 19 –29.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
27. Drayton, D. L., G. Bonizzi, X. Ying, S. Liao, M. Karin, and N. H. Ruddle. 2004.
I␬B kinase complex ␣ kinase activity controls chemokine and high endothelial
venule gene expression in lymph nodes and nasal-associated lymphoid tissue.
J. Immunol. 173: 6161– 6168.
28. Wu, Q., Y. Wang, J. Wang, E. O. Hedgeman, J. L. Browning, and Y. X. Fu. 1999.
The requirement of membrane lymphotoxin for the presence of dendritic cells in
lymphoid tissues. J. Exp. Med. 190: 629 – 638.
29. Browning, J. L., N. Allaire, A. Ngam-Ek, E. Notidis, J. Hunt, S. Perrin, and
R. A. Fava. 2005. Lymphotoxin-␤ receptor signaling is required for the homeostatic control of HEV differentiation and function. Immunity 23: 539 –550.
30. Yoneyama, H., K. Matsuno, Y. Zhang, T. Nishiwaki, M. Kitabatake, S. Ueha,
S. Narumi, S. Morikawa, T. Ezaki, B. Lu, et al. 2004. Evidence for recruitment
of plasmacytoid dendritic cell precursors to inflamed lymph nodes through high
endothelial venules. Int. Immunol. 16: 915–928.
31. Angeli, V., F. Ginhoux, J. Llodra, L. Quemeneur, P. S. Frenette, M. Skobe,
R. Jessberger, M. Merad, and G. J. Randolph. 2006. B cell-driven lymphangiogenesis in inflamed lymph nodes enhances dendritic cell mobilization. Immunity
24: 203–215.
32. Betts, C. J., J. G. Moggs, H. T. Caddick, M. Cumberbatch, G. Orphanides,
R. J. Dearman, C. A. Ryan, B. C. Hulette, G. F. Gerberick, and I. Kimber. 2003.
Assessment of glycosylation-dependent cell adhesion molecule 1 as a correlate of
allergen-stimulated lymph node activation. Toxicology 185: 103–117.
33. Kerjaschki, D., H. M. Regele, I. Moosberger, K. Nagy-Bojarski, B. Watschinger,
A. Soleiman, P. Birner, S. Krieger, A. Hovorka, G. Silberhumer, et al. 2004.
Lymphatic neoangiogenesis in human kidney transplants is associated with immunologically active lymphocytic infiltrates. J. Am. Soc. Nephrol. 15: 603– 612.
34. Maruyama, K., M. Ii, C. Cursiefen, D. G. Jackson, H. Keino, M. Tomita,
N. Van Rooijen, H. Takenaka, P. A. D’Amore, J. Stein-Streilein, et al. 2005.
Inflammation-induced lymphangiogenesis in the cornea arises from CD11b-positive macrophages. J. Clin. Invest. 115: 2363–2372.
35. Steinman, R. M., D. Hawiger, K. Liu, L. Bonifaz, D. Bonnyay, K. Mahnke,
T. Iyoda, J. Ravetch, M. Dhodapkar, K. Inaba, and M. Nussenzweig. 2003. Den-
3379