Published November 6, 2015
o r i g i n a l r es e a r c h
Genes Encoding Aluminum-Activated Malate
Transporter II and their Association with Fruit Acidity
in Apple
Baiquan Ma, Liao Liao, Hongyu Zheng, Jie Chen, Benhong Wu,
Collins Ogutu, Shaohua Li, Schuyler S. Korban, and Yuepeng Han*
Abstract
A gene encoding aluminum-activated malate transporter (ALMT)
was previously reported as a candidate for the Ma locus controlling acidity in apple (Malus × domestica Borkh.). In this study, we
found that apple ALMT genes can be divided into three families
and the Ma1 gene belongs to the ALMTII family. Duplication of
ALMTII genes in apple is related to the polyploid origin of the
apple genome. Divergence in expression has occurred between
the Ma1 gene and its homologs in the ALMTII family and only the
Ma1 gene is significantly associated with malic acid content. The
Ma locus consists of two alleles, Ma1 and ma1. Ma1 resides in
the tonoplast and its ectopic expression in yeast was found to
increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast,
ma1 encodes a truncated protein because of a single nucleotide
substitution of G with A in the last exon. As this truncated protein
resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the Ma1Ma1
genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the Ma1 gene. In addition, variations in the
malic acid content of mature fruits were also observed between
accessions with the same genotype in the Ma locus. This suggests that the Ma gene is not the only genetic determinant of fruit
acidity in apple.
Published in The Plant Genome 8
doi: 10.3835/plantgenome2015.03.0016
© Crop Science Society of America
5585 Guilford Rd., Madison, WI 53711 USA
An open-access publication
All rights reserved. No part of this periodical may be reproduced or
transmitted in any form or by any means, electronic or mechanical,
including photocopying, recording, or any information storage and
retrieval system, without permission in writing from the publisher.
Permission for printing and for reprinting the material contained herein
has been obtained by the publisher.
the pl ant genome

november 2015

vol . 8, no . 3 A
pple is one of the most important fruit trees in temperate regions, and displays a juvenile period of 6 to
10 yr or even longer. The apple genome is highly heterozygous because of self-incompatibility. Genetic improvement of apple using conventional breeding methods
is hampered by this long juvenile phase. To improve
the efficiency of apple breeding efforts, it is critical to
accurately identify young seedlings possessing desirable horticultural traits early using molecular-marker
assisted selection. In the past few decades, several studies
have been conducted to identify molecular markers that
are closely linked to either major genes or quantitative
trait loci (QTLs) controlling economically important
traits in apple, including plant architecture (Kenis and
Keulemans, 2007; Segura et al., 2008), disease resistance
(Xu and Korban, 2002; Belfanti et al., 2004; Le Roux et
al., 2010), bud dormancy (Brunel et al., 2002; Dyk et al.,
B. Ma, L. Liao, H. Zheng, C. Ogutu, S. Li, and Y. Han, Key Lab.
of Plant Germplasm Enhancement and Specialty Agriculture,
Wuhan Botanical Garden of the Chinese Academy of Sciences,
Wuhan, 430074, P.R. China; J. Chen and B. Wu, Beijing Key
Lab. of Grape Sciences and Enology, and Key Lab. of Plant
Resources, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China; B. Ma, H. Zheng, J. Chen, and C. Ogutu,
Graduate Univ. of Chinese Academy of Sciences, 19A Yuquanlu,
Beijing, 100049, P.R. China; S.S. Korban, Dep. of Biology, Univ.
of Massachusetts-Boston, Boston, MA 02184 USA. Received 25
Mar. 2015. Accepted 27 May 2015. *Corresponding author
([email protected]).
Abbreviations: ALMT, aluminum-activated malate transporter;
CAPS, cleaved and amplified polymorphic sequence; FW, fresh
weight; GFP, green fluorescent protein; LG, linkage group; PCR,
polymerase chain reaction; qRT-PCR, quantitative real-time PCR;
QTL, quantitative trait locus; SNP, single-nucleotide polymorphism; SSR, simple sequence repeat; YPDA, yeast peptone dextrose adenine.
1
of
14
2010), and fruit quality (Espley et al., 2009; Mellidou et
al., 2012; Longhi et al., 2012, 2013; Khan et al., 2012b,
Zhang et al., 2012).
Genetic mapping in apple, as well as in other fruit
trees, is usually undertaken using experimental populations derived from biparental crosses. However, establishing and maintaining biparental crosses and progenies
of fruit trees are very difficult and costly. In addition,
genetic resolution of QTL maps is often limited because
only limited numbers of meiotic events occur within a
biparental mapping population (Flint-Garcia et al., 2003).
These negative factors, together with the long juvenile
phase, significantly contribute to the low efficiency of
linkage mapping, particularly for fruit quality traits. As a
result, despite numerous linkage mapping studies being
conducted for a variety of fruit tree species, only a few
genes have been cloned using linkage-based mapping
(Khan and Korban, 2012).
Recently, an alternative approach, known as association mapping, has become increasingly popular in
pursuing genetic mapping studies in plants, as it has demonstrated promise in overcoming the limitations of linkage mapping (Rafalski, 2010). Association mapping, also
referred to as linkage disequilibrium mapping, identifies
genetic polymorphisms that are significantly associated
with phenotypic variation. Compared to QTL mapping,
association mapping offers several advantages, including:
(i) a reduced timeframe because of the use of an existing
natural population instead of a progeny resulting from a
biparental cross, (ii) the availability of greater allele numbers, and (iii) higher mapping resolution, as it exploits
historical and evolutionary recombination events at the
population level (Flint-Garcia et al., 2005; Yu and Buckler,
2006). Association analysis is divided into genome-wide
association study and candidate gene association analysis.
In genome-wide association study, a high density of single-nucleotide polymorphisms (SNPs) across the genome
is often used to test potential loci associated with phenotypic variation. Candidate gene association analysis relies
on developing molecular tags of potential candidate genes
for detecting their association with phenotypic variation.
To date, association mapping has been successfully
used to identify candidate genes responsible for complex
traits of interest in a variety of plants such as maize (Zea
mays L.), pine (Pinus taeda L.), and Arabidopsis thaliana
(L.) Heynh. (Thornsberry et al., 2001; Gonzalez-Martinez
et al., 2007; Ehrenreich et al., 2009; Li et al., 2013). With
the release of the entire genome sequences of several fruit
species including grape (Vitis vinifera L.) (Jaillon et al.,
2007), apple (Velasco et al., 2010), peach (Prunus persica
(L.) Batsch.)(Verde et al., 2013), pear (Pyrus communis
L.)(Wu et al., 2013), and Citrus (Xu et al., 2013), several
commercial SNP arrays have been developed (Chagné
et al., 2012; Khan et al., 2012a; Myles et al., 2010; Verde
et al., 2012), paving the way for pursuing association
mapping studies. For example, association mapping
has recently been reported in apple (Kumar et al., 2012,
2013). In addition, association mapping combined with
2
of
14
QTL mapping has also been conducted in both apple and
grapevine (Fournier-Level et al., 2010; Dunemann et al.,
2012; Khan et al., 2013a; Longhi et al., 2013).
Fruit quality is a highly desirable trait in fruit
breeding efforts. Organic acids, together with sugars
and aromas, contribute to the taste of fresh apple fruits.
In mature apple fruits, malic acid is the predominant
organic acid, accounting for about 90% of the total
organic acid content (Wu et al., 2007; Zhang et al., 2012).
To date, several studies have been performed to identify
QTLs responsible for apple fruit acidity. A major QTL
(designated Ma) has been mapped onto the top of Linkage Group (LG) 16 (Maliepaard et al., 1998; Liebhard et
al., 2003; Kenis et al., 2008). More recently, a gene encoding ALMT was identified as a potential candidate for the
Ma locus (Bai et al., 2012; Khan et al., 2013b). Apple is a
diploid but has a polyploid origin (Velasco et al., 2010). It
is unclear whether the homologs of the Ma1 gene are also
responsible for fruit acidity, although several QTLs other
than the Ma locus have been reported in apple (Liebhard et al., 2003; Kenis et al., 2008). Overall knowledge
of genetic basis of the biosynthesis and accumulation of
malic acid in apple fruits is still limited.
Recently, we initiated the measurement of fruit quality characteristics in apple germplasm and found that
fruit acidity is likely to have undergone selection during
apple domestication (Ma et al., 2015). The malic acid database of apple germplasm also provides an opportunity to
investigate the genetic basis of fruit acidity using the association mapping method. Since duplicated genes often
share redundant functions (Qian et al., 2010), we investigated the effect of homologs of the Ma1 gene on fruit
acidity using candidate gene-based association mapping.
The subcellular localization and functionality of the Ma1
gene were also investigated. This present study not only
provides an insight into the role of the Ma1 gene in determining fruit acidity in apple but it also demonstrates that
candidate gene-based association mapping is an efficient
strategy for identifying the genes involved in complex
traits in apple and perhaps in other fruit species as well.
Materials and Methods
Plant Material
The apple collection used in this study is maintained
at the Xingcheng Institute of Pomology of the Chinese
Academy of Agricultural Sciences, Xingcheng, Liaoning,
China. The collection consists of 352 cultivars or accessions that were reported in our previous study (Ma et
al., 2015) and one Chinese wild accession ‘Lenghaitang’
(Supplemental File 1).
For the accession Lenghaitang, a leaf sample was
collected in spring and a fruit sample was collected at
maturity in 2010. The maturity was assessed by checking the color of the peel and a confirmation of the seed
color changing to brown. Each accession had three replicates consisting of ten fruits. Fruit skins were peeled
off and the flesh was then cut into small sections. Both
the pl ant genome

november 2015

vol . 8, no . 3
fruit and leaf samples of Lenghaitang were immediately
frozen in liquid N, and then stored at -75°C until use.
Leaf samples of the other 352 accessions were the same as
described in our previous study (Ma et al., 2015).
Measurements of Malic Acid Contents
in Apple Fruits
The measurement of malic acid content was only conducted for the accession Lenghaitang according to our
previous protocol (Ma et al., 2015). Briefly, 5 g of frozen
fruit were ground into powder in liquid N, homogenized
with 20 mL ddH2O, and incubated at room temperature
for 5 min. The mixture was then centrifuged at 12,000
rpm for 15 min at 4°C. The supernatant was filtered
successively through solid phase extraction [Sep-Pak
C18 Vac 35-cc cartridges (Waters, Milford, MA)] and
a 0.22-mM millipore membrane. The filtered fluid was
used for measurement of malic acid content using highperformance liquid chromatography, and the standard
malic acid was purchased from Sigma (St. Louis, MO).
The malic acid contents of the other 352 accessions were
measured in our previous study (Ma et al., 2015).
Development of Molecular Tags of ALMT
Genes and their Utility in Genotyping Individuals
in an Apple Collection
Genomic DNA sequences of ALMT genes were retrieved
from the draft genome of the cultivar Golden Delicious
(Velasco et al., 2010) to design and develop SSR and
SNP markers. Simple sequence repeats were identified
using the Microsatellite Repeats Finder program (http://
insilico.ehu.es/mini_tools/microsatellites/, accessed 30
June 2015), and primers flanking SSR loci were designed
using Primer version 3.0 (http://biotools.umassmed.edu/
bioapps/primer3_www.cgi, accessed 30 June 2015). In
addition, a SNP in the coding region of Ma1 was used to
develop a cleaved and amplified polymorphic sequence
(CAPS) marker and the corresponding primer sequences
are as follows: 5’-AGAGTTGGTGTGGAATGTGC-3’ and
5’-TTGCCTTCTCACTCAGCTCT-3’. Amplification was
performed using the following sequence: 95°C 5 min, 35
cycles of 30 s at 95°C, 30 s at 60°C, and 45 s at 72°C, with
a final extension of 10 min at 72°C.
A total of 5 mL of polymerase chain reaction (PCR)
products was mixed with an equal volume of loading
buffer (98% formamide, 0.05% bromophenol blue, 0.05%
xylene cyanol, and 10 mM NaOH), denatured at 95°C
for 5 min, then immediately chilled on ice. Denatured
PCR products were resolved on 8% denaturing polyacrylamide gel in 1× tris(hydroxymethyl)aminomethane-acetate-ethylenediaminetetraacetic acid buffer (40 mM Trisacetate, 20 mM acetic acid, and 1 mM ethylenediaminetetraacetic acid). Electrophoresis was performed at 1200
V for 40 min. Bands were visualized using silver staining
and their sizes were estimated using a 25-bp DNA ladder
standard (Promega, Madison, WI).
Analysis of Population Structure
and Marker–Trait Association
Seventeen SSR markers distributed along different
chromosomes (Supplemental Table S1) were randomly
selected to genotype individuals using polyacrylamide
gel electrophoresis, as described above. Genotyping
data were collected to estimate the most likely K value
(Q matrix) using STRUCTURE version 2.2 software
(Pritchard et al., 2000). Genetic stratification was analyzed using a variant of the Markov chain Monte Carlo
algorithm. Patterns of genetic structure were calculated
in multiple runs, where each run consisted of 500,000
iterations with a burn-in period of 50,000 iterations. The
parameter K was set from 1 to 15 and 10 replicates were
performed for each value of K. A modal value of DK was
used to assess the most likely K corresponding to the Q
matrix (Evanno et al., 2005). An individual was classified into a cluster when the assignment probability was
greater than 0.75. In addition, a microsatellite analyzer
software package was used to estimate relative kinship (K
matrix) (Dieringer and Schlštterer 2003).
In total, 353 individuals were used to detect any
association between molecular markers and malic acid
content. Association analysis was performed with the
software package TASSEL version 3.0 using a mixed linear model (Yu et al., 2006; Bradbury et al., 2007). This
method used both the population structure Q matrix
and a K matrix. The critical P-value for analyzing the significance of molecular markers was calculated based on
the false discovery rate for malic acid content (Benjamini
and Hochberg, 1995; Benjamini and Yekutieli, 2001),
which was found to be highly stringent. The criterion for
marker–trait association was set at P £ 0.005. In addition,
the haplotype association test was performed using PLINK
software, as described by Purcell et al. (2007); the criterion
for haplotype–trait association was set at P £ 0.01.
RNA Isolation and Quantitative Real-Time PCR
Eight cultivars (i.e., Aifeng, Belle de Boskoop, Zhumary,
Jincui, Xinnongjin, McIntosh Red, Annuo, and Yanhongmei) were selected for quantitative real-time PCR
(qRT-PCR) assay and their fruit samples were collected
at 30, 60, and 90 d after full bloom. Each accession had
three replicates consisting of five fruits. Fruit flesh tissues
of each replicate were cut into small sections, mixed, and
subjected to total RNA extraction. Total RNA extraction was performed using the RNAprep pure Plant kit
(Tiangen, Beijing, China) according to the manufacturer’s instructions, and then adjusted to 500 ng mL–1
using a NanoDrop Lite Spectrophotometer (Nanodrop
Technologies, Wilmington, DE). RNA extractions were
treated with DNase I (Takara, Dalian, China) to remove
any contamination of genomic DNA. Approximately,
3 mg of total RNA per sample was used for cDNA synthesis using TransScript One-Step gDNA Renoval and
cDNA Synthesis SuperMix (TRANS, Beijing, China)
according to the manufacturer’s instructions. A pair
of primers (5’-GACTTGGGCTTCAACAGCTC-3’and
m a et al .: aluminum-activated malate transporter genes & apple acidity
3
of
14
5’-TTTTCGAGGATCCGAATGAC-3’) was designed to
investigate the expression profiles of Ma1, a candidate
gene of the Ma locus on LG16 of apple. Quantitative realtime PCR was performed in a reaction mixture (total
volume = 20 mL) containing 10.0 mL of 2× SYBR Green
I Master Mix (Takara), 0.2 µM of each primer, and 100
ng of template cDNA. Amplifications were performed
using Applied Biosystems 7500 Real-Time PCR Systems
(Applied Biosystems, Foster City, CA). The amplification
program consisted of 1 cycle of 95°C for 3 min, followed
by 40 cycles of 95°C for 30 sec, and 60°C for 34 sec. The
fluorescent product was detected at the second step of
each cycle. Melting curve analysis was performed at the
end of 40 cycles to ensure proper amplification of the
target fragments. An actin gene was used as a constitutive control along with the following primer sequences:
5’-TGACCGAATGAGCAAGGAAATTACT-3’ and
5’-TACTCAGCTTTGGCAATCCACATC-3’. All analyses
were repeated three times using biological replicates.
Subcellular Localization using a Green
Fluorescent Protein
Subcellular localization of two alleles, Ma1 and
ma1, were conducted. The allele ma1 contains an
early stop codon that is caused by a single nucleotide mutation and its coding region is 252-bp shorter
than of the allele Ma1. Therefore, two pairs of primers (5’-GCGTCATGAATGGCGGCCAAAATCGGGTCC-3’–5’-CGTTCTTCAACCGCAAACTC-3’
and 5’-GCGTCATGAATGGCGGCCAAAATCGGGTCC-3’–5’-CTGATATTGGTCGTTTTAAAAGAC-3’) were designed to amplify the coding regions
of Ma1 and ma1, respectively, using cDNA templates from
leaf tissues of the apple cultivar Golden Delicious.
Polymerase chain reaction products were purified and inserted into the TA cloning vector pEASY-T1.
Inserts were validated by direct sequencing. Plasmid
DNAs were extracted and digested with two restriction enzymes, BspHI and XbaI. DNA fragments were
recovered and inserted into the expression vector
pCAMBIA1302::GFP under the control of Cauliflower
mosaic virus 35S promoter, thus generating the constitutively expressed fusion proteins Ma1–green fluorescent
protein (GFP) and ma1–GFP. The two constructs were
individually transformed into epidermal cells of onion
(Allium cepa L.) using a modified Agrobacterium infection method as described by Sun et al. (2007). Green
fluorescent protein-dependent fluorescence was detected
at 12 to 36 h following transfection using a D-FL EPIFluoresecence Attachment (Nikon, Tokyo, Japan).
Construction of Yeast Expression Vectors
A pair of primers, 5’-CTCTTGTACGCTGTTCCGCT-3’
and 5’-ATGAGATCCAACCTTGGCC-3’, was designed to
amplify cDNA fragments of Ma1 using cDNA templates
from fruits of Golden Delicious. cDNA fragments were
cloned into the pEASY-T1 vector and plasmid DNAs were
used as PCR templates to generate full coding sequences
4
of
14
of Ma1 allele using a pair of primers, 5’-GCGTGATCAATGGCGGCCAAAATCGGGTCC-3’–5’-GCGGCGGCCGCTTAGTTCTTCAACCGCAAAC-3’. The full
coding sequences were also cloned into the pEASY-T1
vector. Plasmid DNAs were then extracted, digested
with BclI and NotI, and ligated into a BamHI- or NotIdigested mediated vector. DNA fragments covering
the TDH3 promoter, full coding regions of either the
Ma1 or ma1 alleles, and terminator sequences were
then amplified with a pair of primers, 5’-GGTACCCTGCCATTTCAAAGAATACGTAAATAA-3’–5’-GTCGACATCATGTAATTAGTTATGTCACGCT-3’, and
subsequently inserted into the pEASY-T1 vector.
The cloned vector was digested with two enzymes,
KpnI and XhoI. DNA fragments were retrieved, and
introduced into the KpnI or SalI site of an integrative
yeast expression vector, pRS406, generating the construct pRS406–Ma1. The integration vectors pRS406
and pRS406–Ma1 were linearized with the restriction
enzyme StuI and then integrated into the ura3–52 locus
of Saccharomyces cerevisiae WAT11 strain to generate the
yeast strains WAT11/pRS406 and WAT11/pRS406-Ma1,
based on the polyethylene glycol–lithium acetate method
(Gietz and Woods, 2002).
Yeast Collection and Malic Acid
Content Measurements
Yeast strains were inoculated into 250-mL yeast peptone
dextrose adenine (YPDA) liquid medium and incubated
overnight at 30°C with shaking at 250 rpm. Yeast cells
were collected by centrifugation and resuspended in 5
mL ddH2O. One mL of the yeast solution was transferred
into a 1.5-mL Eppendorf tube; 1.0 g of acid-washed glass
beads (425–600 µm, Sigma) was added to mechanically
disrupted yeast cells using a grinder mill (Scientz-48,
Ningbo Scientz Biotechnology, Zhejiang, China). Cellular
fragments were sedimented by centrifugation at 12,000
rpm for 30 min at 4°C and the supernatant was collected
and transferred to a new 1.5-mL Eppendorf tube. The
supernatant was subsequently filtered through solid phase
extraction [Sep-Pak C18 Vac 35-cc cartridge (Waters)]
and a 0.22 mM millipore membrane. The filtered fluid was
used for measurement of malic acid content using high
performance liquid chromatography. All analyses were
repeated three times using biological replicates. One-way
ANOVA was conducted using SPSS Statistics for Windows version 17.0 software (SPSS Inc., Chicago, IL).
Results
Genes Encoding ALMT in the Apple Genome
The DNA coding sequence of the ALMT family in A.
thaliana (Kovermann et al., 2007) was used as a query
sequence to identify homologous genes by basic local
alignment search tool searches of the reference genome
sequence of apple (Velasco et al., 2010). A total of 22
homologs were identified on chromosomes 1, 2, 3, 6, 11,
13, 14, 15, and 16 or among the unanchored sequences
the pl ant genome

november 2015

vol . 8, no . 3
Figure 1. Genes encoding aluminum-activated malate transporter (ALMT) in the apple genome. (a) Chromosomal distribution of the
apple ALMT genes, for which the accession numbers have been retrieved from the Genome Database for Rosaceae database (http://
www.rosaceae.org/, accessed 23 June 2015). The dashed line indicates the anchored sequences. Genes belonging to the ALMTII family are highlighted with a black background. Accession numbers in brackets have the identical coding DNA sequences to their neighbors. (b) Phylogentic tree derived from amino acid sequences of the ALMT genes in apple and Arabidopsis thaliana. The numbers near
the branches indicate bootstrap values calculated from 1000 replicate analyses.
(Fig. 1a). Phylogenetic analysis revealed that these homologs are grouped into three gene families, designated
ALMTI, ALMTII and ALMTIII (Fig. 1b). The ALMTI
family includes eight homologs (MDP0000160829,
MDP0000553830, MDP0000226551, MDP0000873233,
MDP0000227375, MDP0000851070, MDP0000186135,
and MDP0000269351), whereas the ALMTIII family includes six homologs (MDP0000392887,
MDP0000261132, MDP0000315809, MDP0000255420,
MDP0000144432, and MDP0000230322). The ALMTII
family consists of eight homologs (MDP0000791995,
MDP0000259751, MDP0000312421, MDP0000252114,
MDP0000768640, MDP0000244249, MDP0000299697,
and MDP0000290997), one of which (MDP0000252114)
was designated as the Ma1 gene in a previous report (Bai
et al., 2012). Thus, the Ma1 gene and its closely related
homologs in the ALMTII family were chosen to investigate their association with fruit acidity in apple.
Additionally, five more ALMT-like genes
(MDP0000217912, MDP0000241893, MDP0000315808,
MDP0000271850, and MDP0000196725), besides the 22
ALMT genes, were also reported in the apple genome
(Khan et al., 2013b). However, MDP0000241893,
MDP0000315808, and MDP0000271850 are almost
identical in DNA sequence to MDP0000261132,
MDP0000255420, and MDP0000791995, respectively.
MDP0000196725 has a very short open reading frame
(468 bp in size) and is supposed to be a pseudogene.
MDP0000217912 has low levels of sequence identity to all
22 ALMT genes and was separated into an outgroup (data
not shown). Thus these additional five ALMT-like genes
were excluded from the ALMT gene family in this study.
Association between ALMTII Genes
and Fruit Acidity in Apple
Molecular tags, including seven SSRs and one CAPS, were
developed for the eight apple ALMTII genes (Table 1).
These gene tags were subsequently used to screen a collection of 353 Malus accessions. Genotyping data were
collected for association mapping analysis (Supplemental
Data 1). The malic acid content in mature fruits ranged
from 0.53 to 22.74 mg g–1 fresh weight (FW) within the
apple collection, with an average of 4.85 mg g–1 FW. To
avoid false associations between markers and traits of
interest, the genetic structure of the apple collection was
evaluated. The STRUCTURE results indicated a peak
DK value of K = 3 (Supplemental Fig. S1). This suggested
that there were three genetically distinct clusters present
in this collection. Thus the corresponding Q and kinship matrices were calculated and used in the TASSEL
version 3.0 software. Candidate gene-based association
mapping was performed using a mixed linear model
method. As a result, only the Ma1 gene (MDP0000252114)
was significantly associated with malic acid content (P
= 6.07 × 10–4), accounting for ~7.58% of the observed
phenotypic variation (Table 1). Molecular tagging of the
Ma1 gene (WBG90, 1.4 kb downstream of the stop codon)
revealed three genotypes: (TC)17(TC)17, (TC)20(TC)17, and
m a et al .: aluminum-activated malate transporter genes & apple acidity
5
of
14
Table 1. Candidate gene-based association analysis of Ma1 homologs and malic acid content in mature apple fruits.
Molecular tag
Homolog of Ma1
†
MDP0000244249
MDP0000252114
MDP0000768640
MDP0000290997
MDP0000791995
MDP0000259751
MDP0000299697
MDP0000312421
Primer (5’–3’)
Name
Type
Polymorphic site
Location
WBG86
WBG90
WBG106
WBG112
WBG113
WBG117
WBG119
WBG121
SSR§
SSR
SSR
SSR
SSR
SSR
SSR
CAPS
(ATG)5
(TC)20
(GT)10
(GGTTTT)3
(TG)16
(CTG)7
(TA)9
GKAC
-566 bp
-1408 bp
+1473 bp
+1740 bp
+665 bp
-252 bp
+384 bp
+513 bp
‡
LG
Forward
Reverse
P-value
16
16
13
6
U/N
1
14
13
AAACCATTCACTTGATATGACA
GCCCACTAATGCTTTCTGTA
CTGCTGGTGCCTACATGTGGT
AGAAGCCAAGAGGACACTCT
TTAATTTGTTTGGCGTTGGG
GTAGAGGCGGCCATGAATAA
CCTGTAACGACCCTGTATCG
AGATAACTCTGCAATCCCCAG
GACGATATCCCAAGTTAACAA
CTCCAACAGATTGTCGAATC
CAGGTAACTATCCGTGACGAG
TCTGTATCGACCATGTGGTG
TCATGGACGGTGATAGCTGA
CTTCTCCGATCTCACAAGCC
ACTTTTTCTTCGTCCGAATC
TCCGACTTCGGTTTCAACAG
0.08
0.0007
0.21
0.47
0.02
0.03
0.24
0.79
†
Names with the prefix ‘MDP0000’ represent accession numbers of apple genes deposited in Genome Database for Rosaceae (https://www.rosaceae.org, accessed 23 June 2015).
‡
Negative and positive numbers indicate upstream or downstream, respectively, of start or stop codons.
§
SSR, simple sequence repeat; LG, linkage group; U/N, unknown.
Figure 2. Characterization of the Ma1 gene responsible for fruit acidity in apple. (a) Genomic structure of the Ma1 gene. Cleaved
and amplified polymorphic sequence (CAPS) and WBG90 represent the A/G polymorphic and microsatellite (TC)n loci, respectively.
(b) An example of genotyping of the apple population using two molecular tags of the Ma1 gene. I, a polyacrylamide gel of the
simple sequence repeat marker WBG90. The polymorphic bands are indicated with arrows. II, an agarose gel electrophoresis of the
polymerase chain reaction (PCR) products digested with the HaeIII enzyme. Polymerase chain reactions products containing GGCC
sequences can be digested, whereas PCR products with GACC sequences cannot be digested. (c) The transmembrane domain of the
Ma1 gene is predicted to be formed by six putative transmembrane a-helices (TMa1–TMa6) with the N-terminus being located in the
vacuole. The star indicates the A/G polymorphic locus, with the allele ‘A’ corresponding to a premature stop codon. FW, fresh weight.
(TC)20(TC)20, in the apple collection (Fig. 2a, 2bI). Mean
values of malic acid content in mature fruits displayed the
following pattern among the three genotypes: (TC)17(TC)17
> (TC)20(TC)17 > (TC)20(TC)20 (Fig. 3). In contrast, no significant associations were observed between the homologs
of the Ma1 gene and malic acid content (Table 1, P ³ 0.14).
6
of
14
Since an A/G SNP 252 bp upstream of the stop
codon of the Ma1 gene has been reported in a previous
study (Bai et al., 2012), we also developed a CAPS marker
to detect the A–G polymorphism (Fig. 2bII). This CAPS
marker revealed three genotypes, designated AA, AG,
and GG, in the apple collection. The allele ‘A’ contained
the pl ant genome

november 2015

vol . 8, no . 3
Figure 3. Mean values of malic acid contents in mature fruits of
different genotypes that are classified according to whether they
have either the A/G single-nucleotide polymorphism or the microsatellite (TC)n locus of the Ma1 gene in apple. Different lowercase letters indicate significant differences among genotypes
(t-test, LSD test at P < 0.01). Error bars show the SE of the mean.
FW, fresh weight.
Table 2. Correlations between haplotypes in the Ma1
gene and malic acid contents in mature fruits of an
apple population.
Correlation between
haplotype and
malic acid content
Single-nucleotide
polymorphism
Haplotype
(R = A/G)
WBG90
Frequency
Regression
coefficient
Probability
HapA
(TC)17
0.192
3.24
4.69 ×10 –18
G
HapB
A
(TC)17
0.296
-1.09
0.00676
HapC
G
(TC)20
0.115
1.32
0.01400
HapD
A
(TC)20
0.397
-3.12
1.42E-15
a GACC sequence, resulting in a premature stop codon,
whereas the ‘G’ allele containing a GGCC sequence had a
complete coding sequence. The mean values of malic acid
content in mature fruits showed significant differences
among the three genotypes and displayed the following
patterns: GG > AG > AA (Fig. 3).
The combination of a SNP locus and an SSR motif
were evaluated and four haplotypes, designated HapA to
HapD, were identified (Table 2). All haplotypes, except
for HapC, were significantly associated with malic acid
content. HapA and HapD had the greatest effects on
malic acid content in apple fruits.
Expression Profiling of ALMTII Genes
in Apple Fruits at Different Stages
Real-time PCR was initially conducted to investigate
the expression profiles of ALMTII genes in fruits of four
cultivars: Yanhongmei, Belle de Boskoop, Zhumary, and
Aifeng (Fig. 4). These four cultivars have similar ripening
periods, with maturation occurring about 90 d after full
bloom, but show great variation in malic acid content.
Of the eight ALMTII genes, the Ma1 gene was expressed
during fruit development in all tested cultivars. However,
six ALMTII genes (MDP0000312421, MDP0000791995,
MDP0000244249, MDP0000259751, MDP0000290997,
and MDP0000768640) were not expressed in all tested
cultivars. One ALMT gene (MDP0000299697) was weakly
expressed during the early stage of fruit development.
Furthermore, we evaluated transcript levels of the
Ma1 gene using qRT-PCR. As mentioned above, three
genotypes were detected using a CAPS marker developed
from the A/G polymorphic site present in the last exon
of the Ma1 gene. Thus fruits of eight cultivars representing different genotypes were selected for gene expression
analysis. Transcript accumulation of the Ma1 gene was
detected in fruits at different developmental stages and in
all genotypes but showed different patterns during fruit
development (Fig. 5). For example, during fruit development, increased transcript accumulation was observed
in the cultivars Xinnongjin, Jincui, and Yanhongmei, but
only a slight reduction in transcript levels was detected in
the cultivars Belle de Boskoop, Annuo, and McIntosh Red.
In contrast, transcript levels were relatively stable during
fruit development in the cultivars Aifeng and Zhumary.
Finally, we evaluated the relationship between transcript levels of Ma1 and malic acid content. Although
transcript levels for the cultivars Aifeng and Zhumary
were quite similar, malic acid contents were significantly
different. Similarly, transcript accumulation patterns
were very similar between the cultivars Xinnongjin and
Yanhongmei, whereas the malic acid content of the cultivar Yanhongmei was significantly higher than that of
Xinnongjin. Furthermore, transcript levels of the Ma1
gene in fruits of Aifeng were slightly higher than those
of Belle de Boskoop; however, the malic acid content of
Aifeng was lower than that of Belle de Boskoop.
Subcellular Localization of Ma1
and its Functional Analysis by Ectopic
Expression in Yeast
The TMpred program (http://www.ch.embnet.org/
software/TMPRED_form.html, accessed 22 June 2015)
predicted that Ma1 consists of seven transmembrane
domains (TMa1 to TMa7) and a single nucleotide
mutation that results in a premature stop codon is
located between TMa6 and TMa7 (Fig. 2c). To investigate the effects of this single nucleotide mutation on
gene functionality, subcellular localization analysis of
two alleles of the Ma1 gene was conducted. The allele
containing a GACC sequence was designated ma1; the
other, containing a GGCC sequence, was designated
Ma1. Two constructs, 35S:Ma1–GFP and 35S:ma1–GFP,
were transiently transformed into onion epidermal
cells using agro-infection (Fig. 6). It was found that the
Ma1–GFP fusion protein resided in the tonoplast, as the
nucleus was surrounded with fluorescence, whereas the
m a et al .: aluminum-activated malate transporter genes & apple acidity
7
of
14
Figure 4. Analysis of expression profiles of the eight apple ALMT genes using real-time polymerase chain reaction (RT-PCR). S1, S2,
and S3 indicate 30, 60, and 90 d after full bloom, respectively. The numbers 1, 2, 3, and 4 represent the cultivars Yanhongmei,
Bell de Boskoop, Zhumary, and Aifeng, respectively. No RT-PCR product of the expected size was obtained for five ALMT genes
(MDP0000312421, MDP0000791995, MDP0000244249, MDP0000259751, MDP0000290997, and MDP0000768640).
ma1–GFP fusion protein was targeted to the cell membrane. This finding indicates that the C-terminal amino
acid sequence of Ma1 plays an important role in directing the protein to a specific subcellular site.
The Ma1 gene is closely related to AtALMT9 in A.
thaliana (Fig. 1b). AtALMT9 serves as a vacuolar malate
channel in A. thaliana (Kovermann et al., 2007). Thus
the functionality of the Ma1 gene was investigated via
ectopic expression in yeast. When yeast lines were incubated in a standard YPDA liquid medium, no differences
in malic acid content were observed between transgenic
lines expressing Ma1 or ma1 and control yeast lines carrying an empty vector (Table 3). However, in the presence of 0.02 g mL–1 malic acid added to the YPDA liquid
medium, malic acid contents increased significantly in
transgenic lines expressing Ma1 compared to control
lines carrying ma1 or the empty vector. However, no
8
of
14
significant difference in malic acid contents was detected
between transgenic lines expressing ma1 and control lines
carrying the empty vector. This result suggests that Ma1,
similar to AtALMT9, may also function as a channel to
increase the influx of malic acid, but ma1 is probably nonfunctional. In other words, Ma1 is potentially associated
with the accumulation of malic acid in apple fruits.
Discussion
Duplication of ALMTII Genes in Apple
and their Divergence in Expression
Gene duplication, which can arise from polyploidization, segmental duplication, or both is a major driving
force for recruitment of genes in plants. Apple is a diploid, with an autopolyploidization origin (Han et al.,
2011; Velasco et al., 2010). In this study, eight ALMTII
the pl ant genome

november 2015

vol . 8, no . 3
Figure 5. Expression profiles of the Ma1 gene in fruits of different apple varieties. The genotypes at the A/G single-nucleotide polymorphism locus are as follows: AA in the cultivars Aifeng and Belld de Boskoop; AG in the cultivars Zhumary, Jincui, and Xinnongjin; and
GG in the cultivars McIntosh Red, Annuo, and Yanhongmei. All eight cultivars show similar ripening periods, with maturation occurring
at approximately 90 d after full bloom. FW, fresh weight.
genes have been identified in the apple genome. Of
these ALMTII genes, seven are located on chromosomes
1, 6, 13, 14, and 16 and one is among the unanchored
sequences. Chromosomes 6 and 14 are homologous pairs
(Han et al., 2011; Velasco et al., 2010) and both contain
an ALMTII gene on the bottom chromosome. Similarly,
chromosomes 13 and 16 are also homologous pairs and
both contain a cluster of two ALMTII genes on the top
chromosome. These results suggest that duplication
of ALMTII genes in apple is related to whole-genome
m a et al .: aluminum-activated malate transporter genes & apple acidity
9
of
14
Figure 6. Subcellular localization of Ma1–green fluorescent protein (GFP) by transient expression in epidermal cells of onion. (A) Fluorescence of the GFP protein is detected throughout the whole cell, including the cytoplasm and nucleus. (B) Cells stained with the membrane dye Dil (Beyotime Institute of Biotechnology, Haimen, Jiangsu, China). (C) Fluorescence of the ma1–GFP fusion protein is targeted
to the cell membrane. (D) Fluorescence of the Ma1–GFP construct is targeted to the tonoplast, which surrounds the nucleus (marked by
arrows). (E) Fluorescence of the AtALMT12–GFP fusion protein that was previously localized in the cell membrane (Meyer et al., 2010).
(F) Fluorescence of the AtMT9–GFP fusion protein that was previously localized in the tonoplast (Zhang et al., 2013). Ma1 and ma1
represent two different alleles containing GGCC and GACC sequences, respectively, at the A/G polymorphic site 252 bp upstream of
the stop codon.
Table 3. Functional analysis of the Ma1 gene based on
expression in yeast lines.
YPDA liquid
medium§
Containing 0.02g
mL–1 malic acid
Without
malic acid
†
Malic acid content (mg g –1)
Construct†
1
2
3
Mean value‡
Ma1
ma1
Empty vector
Ma1
ma1
Empty vector
3.85
1.45
1.38
N/D
N/D
N/D
3.67
1.55
1.29
N/D
N/D
N/D
3.87
1.41
1.40
N/D
N/D
N/D
3.80a ± 0.11
1.47b ± 0.07
1.36b ± 0.06
–
–
–
Ma1 contains a GGCC sequence at the A/G polymorphic site and has a complete coding sequence.
Means with different letters within the same column are significantly different at the 0.01 level of
probability.
‡
§
N/D, not determined; YPDA, yeast peptone dextrose adenine.
duplication during the process of speciation and that
tandem duplication on chromosomes 13 and 16 is likely
to have occurred in the ancestor of domesticated apples.
Since chromosomes 1 and 7 are known to be homologous
pairs (Han et al., 2011; Velasco et al., 2010), the ALMTII
gene among unanchored sequences (MDP0000791995) is
likely to be located on chromosome 7.
Most polyploid-derived duplicated genes show
a rapid divergence in expression (Blanc and Wolfe
2004). This phenomenon is also observed for the
apple ALMTII genes. For example, two duplicate gene
10
of
14
pairs, Ma1–MDP0000312421 and MDP0000299697–
MDP0000290997, have acquired divergent expression
patterns. The Ma1 gene is expressed in fruit across
the entire process of fruit development, whereas
MDP0000312421 is not expressed in fruit. Similarly,
MDP0000299697 is weakly expressed in fruit at the early
stage of fruit development, whereas MDP0000290997
is not expressed in fruit. However, it is unclear whether
or not the two duplicate gene pairs, MDP0000259751–
MDP0000791995 and MDP0000768640–
MDP0000244249 diverge in expression, although none of
them showed expression in fruit.
In summary, duplication of ALMTII genes in apple
is related to the polyploid origin of the apple genome.
Divergence in expression has occurred between the Ma1
gene and its closely related homologs, which is consistent with our findings that only the Ma1 gene, out of the
ALMTII family, is associated with acidity in apple fruit.
Characterization of the Ma1 Gene
and Complexity of the Genetic Basis
of Fruit Acidity in Apple
Our study indicates that the Ma1 gene is significantly
associated with fruit acidity in an apple collection, which
confirms previous studies (Bai et al., 2012; Khan et al.,
2013b). To gain further insights into the role of Ma1 in
determining fruit acidity, the functionality of this gene
was investigated. Subcellular localization has indicated
the pl ant genome

november 2015

vol . 8, no . 3
that Ma1 resides in the tonoplast and ectopic expression
in yeast has further demonstrated its potential functionality as a vacuolar malate channel. Ma1 consists of a
transmembrane domainthat is formed by seven putative
transmembrane a helices. The last putative transmembrane a-helix at the C-terminus seems to be essential
for directing Ma1 to a specific subcellular compartment
or membrane. A single nucleotide substitution of G by
A in the last exon results in a premature stop codon,
which contributes to a truncated protein lacking the last
putative transmembrane a-helix. The truncated protein
resides in the cell membrane instead of the tonoplast,
thus losing functionality as a vacuolar malate channel.
As malic acid is stored in the vacuole, the single nucleotide mutation must have an influence on the accumulation of malic acid in fruit tissues. Besides the A/G SNP
locus, seven other SNPs in coding regions were also identified in eight cultivars, which were subjected to qRTPCR analysis (data not shown). More studies are needed
to address if these SNPs have an effect on gene function.
Linkage mapping studies have shown that the Ma
locus on LG16 can explain 22.8 to 36% of the observed
variation in fruit acidity (Kenis et al., 2008; Liebhard et al.,
2003). However, our association mapping study indicates
that the Ma1 gene accounts for ~7.46% of the observed
phenotypic variation for malic acid content in mature
fruits. This result strongly suggests that the Ma locus on
LG16 is not the only determinant of fruit acidity in apple.
Moreover, it was revealed that apple cultivar Belle de Boskoop contains two homozygous alleles, ma1ma1; however,
it has lower pH values in fruits at different stages of development. In addition to the Ma1 gene, a major QTL for
fruit acidity was detected on LG 8 (Liebhard et al., 2003;
Zhang et al., 2012). These results suggest the likely presence of major gene(s) other than the Ma1 gene in the apple
genome that are also responsible for fruit acidity. The apple
accessions used in this study, such as Belle de Boskoop,
are highly valuable for identifying these additional major
genes responsible for apple fruit acidity.
In earlier studies, it was reported that Ma1 has a
strong additive effect in increasing fruit acidity and it
is incompletely dominant over ma1 (Xu et al., 2012),
although other studies have indicated that Ma1 is completely dominant over ma1 (Iwanami et al., 2012). Based
on mean values of malic acid content in mature fruits
of the apple collection used in this study, it can be seen
that the following allelic dominance effects are observed,
where Ma1Ma1 > Ma1ma1 > ma1ma1. Thus it seems that
Ma1 is incompletely dominant over ma1.
Variability in Levels of Fruit Acidity
within a Collection and its Implications
for Domestication of Apple
The findings of this study not only confirms malic acid
as being the predominant organic acid in mature apple
fruits (Wu et al., 2007) but also that wide variations in the
malic acid content of mature fruits can also be observed
among cultivars from different geographic regions. Apple
cultivars originating from European countries such as
Germany, England, and France produce acidic fruits with
average malic acid contents of 7.20, 5.80, and 5.42 mg
g–1 FW in mature fruits, respectively. In contrast, apple
cultivars from Asian countries such as China, Japan, and
North Korea produce sweet fruits, with average malic acid
content of 3.32, 3.15, and 2.95 mg g–1 FW in mature fruits,
respectively. These observed differences may be attributed
to the following reasons. First, people in Asian countries
prefer sweet and low-acid apples, whereas Europeans
prefer more acidic (tart) apples. Second, cider is a popular drink in Europe and many apple cultivars have been
developed for cider production. Levels of malic acid are
very critical in cider processing, as it plays an important
role in maintaining a consistently sharp and crispy taste
(Pereira-Lorenzo et al., 2009). In general, fruits of apple
cultivars used for cider processing contain high levels of
malic acid contents. Thus these findings suggest that fruit
acidity is an important determinant for fresh consumption as well as processing in apple breeding programs
(Crisosto and Crisosto, 2002; Juniper and Mabberley,
2006; Wen et al., 2013; Khan et al., 2014).
As mentioned above, the Ma1 gene plays an important role in determining fruit acidity. Three genotypes,
AA (ma1ma1), AG (Ma1ma1), and GG (Ma1Ma1), have
been identified in the apple collection based on the A/G
SNP locus of the Ma1 gene. Most wild apple relatives
have a GG genotype (58%), followed by AG (27%) and
AA (15%) genotypes (Fig. 7a). In contrast, most apple
cultivars have an AA genotype (58%), followed by AG
(38%) and GG (4%) genotypes. On average, mature fruits
of domesticated cultivars have lower malic acid content
compared to its wild relatives (Fig. 7b). These results
suggest that apple domestication may have been accompanied by selection for the Ma1 gene, which plays an
important role in determining fruit acidity. In addition,
it is worthy to note that the observed higher levels of fruit
acidity in wild species may be related to natural selection,
as higher levels of malic acid could contribute to fruit
survival by circumventing damage resulting from both
biotic and abiotic stresses such as pests, pathogens, heat,
and drought (Fernie and Martinoia, 2009).
Variations in the malic acid content of mature fruits
can also be detected among accessions with the same
genotype in the Ma locus. For example, among accessions with the same genotype, wild relatives generally
have the highest value of malic acid content in mature
fruits, followed by European cultivars and Asian cultivars (Fig. 7b). Asian cultivars have a higher frequency of
GG genotype (8%) than cultivars from Europe (2%) or
other countries (3%). Among accessions with the same
GG genotype, however, Asian cultivars have lower level
of malic acid content in mature fruits than cultivars from
Europe and other countries (Fig. 7b). These results further confirm our findings above that gene(s) other than
Ma1 are also responsible for fruit acidity in apple.
Apple was first domesticated in the Tian Shan
Mountains of central Asia, wherein the wild species
m a et al .: aluminum-activated malate transporter genes & apple acidity
11
of
14
Figure 7. Characterization of the apple collection used in this study. (a) Distribution of three genotypes (AA, AG, and AG) among cultivars from different geographic regions and their wild relatives. Other locations include the United States, New Zealand, and Australia.
The genotypes are classified based on the A/G single-nucleotide polymorphism locus of the Ma1 gene. (b) Mean values of malic acid
contents in mature fruits of three genotypes (AA, AG, and AG) among cultivars from different geographic regions and their wild relatives. Different lowercase letters indicate significant differences among genotypes (t-test, LSD test at P < 0.01).
Malus sieversii (Ledeb.) M.Roem. is known to be widely
distributed (Dzhangaliev, 2003). Following sequencing of
the apple genome, M. sieversii has been identified as the
main contributor to the genome of the cultivated apple
(Velasco et al., 2010). Thus it is reasonable to speculate
that sweet apples were initially developed in Central
Asia and then introduced to Europe along the famous
Silk Road. Hybridization between Malus sylvestris (L.)
Mill. and sweet apples has been undertaken to develop
cultivars for cider production, fresh fruit consumption or
both (Wagner and Weeden, 2000).
Relationship between the Origin of the Cultivated
Apple and the Population Structure
As mentioned above, the initial progenitor of the cultivated apple, M. × domestica, was initially domesticated
from M. sieversii (Dzhangaliev, 2003). Subsequently, the
introgression of wild species into the cultivated apple must
12
of
14
have occurred as a distinct event during domestication.
In East Asia, interspecific hybridization between M. sieversii and another wild species, Malus baccata (L.) Borkh.,
contributed to the development of a new hybrid species,
Malus × asiatica Nakai, which has been grown as a local
landrace since ancient times (Pereira-Lorenzo et al., 2009).
In Europe, interspecific hybridization between the initial
progenitor of M. × domestica and the European crabapple
M. sylvestris has been reported to be an important event in
the evolution of domesticated apple cultivars that are more
closely related to M. sylvestris than to M. sieversii (Richards et al., 2008; Cornille et al., 2012). In short, M. sieversii
and M. sylvestris are the two predominant contributors to
the M. × domestica gene pool (Velasco et al., 2010; Cornille
et al., 2012) and the introgression of other wild species
such as M. baccata into the domesticated apple has also
contributed to the diversity of apple.
the pl ant genome

november 2015

vol . 8, no . 3
The apple accessions used in this study predominantly originated from Europe and Asia and are clustered into three groups based on the results of the
population structural analysis (Supplemental Fig. S2).
All accessions in the second group (marked with a predominantly green color), except ‘Hongroupingguo’ (M.
sieversii) and ‘Tukumanpingguo’ (M. sieversii), are cultivars. The first group (marked with a predominantly red
color) is composed of cultivars and most wild species
such as M. baccata. The third group (marked with a predominantly blue color) consists of cultivars and several
wild species such as M. sylvestris and Malus prunifolia
(Willd.) Borkh. Thus, our finding suggests that these
apple collections are divided into three on the basis of the
different origins and evolution of the domesticated apple.
Acknowledgments
This work was supported by the National Natural Science Foundation of
China (Grant Nos. 31420103914 and 31372048) and the National Basic
Research Program of China (Grant No. 2011CB100600).
References
Bai, Y., L. Dougherty, M. Li, G. Fazio, L. Cheng, and K. Xu. 2012. A natural
mutation-led truncation in one of the two aluminum-activated malate
transporter-like genes at the Ma locus is associated with low fruit
acidity in apple. Mol. Genet. Genomics 287:663–678. doi:10.1007/
s00438-012-0707-7
Belfanti, E., E. Silfverberg-Dilworth, S. Tartarini, A. Patocchi, M. Barbieri,
J. Zhu, et al. 2004. The HcrVf2 gene from a wild apple confers scab
resistance to a transgenic cultivated variety. Proc. Natl. Acad. Sci.
USA 101:886–890. doi:10.1073/pnas.0304808101
Benjamini, Y., and Y. Hochberg. 1995. Controlling the false discovery rate:a
practical and powerful approach to multiple testing. J. R. Stat. Soc., B
57:289–300.
Benjamini, Y., and D. Yekutieli. 2001. The control of the false discovery
rate in multiple testing under dependency. Ann. Stat. 29:1165–1188.
doi:10.1214/aos/1013699998
Blanc, G., and K.H. Wolfe. 2004. Functional divergence of duplicated
genes formed by polyploidy during Arabidopsis evolution. Plant Cell
16:1679–1691. doi:10.1105/tpc.021410
Bradbury, P.J., Z. Zhang, D.E. Kroon, T.M. Casstevens, Y. Ramdoss, and
E.S. Buckler. 2007. TASSEL: Software for association mapping of
complex traits in diverse samples. Bioinformatics 23:2633–2635.
doi:10.1093/bioinformatics/btm308
Brunel, N., N. Leduc, P. Poupard, P. Simoneau, J.C. Mauget, and J.D. Viémont. 2002. KNAP2, a class I KN1-like gene is a negative marker of
bud growth potential in apple trees (Malus domestica [L.] Borkh.). J.
Exp. Bot. 53:2143–2149. doi:10.1093/jxb/erf063
Chagné, D., R.N. Crowhurst, M. Troggio, M.W. Davey, B. Gilmore, C.
Lawly, et al. 2012. Genome-wide SNP detection, validation, and
development of an 8K SNP array for apple. PLoS ONE 7:E31745.
doi:10.1371/journal.pone.0031745
Cornille, A., P. Gladieux, M.J. Smulders, I. Roldán-Ruiz, F. Laurens, B.L. Cam,
et al. 2012. New insight into the history of domesticated apple: Secondary
contribution of the European wild apple to the genome of cultivated varieties. PLoS Genet. 8:E1002703. doi:10.1371/journal.pgen.1002703
Crisosto, C.H., and G.M. Crisosto. 2002. Understanding American and
Chinese consumer acceptance of ‘Redglobe’ table grapes. Postharvest
Biol. Technol. 24:155–162. doi:10.1016/S0925-5214(01)00189-2
Dieringer, D., and C. Schlštterer. 2003. Microsatellite analyser (MSA): A
platform independent analysis tool for large microsatellite data sets.
Mol. Ecol. Notes 3:167–169. doi:10.1046/j.1471-8286.2003.00351.x
Dunemann, F., D. Ulrich, L. Malysheva-Otto, W.E. Weber, S. Longhi, R.
Velasco, et al. 2012. Functional allelic diversity of the apple alcohol acyltransferase gene MdAAT1 associated with fruit ester volatile contents in
apple cultivars. Mol. Breed. 29:609–625. doi:10.1007/s11032-011-9577-7
Dyk, M.-M., M.K. Soeker, I.F. Labuschagne, and D.J.G. Rees. 2010. Identification of a major QTL for time of initial vegetative budbreak in
apple (Malus × domestica Borkh.). Tree Genet. Genomes 6:489–502.
doi:10.1007/s11295-009-0266-1
Dzhangaliev, A. D., 2003: The wild apple tree of Kazakhstan. Hort. Rev.
(Amer. Soc. Hort. Sci.) 29:263–303..
Ehrenreich, I.M., Y. Hanzawa, L. Chou, J.L. Roe, P.X. Kover, and M.-D.
Purugganan. 2009. Candidate gene association mapping of Arabidopsis
flowering time. Genetics 183:325–335. doi:10.1534/genetics.109.105189
Espley, R.V., C. Brendolise, D. Chagné, S. Kutty-Amma, S. Green, R. Volz, et
al. 2009. Multiple repeats of a promoter segment causes transcription
factor autoregulation in red apples. Plant Cell 21:168–183. doi:10.1105/
tpc.108.059329
Evanno, G., S. Regnaut, and J. Goudet. 2005. Detecting the number of
clusters of individuals using the software STRUCTURE: A simulation
study. Mol. Ecol. 14:2611–2620. doi:10.1111/j.1365-294X.2005.02553.x
Fernie, A.-R., and E. Martinoia. 2009. Malate. Jack of all trades or
master of a few? Phytochemistry 70:828–832. doi:10.1016/j.phytochem.2009.04.023
Flint-Garcia, S.A., J.M. Thornsberry, and E.S. Buckler. 2003. Structure of
linkage disequilibrium in plants. Annu. Rev. Plant Biol. 54:357–374.
doi:10.1146/annurev.arplant.54.031902.134907
Flint-Garcia, S.A., A.C. Thuillet, J. Yu, G. Pressoir, S.M. Romero, S.E. Mitchell, et al. 2005. Maize association population: A high-resolution
platform for quantitative trait locus dissection. Plant J. 44:1054–1064.
doi:10.1111/j.1365-313X.2005.02591.x
Fournier-Level, A., T. Lacombe, L. Le Cunff, J.M. Boursiquot, and P. This.
2010. Evolution of the VvMYbA gene family, the major determinant
of berry colour in cultivated grapevine (Vitis vinifera L.). Heredity
104:351–362. doi:10.1038/hdy.2009.148
Gietz, R.D., and R.A. Woods. 2002. Transformation of yeast by lithium
acetate/single-stranded carrier DNA/polyethylene glycol method.
Methods Enzymol. 350:87–96.
Gonzalez-Martinez, S.C., N.C. Wheeler, E. Ersoz, C.D. Nelson, and D.B.
Neale. 2007. Association genetics in Pinus taeda L. I. Wood property
traits. Genetics 175:399–409. doi:10.1534/genetics.106.061127
Han, Y., D. Zheng, S. Vimolmangkang, M.A. Khan, J.E. Beever, and S.S.
Korban. 2011. Integration of physical and genetic maps in apple confirms whole-genome and segmental duplications in the apple genome.
J. Exp. Bot. 62:5117–5130. doi:10.1093/jxb/err215
Iwanami, H., S. Moriya, N. Kotoda, N. Mimida, S. Takahashi-Sumiyoshi, and
K. Abe. 2012. Mode of inheritance in fruit acidity in apple analysed with
a mixed model of a major gene and polygenes using large complex pedigree. Plant Breed. 131:322–328. doi:10.1111/j.1439-0523.2011.01932.x
Jaillon, O., J.M. Aury, B. Noel, A. Policriti, C. Clepet, A. Casagrande, et al. 2007.
The grapevine genome sequence suggests ancestral hexaploidization in
major angiosperm phyla. Nature 449:463–467. doi:10.1038/nature06148
Juniper, B.E., and D.J. Mabberley. 2006. The story of the apple. Timber
Press, Portland, OR.
Kenis, K., and J. Keulemans. 2007. Study of tree architecture of apple
(Malus × domestica Borkh.) by QTL analysis of growth traits. Mol.
Breed. 19:193–208. doi:10.1007/s11032-006-9022-5
Kenis, K., J. Keulemans, and M.W. Davey. 2008. Identification and stability
of QTLs for fruit quality traits in apple. Tree Genet. Genomes 4:647–
661. doi:10.1007/s11295-008-0140-6
Khan, M.-A., and S.S. Korban. 2012. Association mapping in forest trees
and fruit crops. J. Exp. Bot. 63:4045–4060. doi:10.1093/jxb/ers105
Khan, M.A., Y. Han, Y.F. Zhao, and S.S. Korban. 2012a. A high-throughput
apple SNP genotyping platform using the GoldenGate™ assay. Gene
494:196–201. doi:10.1016/j.gene.2011.12.001
Khan, M.A., Y.F. Zhao, and S.S. Korban. 2013a. Identification of genetic
loci associated with fire blight resistance in Malus through combined
use of QTL and association mapping. Physiol. Plant. 148:344–353.
doi:10.1111/ppl.12068
Khan, M.A., K.M. Olsen, V. Sovero, M.M. Kushad, and S.S. Korban. 2014.
Fruit quality traits have played critical roles in domestication of the
apple. Plant Gen. 10.3835/plantgenome2014.04.0018.
m a et al .: aluminum-activated malate transporter genes & apple acidity
13
of
14
Khan, S.A., P.Y. Chibon, R.C. de Vos, B.A. Schipper, E. Walraven, J. Beekwilder, et al. 2012b. Genetic analysis of metabolites in apple fruits
indicates an mQTL hotspot for phenolic compounds on linkage group
16. J. Exp. Bot. 63:2895–2908. doi:10.1093/jxb/err464
Khan, S.A., J. Beekwilder, J.G. Schaart, R. Mumm, J.M. Soriano, E.
Jacobsen, et al. 2013b. Differences in acidity of apples are probably
mainly caused by a malic acid transporter gene on LG16. Tree Genet.
Genomes 9:475–487. doi:10.1007/s11295-012-0571-y
Kovermann, P., S. Meyer, S. Hörtensteiner, C. Picco, J. Scholz-Starke, S.
Ravera, et al. 2007. The Arabidopsis vacuolar malate channel is a member of the ALMT family. Plant J. 52:1169–1180. doi:10.1111/j.1365313X.2007.03367.x
Kumar, S., D. Chagné, M.C. Bink, R.K. Volz, C. Whitworth, and C. Carlisle.
2012. Genomic selection for fruit quality traits in apple (Malus × domestica Borkh.). PLoS ONE 7:E36674. doi:10.1371/journal.pone.0036674
Kumar, S., D.J. Garrick, M.C. Bink, C. Whitworth, D. Chagné, and R.K. Volz.
2013. Novel genomic approaches unravel genetic architecture of complex
traits in apple. BMC Genomics 14:393. doi:10.1186/1471-2164-14-393
Le Roux, P.M., M.A. Khan, G.A. Broggini, B. Duffy, C. Gessler, and A. Patocchi. 2010. Mapping of quantitative trait loci for fire blight resistance
in the apple cultivars ‘Florina’ and ‘Nova Easygro’. Genome 53:710–
722. doi:10.1139/G10-047
Li, H., Z. Peng, X. Yang, W. Wang, J. Fu, J. Wang, et al. 2013. Genome-wide
association study dissects the genetic architecture of oil biosynthesis
in maize kernels. Nat. Genet. 45:43–50. doi:10.1038/ng.2484
Liebhard, R., M. Kellerhals, W. Pfammatter, M. Jertmini, and C.
Gessler. 2003. Mapping quantitative physiological traits in
apple (Malus × domestica Borkh.). Plant Mol. Biol. 52:511–526.
doi:10.1023/A:1024886500979
Longhi, S., M. Moretto, R. Viola, R. Velasco, and F. Costa. 2012. Comprehensive QTL mapping survey dissects the complex fruit texture physiology in apple (Malus × domestica Borkh.). J. Exp. Bot. 63:1107–1121.
doi:10.1093/jxb/err326
Longhi, S., M.T. Hamblin, L. Trainotti, C.P. Peace, R. Velasco, and C. Fabrizio. 2013. A candidate gene based approach validates Md-PG1 as the
main responsible for a QTL impacting fruit texture in apple (Malus ×
domestica Borkh). BMC Plant Biol. 13:37. doi:10.1186/1471-2229-13-37
Ma, B.Q., J. Chen, H.Y. Zheng, T. Fang, O. Collins, S.H. Li, et al. 2015.
Comparative assessment of sugar and malic acid composition in
cultivated and wild apples. Food Chem. 172:86–91. doi:10.1016/j.foodchem.2014.09.032
Maliepaard, C., F.H. Alston, G. van Arkel, L.M. Brown, E. Chevreau, K.M.
Dunemann, et al. 1998. Aligning male and female linkage maps of
apple (Malus pumila Mill.) using multi-allelic markers. Theor. Appl.
Genet. 97:60–73. doi:10.1007/s001220050867
Mellidou, I., D. Chagné, W.A. Laing, J. Keulemans, and M.W. Davey. 2012.
Allelic variation in paralogs of GDP-L-galactose phosphorylase is a
major determinant of vitamin C concentrations in apple fruit. Plant
Physiol. 160:1613–1629. doi:10.1104/pp.112.203786
Meyer, S., P. Mumm, D. Imes, A. Endler, B. Weder, K.A. Al-Rasheid, et al.
2010. AtALMT12 represents an R-type anion channel required for
stomatal movement in Arabidopsis guard cells. Plant J. 63:1054–1062.
doi:10.1111/j.1365-313X.2010.04302.x
Myles, S., J.M. Chia, B. Hurwitz, C. Simon, G.Y. Zhong, E. Buckler, et al.
2010. Rapid genomic characterization of the genus Vitis. PLoS ONE
5:E8219. doi:10.1371/journal.pone.0008219
Pereira-Lorenzo, S., A.M. Ramos-Cabrer, and M. Fischer. 2009. Breeding
apple (Malus × domestica Borkh). In: P.M. Priyadarshan, S. Mohan
Jain, editors, Breeding plantation tree crops: Temperate species.
Springer, New York. p. 33–81.
Pritchard, J.K., M. Stephens, and P. Donnelly. 2000. Inference of population
structure using multilocus genotype data. Genetics 155:945–959.
Purcell, S., B. Neale, K. Todd-Brown, L. Thomas, M.A. Ferreira, D. Bender,
et al. 2007. PLINK: A tool set for whole-genome association and
population-based linkage analyses. Am. J. Hum. Genet. 81:559–575.
doi:10.1086/519795
14
of
14
Qian, W., B.Y. Liao, A.Y. Chang, and J. Zhang. 2010. Maintenance of duplicate genes and their functional redundancy by reduced expression.
Trends Genet. 26:425–430. doi:10.1016/j.tig.2010.07.002
Rafalski, J.A. 2010. Association genetics in crop improvement. Curr. Opin.
Plant Biol. 13:1–7. doi:10.1016/j.pbi.2009.12.004
Richards, C.M., G.M. Volk, A.A. Reilley, A.D. Henk, D.R. Lockwood, P.A.
Reeves, et al. 2008. Genetic diversity and population structure in
Malus sieversii, a wild progenitor species of domesticated apple. Tree
Genet. Genomes 5:339–347. doi:10.1007/s11295-008-0190-9
Segura, V., C. Cilas, and E. Costes. 2008. Dissecting apple tree architecture
into genetic, ontogenetic and environmental effects: Mixed linear
modelling of repeated spatial and temporal measures. New Phytol.
178:302–314. doi:10.1111/j.1469-8137.2007.02374.x
Sun, W., Z.Y. Cao, Y. Li, Y.X. Zhao, and H. Zhang. 2007. A simple and effective method for protein subcellular localization using Agrobacteriummediated transformation of onion epidermal cells. Biologia 62:529–
532. doi:10.2478/s11756-007-0104-6
Thornsberry, J.M., M.M. Goodman, J. Doebley, S. Kresovich, D. Nielsen,
and E.S. Buckler. 2001. Dwarf8 polymorphisms associate with variation in flowering time. Nat. Genet. 28:286–289. doi:10.1038/90135
Velasco, R., A. Zharkikh, J. Affourtit, A. Dhingra, A. Cestaro, A. Kalyanaraman, et al. 2010. The genome of the domesticated apple (Malus ×
domestica Borkh.). Nat. Genet. 42:833–839. doi:10.1038/ng.654
Verde, I., N. Bassil, S. Scalabrin, B. Gilmore, C.T. Lawley, K. Gasic, et al.
2012. Development and evaluation of a 9K SNP array for peach by
internationally coordinated SNP detection and validation in breeding
germplasm. PLoS ONE 7:E35668. doi:10.1371/journal.pone.0035668
Verde, I., A.G. Abbott, S. Scalabrin, S. Jung, S. Shu, F. Marrono, et al. 2013.
The high-quality draft genome of peach (Prunus persica) identifies
unique patterns of genetic diversity, domestication and genome evolution. Nat. Genet. 45:487–494. doi:10.1038/ng.2586
Wagner, I., and N.F. Weeden. 2000. Isozyme in Malus sylvestris, Malus ×
domestica and in related Malus species. Acta Hortic. 538:51–56.
Wen, Y.Q., J. Cui, Y. Zhang, C.Q. Duan, and Q.H. Pan. 2013. Comparison of
organic acid levels and L-IdnDH expression in Chinese-type and European-type grapes. Euphytica 196:63–76. doi:10.1007/s10681-013-1014-z
Wu, J., H. Gao, L. Zhao, X. Liao, F. Chen, Z. Wang, et al. 2007. Chemical
compositional characterization of some apple cultivars. Food Chem.
103:88–93. doi:10.1016/j.foodchem.2006.07.030
Wu, J., Z. Wang, Z. Shi, S. Zhang, R. Ming, S. Zhu, et al. 2013. The genome
of the pear (Pyrus bretschneideri Rehd.). Genome Res. 23:396-408.
doi: 10.1101/gr.144311.112
Xu, K., A. Wang, and S. Brown. 2012. Genetic characterization of the Ma
locus with pH and titratable acidity in apple. Mol. Breed. 30:899–912.
doi:10.1007/s11032-011-9674-7
Xu, M., and S.S. Korban. 2002. A cluster of four receptor-like genes resides
in the Vf locus that confers resistance to apple scab disease. Genetics
162:1995–2006.
Xu, Q., L.L. Chen, X. Ruan, D. Chen, A. Zhu, C. Chen, et al. 2013. The
draft genome of sweet orange (Citrus sinensis). Nat. Genet. 45:59–66.
doi:10.1038/ng.2472
Yu, J., G. Pressoir, W.H. Briggs, B. Vroh, M. Yamasaki, J.F. Doebley, et al.
2006. A unified mixed-model method for association mapping that
accounts for multiple levels of relatedness. Nat. Genet. 38:203–208.
doi:10.1038/ng1702
Yu, J.M., and E.S. Buckler. 2006. Genetic association mapping and
genome organization of maize. Curr. Opin. Biotechnol. 17:155–160.
doi:10.1016/j.copbio.2006.02.003
Zhang, J., U. Baetz, U. Krügel, E. Martinoia, and A. De Angeli. 2013. Identification of a probable pore-forming domain in the multimeric vacuolar anion channel AtALMT9. Plant Physiol. 163:830–843. doi:10.1104/
pp.113.219832
Zhang, Q., B.Q. Ma, H. Li, Y.S. Chang, Y.Y. Han, J. Li, et al. 2012. Identification, characterization, and utilization of genome-wide simple
sequence repeats to identify a QTL for acidity in apple. BMC Genomics 13:537. doi:10.1186/1471-2164-13-537
the pl ant genome

november 2015

vol . 8, no . 3