THE ROLE OF AUXIN AND ETHYLENE IN ADVENTITIOUS ROOT

THE ROLE OF AUXIN AND ETHYLENE IN ADVENTITIOUS ROOT FORMATION
IN ARABIDOPSIS AND TOMATO
BY
POORNIMA SUKUMAR
A Dissertation Submitted to the Graduate Faculty of
WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND SCIENCES
in Partial Fulfillment of the Requirements
for the Degree of
DOCTOR OF PHILOSOPHY
In the Department of Biology
May 2010
Winston-Salem, North Carolina
Approved By:
Gloria K. Muday, Ph.D., Advisor
Examining Committee:
Brenda S. J. Winkel, Ph.D., Chair
Susan E. Fahrbach, Ph.D.
Anita K. McCauley, Ph.D.
Brian W. Tague, Ph.D.
ACKNOWLEDGMENTS
“Live as if you were to die tomorrow. Learn as if you were to live forever.”
Mohandas Gandhi
First and foremost, I would like to thank my advisor Dr Gloria Muday for all her
help with scientific as well as several aspects of my graduate student life. I appreciate
your constant encouragement, support, and advice throughout my graduate studies. I owe
my passion for science and teaching to your incessant enthusiasm and challenges.
I am grateful to my committee members, Dr Brian Tague, Dr Susan Fahrbach, Dr
Anita McCauley, and Dr Brenda Winkel for their encouragement, and assistance. I am
indebted to you for providing valuable suggestions and ideas for making this project
possible.
I appreciate the friendship and technical assistance by all my lab mates. In
particular, I like to thank Sangeeta Negi for helping me with tomato research and making
the lab more fun. I am grateful to Dan Lewis for his advice and help with figuring out
imaging and molecular techniques, and Mary Beth Lovin for her sincere friendship and
positive thoughts. I thank Hanya Chrispeels, Jonathan Isley, and Monica Jenks for being
there for me everyday. I also acknowledge all the financial support for travel, facilities
and opportunities provided by the Department of Biology.
I am obliged to my father Sukumara Kurup, my mother Dr Sujatha, my brother Dr
Kumar, my sister in law Dr Menon, my twin Dr Sukumar, and my brother in law Dr
Mohanan for their relentless love, encouragement, and support. They are my ideals and I
hope I can be as successful as them one day. Finally, I like to thank the higher power for
guiding me, giving me strength, and for helping me making the right choices.
ii
TABLE OF CONTENTS
ACKNOWLEDGMENTS………………………………………………………………...ii
TABLE OF CONTENTS………………………………………………………………...iii
LIST OF TABLES………………………………………………………………………..vi
LIST OF FIGURES……………………………………………………………………...vii
ABSTRACT……………………………………………………………………………...ix
CHAPTER I……………………………………………………………………………….1
INTRODUCTION………………………………………………………………...1
Environmental factors regulate adventitious root formation……………...1
Development of adventitious roots………………………………………..3
Auxin transport, synthesis, and signaling regulates lateral root
development……………………………………………………………….4
Positional specificity of lateral root formation……………………………7
Ethylene signaling and synthesis regulates root development…………….8
Treatment with exogenous hormones alters adventitious root formation…9
Positional specificity of adventitious root formation…………………….11
Auxin-ethylene crosstalk involved in adventitious root formation………12
Use of genetics to study adventitious root formation……………………13
Literature cited…………………………………………………………...15
CHAPTER II……………………………………………………………………………..26
Polar auxin transport mediated by ABCB19 and PIN1 regulates adventitious root
formation in Arabidopsis.
iii
Abstract…………………………………………………………………..27
Introduction………………………………………………………………28
Results……………………………………………………………………33
Discussion………………………………………………………………..62
Methods…………………………………………………………………..69
Literature cited…………………………………………………………...75
CHAPTER III……………………………………………………………………………85
Auxin-ethylene cross talk drives adventitious root formation in Arabidopsis
Abstract…………………………………………………………………..86
Introduction………………………………………………………………87
Results……………………………………………………………………92
Discussion………………………………………………………………118
Methods…………………………………………………………………123
Literature cited………………………………………………………….129
CHAPTER IV…………………………………………………………………………..136
Genetic dissection of the role of the ethylene in regulating auxin-dependent lateral
and adventitious root formation in tomato
Abstract…………………………………………………………………137
Introduction……………………………………………………………..138
Results…………………………………………………………………..143
Discussion………………………………………………………………165
Methods…………………………………………………………………171
Literature cited………………………………………………………….175
iv
CHAPTER V…………………………………………………………………………...183
CONCLUSION…………………………………………………………………183
Literature cited………………………………………………………………….195
APPENDIX……………………………………………………………………………..198
Introduction……………………………………………………………………..198
Results…………………………………………………………………………..200
Discussion………………………………………………………………………208
Methods…………………………………………………………………………210
Literature cited………………………………………………………………….212
CURRICULUM VITAE………………………………………………………………..213
v
LIST OF TABLES
Table I-I: Effect of application of different hormones on adventitious root formation...10
Table II-I: Auxin from the shoot is important for adventitious root formation………...39
Table II-II: Root excision alters ABCB19:GFP fluorescence…………………………..55
Table A-I: Changing local auxin maxima from apical end to basal end changes the
position of adventitious root formation…………………………………………………203
vi
LIST OF FIGURES
Figure II-1: Removal of basal portion of hypocotyl and root increases adventitious root
formation in Arabidopsis………………………………………………………………...34
Figure II-2: Adventitious roots emerge from pericycle tissues of the hypocotyl………35
Figure II-3: Effect of scr1 and shr1 mutations on adventitious root formation………...38
Figure II-4: The effect of IAA on adventitious root formation…………………………41
Supplemental Figure II-1: Free IAA levels…………………………………………...45
Figure II-5: Auxin signaling and transport are required for adventitious root
formation…………………………………………………………………………………46
Supplemental Figure II-2: Transcript abundance of IAA signaling and IAA transport
genes……………………………………………………………………………………..49
Figure II-6: PIN1 transcription and pABCB19::ABCB19:GFP protein accumulation is
enhanced with excision…………………………………………………………………..53
Figure II-7: Phosphorylation regulates localization of adventitious roots……………...58
Figure III-1: Ethylene negatively affects adventitious root formation and is induced with
excision…………………………………………………………………………………..93
Figure III-2: Ethylene can inhibit auxin induction of adventitious root formation……..97
Supplemental Figure III-1: Adventitious roots formed in intact or root excised in wild
type and, etr1-1................................................................................................................100
Figure III-3: Ethylene inhibits IAA transport and free IAA levels in hypocotyls…….102
Figure III-4: Flavonoids are induced with excision and negatively regulates adventitious
root formation…………………………………………………………………………..106
vii
Figure III-5: Ethylene induces flavonoids in hypocotyls and effect of ethylene on
adventitious root formation is partially dependent on flavonoids……………………...109
Supplemental Figure III-2: Relative transcript levels of CHS in Col and eto1-1…….113
Figure III-6: Ethylene regulation of auxin transport proteins mediating auxin transport
required for adventitious root formation………………………………………………..115
Figure IV-1: Lateral root formation in tomato is influenced by mutations that alter
ethylene signaling and synthesis. Roots were grown for 8 days on nutrient agar……...144
Figure IV-2: ACC reduces root initiation in Pearson, but not in the Nr mutant………147
Figure IV-3: Ethylene enhances adventitious root formation in tomato hypocotyls…..151
Figure IV-4: In tomato roots acropetal and basipetal IAA transport are positively
regulated by ethylene…………………………………………………………………...154
Figure IV-5: Ethylene alters basipetal auxin transport in tomato
hypocotyls.……………………………………………………………………………...157
Figure IV-6: In tomato roots free IAA content is reduced two days after 1 µM ACC
treatment………………………………………………………………………………..160
Figure IV-7: Effect of ethylene on free IAA content in tomato hypocotyls…………...161
Figure IV-8: Nr has altered responses to auxin in both lateral and adventitious root
formation………………………………………………………………………………..163
Figure V-1: Model for excision induced adventitious root formation…………………190
Figure V-II: Cell model for excision induced adventitious root formation…………...192
Figure A-1: Shifting auxin maxima from apex to base of hypocotyl explant can change
the position of adventitious root formation and auxin accumulation…………………..201
Figure A-2: Acropetal auxin transport can be observed after polarity reversal………..206
viii
ABSTRACT
Sukumar, Poornima
ROLE OF AUXIN AND ETHYLENE IN ADVENTITIOUS ROOT FORMATION IN
ARABIDOPSIS AND TOMATO
Dissertation under the direction of Gloria K.Muday, Ph.D., Professor of Biology
Adventitious roots emerge from aerial plant tissues. Although important for clonal
propagation of commercially important crop species, few studies have explored the
mechanisms driving the development of these roots. This thesis research explored the
hormonal controls and molecular mechanisms of adventitious root formation in
Arabidopsis thaliana (Arabidopsis) and Solanum lycopersicum (tomato). Removal of the
hypocotyl base and root from Arabidopsis seedlings enhanced the frequency of
adventitious root formation. ACC treatment and mutations that cause enhanced ethylene
synthesis reduced adventitious root formation in Arabidopsis, but enhanced adventitious
root formation in tomato, with opposite effects found in ethylene insensitive mutations.
These results are consistent with ethylene oppositely regulating adventitious root
formation in these two species, while auxin has a similar stimulatory effect on
adventitious root formation in both. Root excision increases both adventitious root
formation and auxin transport. Additionally, local increases in auxin induced reporter
expression after excision precede adventitious root formation and predict the position of
root formation. These results indicate that local auxin accumulation due to changing
transport may drive adventitious root formation. Moreover, the auxin transport proteins
ABCB19 and PIN1, are required for efficient adventitious root formation. Transcript
ix
levels of PIN1 increased with root excision in hypocotyls, while neither ABCB19
transcripts nor pABCB19:GFP fluorescence was found to change. In contrast,
pABCB19::ABCB19:GFP fluorescence was increased in excised Arabidopsis hypocotyls,
suggesting an increase in protein accumulation through post-transcriptional mechanisms.
A protein phosphatase inhibitor decreased ABCB19 accumulation, reduced auxin
transport and accumulation, and altered location of adventitious root formation,
suggesting that phosphorylation might modulate the ABCB19 protein abundance and/or
activity. In addition, ethylene inhibits basipetal auxin transport in hypocotyls of
Arabidopsis in an ABCB19 dependent manner. Excision and elevated ethylene levels
enhanced the accumulation of transcripts encoding the flavonoid biosynthetic enzyme
chalcone synthase, as well as flavonoids metabolites, which have previously been shown
to regulate auxin transport. The tt4 mutant, which lacks flavonoids, had altered
adventitious root formation and was insensitive to ACC treatment. These identify
changes in auxin transport, through altered accumulation of transport proteins and
transport regulators, as critical events for the excision and ethylene regulation of
adventitious root formation.
x
CHAPTER I
INTRODUCTION
The architecture of roots is defined by a primary root and secondary or lateral
roots, which develop as branches off the primary roots. In addition, adventitious roots are
aerial borne roots formed post embryonically from shoot tissues of some plants. These
aerial roots serve numerous functions in plants including nutrient and water uptake,
providing mechanical support, and in vegetative propagation. Because these roots can
perform all the functions of primary and secondary roots, induction of adventitious roots
have been used agriculturally to propagate commercially important species from stem
cuttings (reviewed in De-Klerk et al., 1999). This technique allows clonal multiplication
of ideal varieties and propagation of species that have poor seed set or germination.
Though adventitious root formation is widely used in agriculture, the development of
these roots, the mechanism that drive development, and the signals that control this
process are much more poorly understood than for primary and lateral root development.
Environmental factors regulate adventitious root formation
Many environmental factors dictate the root architecture of plants (Furuya and
Torrey, 1964; Lovin, 2009). The majority of the published experiments on adventitious
root formation focus on the effects of environmental factors. Growth of plants in red light
produced the maximum number of adventitious roots in beans and birch, and yellow light
induces adventitious roots in cherry, while blue light inhibits the formation in all species
(Fletcher et al., 1965; Pinker et al., 1989; Fuernkranz et al., 1990). Light quantity is also
an important factor, as there is a reduction in adventitious roots formation in maize under
1
shaded conditions, with plants having altered root/shoot biomass allocation (Hebert et al.,
2001). In Arabidopsis, the light hypersensitive argonaute 1 (ago1) mutant had reduced
adventitious root formation (Sorin et al., 2005). Moreover, a species-specific effect of day
and night temperature on development of adventitious root formation was observed in
Eucalyptus, with temperatures lower than 15o C and higher than 40oC inhibiting
adventitious root development (Correa and Fett-Neto, 2004). Situations of stress in the
environment, such as wounding and flooding, also induces the formation of adventitious
roots in many plants, perhaps as an adaptive strategy (Mergemann and Sauter, 2000;
Visser et al., 1996).
Root development is extremely sensitive to available nutrients. Effects of nitrates,
phosphates, and sulphates on lateral root formation and elongation have been well
documented (reviewed in Lopez-Bucio et al., 2003; Walch-Liu et al., 2006), while fewer
reports have examined nutrient effects on adventitious root development. When apple
stem cuttings were treated with suboptimal levels of rooting media, sucrose was found to
enhanced the formation of adventitious roots (Calamar and de Klerk, 2002). Elevated
sucrose concentrations also enhance the formation of adventitious roots in rose stems,
with higher sucrose to nitrogen ratios leading to the greatest induction (Hyndman et al.,
1981). Furthermore, adventitious root number and length in Eucalyptus were found to be
affected by mineral nutrient concentrations, with some nutrients including zinc and
calcium, had a positive effect, while other nutrients, such as iron and manganese, had a
negative effect (Schwambach et al., 2005). Phosphorus deficiency reduces adventitious
root elongation, but not the number of roots that formed (Schwambach et al., 2005).
Moreover, some of the effects of mineral nutrients were specific to the stage of
2
development of adventitious roots (Schwambach et al., 2005). In addition to external
factors, age and ecotype of plants also affected adventitious root formation in pine and
Arabidopsis (Diaz-Sala et al., 1996; King and Stimart, 1998). These results indicate that
adventitious root formation involves a complex interaction of external factors.
Development of adventitious roots
Root development follows a precise developmental program, although the
initiation of this process is plastic. The development of lateral roots along primary roots
begins when pericycle cells become activated to undergo a precise series of cell divisions
to form root primordia which then differentiate into emerged lateral roots (Malamy and
Benfey, 1997). In cereals, lateral roots can also emerge from the endodermal layer of
roots (reviewed in Peret et al., 2009). Similar to lateral roots, adventitious roots originate
from pericycle cells of the hypocotyl which progress through similar stages of division
and development as lateral root primordia (Falasca and Altamura, 2003; Chapter 2). In
addition, adventitious roots can develop from alternate tissues under certain conditions.
When treated with exogenous auxin, cells of the root endodermis and cortex were found
to contribute to the formation of adventitious roots, with longer treatments resulting in
adventitious root development from callus (Falasca and Altamura, 2003). In some woody
species such as apple, adventitious roots emerge from cambium cells (as reviewed in DeKlerk et al., 1999) while, under in vitro tissue culture conditions, Arabidopsis thin cell
layer (TCL), consisting of epidermis and cortex, can produce adventitious roots when
treated with IBA (indole 3-butyric acid) (Falasca et al., 2004). These reports indicate that
adventitious root formation is complex in its development and that a number of factors
3
may regulate their formation, yet generally adventitious roots share developmental origin
and progression of growth in common with lateral roots.
Auxin transport, synthesis, and signaling regulates lateral root development
Auxin synthesis, signaling and transport are the key components involved in the
regulation of root development (reviewed in Peret et al., 2009). Synthesis of auxin
involves two pathways with tryptophan dependent and tryptophan independent pathway
(reviewed in Woodward and Bartel, 2005). Auxin can be inactivated thorough
conjugation and oxidation (reviewed in Woodward and Bartel, 2005). Mutant analysis
have identified some of the enzymes and components of these pathways, yet our
understanding of this complex pathway is still limited (Strader and Bartel, 2008).
Increased auxin concentration through exogenous application or genetic manipulations
has been shown to result in enhanced lateral root formation (reviewed in Malamy, 2005).
In addition, the Arabidopsis mutants, superroot and rooty, which have high endogenous
levels of IAA, exhibit a proliferation of lateral and adventitious roots (Boerjan et al.,
1995; Celenza et al., 1995).
Auxin is synthesized in the shoot apex and young leaves and then transported
towards the root shoot junction uni-directionally through the stem (Sieberer and Leyser,
2006). In the roots, auxin moves in two directions in two distinct tissues. Basipetal
movement occurs from the root tip in epidermal and cortical cells, while acropetal
transport occurs from the root shoot junction towards the root in cells of the central
cylinder (reviewed in Muday and DeLong, 2001). Cell to cell movement of IAA is
mediated by transport proteins located in the plasma membrane. These IAA transport
4
proteins include influx carriers such as AUX1 (AUXIN RESISTANT 1) and LAX (LIKE
AUX) (Bennett et al., 1996; Swarup et al., 2008), and efflux carriers such as members of
the PIN (PIN FORMED) and ABCB/MDR/PGP (ATP BINDING CASSETTE
B/MULTIDRUG RESISTANCE/P-GLYCOPROTEIN) protein families (Galweiler et al.,
1998; Noh et al., 2001; Teale et al., 2006; Zazimalova et al., 2010). The asymmetric
localization of PIN proteins have been suggested to play a critical role in defining the
polarity of IAA transport (reviewed in Muday and DeLong, 2001). Plants with mutations
in the genes encoding these proteins were utilized to explore the roles of specific auxin
transport proteins in adventitious root formation, as described in Chapter 2.
Auxin transport is also required for initiation and elongation of lateral roots as
judged by chemical, physical and genetic methods to block auxin flow (Reed et al., 1998;
Casimiro et al., 2001). Defects in AUX1, LAX , PIN1, and ABCB19/PGP19/MDR1
reduce initiation and/or elongation of lateral roots due to reduced movement of auxin
(Marchant et al., 2002; Swarup et al., 2008; Wu et al., 2007; Benkova et al., 2003).
Lateral root development has been shown to require complex changes in expression of
PIN proteins in developing primordia (Sauer et al., 2006; Benkova et al., 2003).
Examination of PIN3- and PIN7-GFP fusions in roots bent to initiate lateral roots has
revealed that the expression of these proteins is reduced in the roots below the point of
the bend, while AUX1-YFP is increased at the point of root formation, creating auxin
maxima that drives primordia formation (Laskowski et al., 2008). These results suggest
that regulation of carrier protein-mediated auxin transport plays an important role in
lateral root development.
5
Auxin signaling begins with the binding of auxin to the TIR1 (TRANSPORT
INHIBITOR RESPONSE 1) receptor. TIR1 is an F-box protein, part of ubiquitin ligase
E3 complex (reviewed in Parry et al., 2009). Binding of auxin to the receptor complex
promotes its interaction with AUX/IAA proteins, which are repressors of auxin signaling,
and targets them to be degraded by the 26S proteasome (Kepinski and Leyser, 2002).
This results in the release of auxin response factors (ARFs), transcription factors that then
lead to auxin induced gene expression (reviewed in Leyser, 1998). In Arabidopsis, there
are 22 known ARF proteins and 29 AUX/IAA proteins (Remington et al., 2004). The
model for the function of these transcriptional regulation is that sets of these proteins
interact to lead to tissue and developmental patterns of gene expression (Weijers et al.,
2005; Santner and Estelle, 2010).
The roles of several of the ARF and AUX/IAA in regulating development in
Arabidopsis have been examined through mutant analysis, though overlapping expression
and function of these proteins make it difficult to deduce the complex pattern of
interaction and functions of these proteins (reviewed in Reed, 2001). Several studies have
identified the roles of genes encoding auxin signaling proteins that reduce lateral root
formation including the auxin receptor, (TIR1), auxin response factors (ARF), and auxin
induced genes (IAA/AUX) (reviewed in Casimiro et al., 2003). These mutants were
utilized to understand auxin signaling required for adventitious root formation as
described in Chapter 2. As auxin transport, signaling, and synthesis are important for root
development, understanding these complex phenomena helps in dissecting the
mechanisms of root development.
6
Positional specificity of lateral root formation
Despite all the studies examining the progression of development of root lateral
organs, the signals that define the longitudinal position along roots or hypocotyls from
which roots originate are still unknown. Auxin not only regulates the development of
roots but some studies have suggested a role for auxin in regulating the position of
formation of lateral roots (Dubrovsky et al., 2008). When an auxin biosynthetic enzyme
was randomly activated through Cre/Lox system that lead to localized auxin synthesis,
the pattern of position of formation of lateral roots was altered (Dubrovsky et al., 2008).
Primary roots wave when grown on hard agar medium at an angle, with lateral roots
emerging from convex sides of the waves (De Smet et al., 2007). This formation was
altered in auxin transport defective mutant aux1 (De Smet et al., 2007). Additionally,
fluctuation of auxin accumulation was found to modulate the spacing of development of
lateral roots (De Smet et al., 2007). Altered expression of the auxin signaling proteins
IAA12 and ARF5, was shown to mislocalize lateral roots (De Smet et al., 2010). The
triple mutant pin2pin3pin7 which is defective in auxin transport proteins not only has
increased lateral root density but at times these lateral roots emerged fused together
(Laskowski et al., 2008). In roots bent to initiate lateral roots, the expression of PIN3 and
PIN7 proteins reduce while expression of AUX1 increases, creating an auxin maximum
that drives primordia formation (Laskowski et al., 2008). These results suggest that auxin
transport, synthesis and signaling are involved in defining the position, and the formation
of, the lateral roots.
7
Ethylene signaling and synthesis regulates root development
In addition to auxin, another major plant hormone involved in regulation of root
development is ethylene. The ethylene signaling pathway is mediated by a receptor
family that includes ETR1 (ETHYLENE RESISTANT 1) (reviewed in Kieber, 1997).
Binding of ethylene to these receptors inactivates CTR1 (CONSTITUTIVE TRIPLE
RESPONSE 1), which encodes a kinase that is implicated in a MAPKKK cascade
(reviewed in Bleecker and Kende, 2000). Both receptors and CTR1 negatively regulate
this pathway (Kieber, 1997). Downstream of CTR1 is EIN2 (ETHYLENE
INSENSITIVE 2), a Nramp metal ion transporter, which is required for ethylene
signaling (reviewed in Bleecker and Kende, 2000). EIN3 (ETHYLENE INSENSITVE 3)
and EILs (EIN3 LIKE) are transcription factors that regulate the expression of ethylene
induced genes (reviewed in Bleecker and Kende, 2000). Ethylene biosynthesis begins
with formation of ACC (Aminocyclopropane-1-carboxylic acid) by the enzyme ACC
synthase (ACS), which is then converted to ethylene by the enzyme, ACC oxidase
(Argueso et al., 2007). ACS is modulated by ETO (ETHYLENE OVERPRODUCER),
which regulates its protein stability (Chae et al., 2003). Plants with mutations in ethylene
signaling or synthesis genes have provided valuable insights into the physiological
proceses mediated by ethylene.
In Arabidopsis, etr1 and ein2 have enhanced lateral root formation, while eto1
and ctr1 have reduced formation of lateral roots (Negi et al., 2008). Similarly, the tomato
NR (Never ripe) mutant, which has a defect in a gene encoding an ethylene receptor,
exhibits enhanced formation of lateral roots (Negi et al., 2010). Auxin and ethylene were
shown to oppositely modulate lateral root development (Negi et al., 2008; Ivanchenko et
8
al., 2008). Furthermore, ethylene enhances auxin transport, while it inhibits the formation
of lateral roots in Arabidopsis and tomato (Negi et al., 2010; Negi et al., 2008). The
ethylene effect on lateral root formation is lost in auxin transport mutants, suggesting
that the effect acts through these auxin transport proteins (Negi et al., 2008). These
results indicate that ethylene is an important regulator of plant growth and development
and that several of these physiological processes require complex interaction of auxin and
ethylene.
Treatment with exogenous hormones alters adventitious root formation
The role of plant hormones in adventitious root formation has been examined in
numerous studies with a range of species, doses, growth, and treatment conditions
(reviewed in Li et al., 2009). Because of these variables, the effects of different hormones
from these reports are in many cases contradictory, as summarized in Table I-I. The two
hormones for which the data are the most clear are auxin and ethylene. In most species,
ethylene has a positive effect on adventitious root formation (Roy et al., 1972; reviewed
in De-Klerk et al., 1999; Clark et al., 1999; Negi et al., 2010), but in few cases ethylene
has been shown to inhibit (Coleman et al., 1980; Nordstrom and Eliasson, 1984) or have
no effect (Batten and Mullins, 1978) on adventitious roots formation. Genetic tools are
now available to study this process in at least two species, Arabidopsis and tomato.
Chapters 3 and 4 of this thesis focus on examining the regulation of this process by
ethylene.
Many internal and external pathways of regulation culminate at one central point
to regulate physiological process. For adventitious root formation, this underlying signal
9
Table I-I: Effect of application of different hormones on adventitious root formation.
Hormone
Effect
Species
Reference
Abscisic acid
Positive
Beans
Tari and Nagy, 1996
Tomato
Basu et al., 1970
Abscisic acid
Negative
Rice
Steffens et al., 2006
Cytokinin
No effect
Arabidopsis
Kuroha et al., 2006
Cytokinin
Positive
Centaurium erthraea
Subotic et al., 2009
Cytokinin
Negative
Arabidopsis
Pernisova et al., 2009
Gibberellic acid
No effect
Rice
Steffens et al., 2006
Gibberellic acid
Positive
Peas
Coleman and Greyson, 1977
Tomato
Hansen, 1975
Soybean
Steffens et al., 2006
Brassinosteroids Positive
10
might be the plant hormone auxin. Auxin has been commercially used to induce
adventitious root formation in stem cuttings of many species (reviewed in De-Klerk et al.,
1999). Most commonly, one of the natural forms of auxin, IBA (indole-3-byutric acid), is
used because of its greater stability than IAA (indole-3-acetic acid), even though IAA is
more abundant than IBA in plants. Several studies have compared the effects of IAA and
IBA in inducing adventitious roots and find that in most cases IBA induces adventitious
roots to a greater extent than IAA (Eliasson and Areblad, 1984; Riov and Yang, 1989).
This is not true in Arabidopsis, where IAA was found to induce a greater number of
adventitious roots than IBA (Chapter 3).
Auxin is the central point of regulation of adventitious root formation by
environmental factors such as temperature, light and nutrients as well as cross talk with
other hormones (Correa and Fett-Neto, 2004; Fletcher et al., 1965; reviewed in De-Klerk
et al., 1999). In contrast to other hormones, in most species auxin positively regulates
adventitious root formation (reviewed in De-Klerk et al., 1999; Chapter 2). To our
knowledge, one study has suggested a negative effect of one form of natural auxin;
indole-3-acetic acid (IAA) at lower concentrations (Eliasson and Areblad, 1984). This
suggests that auxin positively regulates adventitious root formation consistently across
species. The goal of the work described in chapter 2 of this thesis was to explore the
mechanisms by which auxin enhances adventitious root formation using the genetic tools
available in Arabidopsis.
11
Positional specificity of adventitious root formation
Very few studies have looked at mechanisms that define the longitudinal position
of adventitious root formation. Excision-enhanced adventitious roots seem to develop at
1-2 mm above the site of excision, which coincides with positions of auxin accumulation
in hypocotyls of Arabidopsis (Chapter 2). Additionally, treatment with the protein
phosphatase inhibitor, canthardin, results in reduced auxin transport and delocalization of
adventitious root formation along the hypocotyls (Chapter 2). These results indicate that
auxin transport and local gradients might be involved in determining the position of
adventitious root formation, similar to formation of lateral roots.
Auxin-ethylene cross talk in adventitious root formation
Auxin-ethylene crosstalk has shown to be important in modulating diverse
physiological processes, including root growth and lateral root development (Ruzicka et
al., 2007; Stepanova et al., 2007; Negi et al., 2008). This mechanism for cross talk has
been explored by some studies, which found an interdependency of auxin and ethylene in
synthesis, movement, and signaling of both hormones. Auxin treatments in stems of
Rumex palustris under flooded conditions, and mung-bean, have been found to enhance
the production of the ethylene precursor, ACC (1-aminocyclopropane-1-carboxylic acid),
and ethylene, respectively, resulting in induction of adventitious roots (Riov and Yang,
1989; Visser et al., 1996). But in peas, in which ethylene inhibits adventitious roots, low
dose of IAA were found to enhance ethylene production, resulting in inhibition of
adventitious roots, which were rescued by application of high doses of auxin (Nordstrom
and Eliasson, 1984). Conversely, ethylene has been shown to induce auxin synthesis in
12
root tips of primary roots (Ruzicka et al., 2007; Stepanova et al., 2007). Additionally,
ethylene-enhanced auxin sensitivity has been shown to increase adventitious root
formation in Rumex palustris under flooded conditions (Visser et al., 1996). Consistent
with this, the response of ethylene-insensitive mutants to auxin treatments is altered in
tomato and Arabidopsis (Chapter 4; Clark et al., 1999). These results suggest cross talk
between auxin and ethylene occurs at multiple levels in a species specific manner.
Use of genetics to study adventitious root formation
Genetic approaches to understand the mechanism of auxin-ethylene cross talk is a
valuable tool to understand the physiology and mechanisms driving adventitious root
formation. Altered expression of auxin response factor and auxin transport proteins were
found to reduce formation of adventitious roots in rice (Liu et al., 2005; Xu et al., 2005;
Liu et al., 2009). In Arabidopsis, mutants defective in initiation, development, and
elongation of adventitious roots have been isolated that are temperature sensitive, a few
of which had defective auxin signaling (Konishi and Sugiyama, 2003). In tomato, the
Never Ripe (NR) mutant has been shown to have reduced sensitivity to auxin-induced
adventitious root formation (Clark et al., 1999). Though some studies have revealed a
cross talk of auxin and ethylene using mutants, the mechanism of regulation at the level
of signaling, synthesis, and transport are still unknown.
This thesis utilized mutants and transgenic lines available in Arabidopsis to
analyze the components of auxin signaling, synthesis, and transport required for
adventitious root formation, as detailed in chapter 2. Additionally, these experiments
explored possible cross talk between auxin and ethylene at the level of signaling,
13
synthesis, and transport during adventitious root formation in both Arabidopsis and
tomato as detailed in chapters 3 and 4, respecitvely. The results suggest that auxin
transport and local auxin accumulation drives adventitious root formation in Arabidopsis.
Ethylene negatively affects both these processes, but has opposite physiological effects in
Arabidopsis and tomato, reducing the formation of adventitious roots in Arabidopsis and
enhancing the formation in tomato. The results from this thesis provide insight into the
components of auxin and ethylene signals which regulate adventitious root formation.
14
Literature cited
Argueso CT, Hansen M, Kieber JJ (2007) Regulation of ethylene biosynthesis. Journal
of Plant Growth Regulation 26: 92-105
Basu R, Roy B, Bose T (1970) Interaction of abscisic acid and auxins in rooting of
cuttings. Plant and Cell Physiology 11: 681-684
Batten DJ, Mullins MG (1978) Ethylene and adventitious root formation in hypocotyl
segments of etiolated Mung-bean (Vigna radiata (L.) Wilczek) seedlings. Planta
138: 193-197
Benkova E, Michniewicz M, Sauer M, Teichmann T, Seifertova D, Jurgens G, Friml
J (2003) Local, efflux-dependent auxin gradients as a common module for plant
organ formation. Cell 115: 591-602
Bennett MJ, Marchant A, Green HG, May ST, Ward SP, Millner PA, Walker AR,
Schulz B, Feldmann KA (1996) Arabidopsis AUX1 gene: A permease-like
regulator of root gravitropism. Science 273: 948-950
Bleecker AB, Kende H (2000) Ethylene: A gaseous signal molecule in plants. Annual
Review of Cell and Developmental Biology 16: 1-+
Boerjan W, Cervera M-T, Delarue M, Beeckman T, Dewitte W, Bellini C, Caboche
M, van Onckelen H, Van Montagu M, Inze D (1995) Superroot, a recessive
mutation in Arabidopsis, confers auxin overproduction. Plant Cell 7: 1405-1419
Calamar A, de Klerk GJ (2002) Effect of sucrose on adventitious root regeneration in
apple. Plant Cell Tissue and Organ Culture 70: 207-212
15
Casimiro I, Beeckman T, Graham N, Bhalerao R, Zhang HM, Casero P, Sandberg
G, Bennett MJ (2003) Dissecting Arabidopsis lateral root development. Trends
in Plant Science 8: 165-171
Casimiro I, Marchant A, Bhalerao RP, Beeckman T, Dhooge S, Swarup R, Graham
N, Inze D, Sandberg G, Casero PJ, Bennett M (2001) Auxin transport promotes
Arabidopsis lateral root initiation. Plant Cell 13: 843-852
Celenza JL, Grisafi PL, Fink GR (1995) A Pathway for Lateral Root-Formation in
Arabidopsis-Thaliana. Genes & Development 9: 2131-2142
Chae HS, Faure F, Kieber JJ (2003) The eto1, eto2, and eto3 mutations and cytokinin
treatment increase ethylene biosynthesis in Arabidopsis by increasing the stability
of ACS protein. Plant Cell 15: 545-559
Clark DG, Gubrium EK, Barrett JE, Nell TA, Klee HJ (1999) Root formation in
ethylene-insensitive plants. Plant Physiol 121: 53-60
Coleman W, Greyson R (1977) Promotion of root initiation by Gibberellic acid in leaf
discs of tomato (Lycopersicon esculentum) culutred in vitro. New Phytologist 78:
47-54
Coleman W, Huxter T, Reid D, Thrope T (1980) Ethylene as an endogenous inhibitor
of root regeneration in tomato leaf disc cultures in vitro. Physiol Plant 48: 519525
Correa L, Fett-Neto A (2004) Effect of temperature on adventitious root development in
microcuttings of Eucalyptus Saligna Smith and Eucalyptus globulus Labill.
Journal of Thermal biology 29: 315-324
16
De-Klerk G, Krieken W, DeJong J (1999) The formation of adventitious roots: New
concepts, new possibilities. In Vitro Cell Dev Biol-Plant 35: 189-199
De Smet I, Lau S, Voss U, Vanneste S, Benjamins R, Rademacher EH, Schlereth A,
De Rybel B, Vassileva V, Grunewald W, Naudts M, Levesque MP,
Ehrismann JS, Inze D, Luschnig C, Benfey PN, Weijers D, Van Montagu
MCE, Bennett MJ, Jurgens G, Beeckman T (2010) Bimodular auxin response
controls organogenesis in Arabidopsis. Proceedings of the National Academy of
Sciences of the United States of America 107: 2705-2710
De Smet I, Tetsumura T, De Rybel B, Frey NFD, Laplaze L, Casimiro I, Swarup R,
Naudts M, Vanneste S, Audenaert D, Inze D, Bennett MJ, Beeckman T
(2007) Auxin-dependent regulation of lateral root positioning in the basal
meristem of Arabidopsis. Development 134: 681-690
Diaz-Sala C, Hutchison KW, Goldfarb B, Greenwood MS (1996) Maturation-related
loss in rooting competence by loblolly pine stem cutting: the role of auxin
transport, metabolism and tissue sensitivity. Physiol Plant 97: 481-490
Dubrovsky JG, Sauer M, Napsucialy-Mendivil S, Ivanchenko MG, Friml J,
Shishkova S, Celenza J, Benkova E (2008) Auxin acts as a local morphogenetic
trigger to specify lateral root founder cells. Proc Natl Acad Sci U S A 105: 87908794
Eliasson L, Areblad K (1984) Auxin effects on rooting in pea cuttings. Physiol Plant 61:
293-297
Falasca G, Altamura M (2003) Histological analysis of adventitious rooting in
Arabidopsis thaliana (L.) Heynh seedlings. Plant Biosystems 137: 265-274
17
Falasca G, Zaghi D, Possenti M, Altamura MM (2004) Adventitious root formation in
Arabidopsis thaliana thin cell layers. Plant Cell Rep 23: 17-25
Fletcher R, Peterson R, Zalik S (1965) Effect of Light Quality on Elongation,
Adventitious Root Production and the Relation of Cell Number and Cell Size to
Bean Seedling Elongation Plant Physiol 40: 541-548
Fuernkranz H, Nowak C, Maynard C (1990) Light effects on in vitro adventitious root
formation in axillary shoots of mature Prunus serotina. Physiol Plant 80: 337-341
Furuya M, Torrey J (1964) The reversible inhibition by red far-red light of auxin
induced lateral root initiation in isolated pea roots. Plant Physiol 39: 987-991
Galweiler L, Guan CH, Muller A, Wisman E, Mendgen K, Yephremov A, Palme K
(1998) Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular
tissue. Science 282: 2226-2230
Hansen J (1975) Light dependent promotion and inhibition of adventitious root
formation by gibberellic acid. Planta 123: 203-205
Hebert Y, Guingo E, Loudet O (2001) The response of root/shoot partitioning and root
morphology to light reduction in maize genotypes. Crop Science 41: 363-371
Hyndman S, Hasegawa P, Bressan R (1981) The role of sucrose and nitrogen in
adventitious root formation on cultured rose shoots Plant Cell, Tissue and Organ
Culture 1: 229-238
Ivanchenko MG, Muday GK, Dubrovsky JG (2008) Ethylene-auxin interactions
regulate lateral root initiation and emergence in Arabidopsis thaliana. Plant J 55:
335-347
18
Kepinski S, Leyser O (2002) Ubiquitination and auxin signaling: A degrading story.
Plant Cell 14: S81-S95
Kieber JJ (1997) The ethylene signal transduction pathway in Arabidopsis. Journal of
Experimental Botany 48: 211-218
King JJ, Stimart DP (1998) Genetic analysis of variation for auxin-induced adventitious
root formation among eighteen ecotypes of Arabidopsis thaliana L. Heynh. J
Hered 89: 481-487
Konishi M, Sugiyama M (2003) Genetic analysis of adventitious root formation with a
novel series of temperature-sensitive mutants of Arabidopsis thaliana.
Development 130: 5637-5647
Kuroha T, Ueguchi C, Sakakibara H, Satoh S (2006) Cytokinin receptors are required
for normal development of auxin-transporting vascular tissues in the hypocotyl
but not in adventitious roots. Plant and Cell Physiology 47: 234-243
Laskowski M, Grieneisen VA, Hofhuis H, Hove CA, Hogeweg P, Maree AF, Scheres
B (2008) Root system architecture from coupling cell shape to auxin transport.
PLoS Biol 6: e307
Leyser O (1998) Auxin signalling: Protein stability as a versatile control target. Current
Biology 8: R305-R307
Li S, Xue L, Xu S, Feng H, An L (2009) Mediators, Genes and signaling in
Adventitious rooting. Bot.Rev 75: 230-247
Liu HJ, Wang SF, Yu XB, Yu J, He XW, Zhang SL, Shou HX, Wu P (2005) ARL1, a
LOB-domain protein required for adventitious root formation in rice. Plant
Journal 43: 47-56
19
Liu SP, Wang JR, Wang L, Wang XF, Xue YH, Wu P, Shou HX (2009) Adventitious
root formation in rice requires OsGNOM1 and is mediated by the OsPINs family.
Cell Research 19: 1110-1119
Lopez-Bucio J, Cruz-Ramirez A, Herrera-Estrella L (2003) The role of nutrient
availability in regulating root architecture. Current Opinion in Plant Biology 6:
280-287
Lovin M (2009) Exploring the role of auxin in phenotypic plasticity in arabidopsis
thaliana root development. Dissertation. Wake Forest University, Winston Salem
Malamy J (2005) Intrinsic and environmental response pathways that regulate root
system architecture. Plant Cell Environ 28: 67-77
Malamy J, Benfey P (1997) Organization and cell differentiation in lateral roots of
Arabidopsis thaliana. Development 124: 33-44
Marchant A, Bhalerao R, Casimiro I, Eklof J, Casero PJ, Bennett M, Sandberg G
(2002) AUX1 promotes lateral root formation by facilitating indole-3-acetic acid
distribution between sink and source tissues in the Arabidopsis seedling. Plant
Cell 14: 589-597
Mergemann H, Sauter M (2000) Ethylene induces epidermal cell death at the site of
adventitious root emergence in rice. Plant Physiology 124: 609-614
Muday GK, DeLong A (2001) Polar auxin transport: controlling where and how much.
Trends in Plant Science 6: 535-542
Negi S, Ivanchenko MG, Muday GK (2008) Ethylene regulates lateral root formation
and auxin transport in Arabidopsis thaliana. Plant J 55: 175-187
20
Negi S, Sukumar P, Liu X, Cohen JD, Muday GK (2010) Genetic dissection of the
role of ethylene in regulating auxin-dependent lateral and adventitious root
formation in tomato. Plant J 61: 3-15
Noh B, Murphy AS, Spalding EP (2001) Multidrug resistance-like genes of
Arabidopsis required for auxin transport and auxin-mediated development. Plant
Cell 13: 2441-2454
Nordstrom A-C, Eliasson L (1984) Regulation of root formation by auxin-ethylene
interaction in pea stem cuttings. Physiol Plant 61: 298-302
Parry G, Calderon-Villalobos LI, Prigge M, Peret B, Dharmasiri S, Itoh H, Lechner
E, Gray WM, Bennett M, Estelle M (2009) Complex regulation of the
TIR1/AFB family of auxin receptors. Proceedings of the National Academy of
Sciences of the United States of America 106: 22540-22545
Peret B, De Rybel B, Casimiro I, Benkova E, Swarup R, Laplaze L, Beeckman T,
Bennett MJ (2009) Arabidopsis lateral root development: an emerging story.
Trends in Plant Science 14: 399-408
Peret B, Larrieu A, Bennett M (2009) Lateral root emergence: a difficult birth. Journal
of Experimental Botany 60: 3637-3643
Pernisova M, Klima P, Horak J, Valkova M, Malbeck J, Soucek P, Reichman P,
Hoyerova K, Dubova J, Friml J, Zazimalova E, Hejatko J (2009) Cytokinins
modulate auxin-induced organogenesis in plants via regulation of the auxin efflux.
Proceedings of the National Academy of Sciences of the United States of America
106: 3609-3614
21
Pinker I, Zoglauer G, Goring H (1989) Influence of light on adventitious root
formation in birch shoot culturesin vitro Biologia Plantarum 31: 254-260
Reed JW (2001) Roles and activities of Aux/IAA proteins in Arabidopsis. Trends in
Plant Science 6: 420-425
Reed RC, Brady SR, Muday GK (1998) Inhibition of auxin movement from the shoot
into the root inhibits lateral root development in arabidopsis. Plant Physiology
118: 1369-1378
Remington DL, Vision TJ, Guilfoyle TJ, Reed JW (2004) Contrasting modes of
diversification in the Aux/IAA and ARF gene families. Plant Physiology 135:
1738-1752
Riov J, Yang S (1989) Ethylene and Auxin-ethylene interaction in adventiitous root
formation in Mung bean (Vigna radiata) cuttings. Journal of Plant Growth
Regulation 8: 131-141
Roy B, Basu R, Bose T (1972) Interaction of auxins with growth-retarding, -inhibiting
and ethylene-producing chemicals in rooting of cuttings. Plant Cell Physiol 13:
1123-1127
Ruzicka K, Ljung K, Vanneste S, Podhorska R, Beeckman T, Friml J, Benkova E
(2007) Ethylene regulates root growth through effects on auxin biosynthesis and
transport-dependent auxin distribution. Plant Cell 19: 2197-2212
Santner A, Estelle M (2010) The ubiquitin-proteasome system regulates plant hormone
signaling. Plant Journal 61: 1029-1040
22
Sauer M, Balla J, Luschnig C, Wisniewska J, Reinohl V, Friml J, Benkova E (2006)
Canalization of auxin flow by Aux/IAA-ARF-dependent feedback regulation of
PIN polarity. Genes & Development 20: 2902-2911
Schwambach J, Fadanelli C, Fett-Neto AG (2005) Mineral nutrition and adventitious
rooting in microcuttings of Eucalyptus globulus. Tree Physiology 25: 487-494
Sieberer T, Leyser O (2006) Plant science - Auxin transport, but in which direction?
Science 312: 858-860
Sorin C, Bussell JD, Camus I, Ljung K, Kowalczyk M, Geiss G, McKhann H,
Garcion C, Vaucheret H, Sandberg G, Bellini C (2005) Auxin and light control
of adventitious rooting in Arabidopsis require ARGONAUTE1. Plant Cell 17:
1343-1359
Steffens B, Wang JX, Sauter M (2006) Interactions between ethylene, gibberellin and
abscisic acid regulate emergence and growth rate of adventitious roots in
deepwater rice. Planta 223: 604-612
Stepanova AN, Yun J, Likhacheva AV, Alonso JM (2007) Multilevel interactions
between ethylene and auxin in Arabidopsis roots. Plant Cell 19: 2169-2185
Strader LC, Bartel B (2008) A new path to auxin. Nature Chemical Biology 4: 337-339
Subotic A, Jevremovic S, Grubisic D (2009) Influence of cytokinins on in vitro
morphogenesis in root cultures of Centaurium erythraea-Valuable medicinal plant.
Scientia Horticulturae 120: 386-390
Swarup K, Benkova E, Swarup R, Casimiro I, Peret B, Yang Y, Parry G, Nielsen E,
De Smet I, Vanneste S, Levesque MP, Carrier D, James N, Calvo V, Ljung K,
Kramer E, Roberts R, Graham N, Marillonnet S, Patel K, Jones JDG, Taylor
23
CG, Schachtman DP, May S, Sandberg G, Benfey P, Friml J, Kerr I,
Beeckman T, Laplaze L, Bennett MJ (2008) The auxin influx carrier LAX3
promotes lateral root emergence. Nature Cell Biology 10: 946-954
Swarup K, Benková E, Swarup R, Casimiro I, Péret B, Yang Y, Parry G, Nielsen E,
De Smet I, Vanneste S, Levesque MP, Carrier D, James N, Calvo V, Ljung K,
Kramer E, Roberts R, Graham N, Marillonnet S, Patel K, Jones JDG, Taylor
CG, Schachtman DP, May S, Sandberg G, Benfey P, Friml J, Kerr I,
Beeckman T, Laplaze L, Bennett MJ (2008) The auxin influx carrier LAX3
promotes lateral root emergence. Nature Cell Biology In Press
Tari I, Nagy M (1996) Abscisic acid and ethrel abolish the inhibition of adventitious
root formation of paclobutrazol-treated bean primary leaf cuttings. Biologia
Plantarum 38: 369-375
Teale WD, Paponov IA, Palme K (2006) Auxin in action: signalling, transport and the
control of plant growth and development. Nature Reviews Molecular Cell
Biology 7: 847-859
Visser E, Cohen JD, Barendse G, Blom C, Voesenek L (1996) An Ethylene-Mediated
Increase in Sensitivity to Auxin Induces Adventitious Root Formation in Flooded
Rumex palustris Sm. Plant Physiol 112: 1687-1692
Walch-Liu P, Ivanov II, Filleur S, Gan YB, Remans T, Forde BG (2006) Nitrogen
regulation of root branching. Annals of Botany 97: 875-881
Weijers D, Benkova E, Jager KE, Schlereth A, Hamann T, Kientz M, Wilmoth JC,
Reed JW, Jurgens G (2005) Developmental specificity of auxin response by
24
pairs of ARF and Aux/IAA transcriptional regulators. Embo Journal 24: 18741885
Woodward AW, Bartel B (2005) Auxin: Regulation, action, and interaction. Annals of
Botany 95: 707-735
Wu G, Lewis DR, Spalding EP (2007) Mutations in Arabidopsis multidrug resistancelike ABC transporters separate the roles of acropetal and basipetal auxin transport
in lateral root development. Plant Cell 19: 1826-1837
Xu M, Zhu L, Shou HX, Wu P (2005) A PIN1 family gene, OsPIN1, involved in auxindependent adventitious root emergence and tillering in rice. Plant and Cell
Physiology 46: 1674-1681
Zazimalova E, Murphy AS, Yang H, Hoyerova K, Hosek P (2010) Auxin transporterWhy so many? Cold Spring Harb Perspect in Biol 2: a001552
25
CHAPTER II
POLAR AUXIN TRANSPORT MEDIATED BY ABCB19 AND PIN1 REGULATES
ADVENTITIOUS ROOT FORMATION IN ARABIDOPSIS
Sukumar P., Muday G.K.
The following manuscript has been submitted for review in Plant Physiology. Sukumar P
performed the experiments and prepared the manuscript, and Muday G.K. acted in an
advisory and editorial capacity.
26
Abstract
Adventitious roots emerge from aerial plant tissues and although the induction of
these roots is essential for clonal propagation of agriculturally important plant species,
little is known about the mechanisms that control this type of root formation. We have
utilized Arabidopsis thaliana and its widely available genetic and molecular tools to
dissect the molecular mechanisms by which auxin controls this process. We developed a
system to induce adventitious root formation in Arabidopsis by manipulating growth
conditions and by excising roots from hypocotyls. We find that root excision is
accompanied by an increase in auxin transport and local changes in AtGH3:GUS reporter
above the site of excision, correlating with auxin accumulation. These changes precede
development of adventitious roots. Examination of auxin transport mutants revealed that
abcb19 and pin1 mutants have reduced adventitious root formation. Quantification of
relative transcript levels detected an increase in PIN1, but not ABCB19 transcripts upon
excision. However, pABCB19::ABCB19:GFP levels were higher in excised hypocotyls
compared to intact plants, suggesting post transcriptional regulation of ABCB19.
Additionally, the phosphatase inhibitor, canthardin, which has been previously shown to
regulate auxin transport in roots, reduces auxin transport and fluorescence of the
pABCB19::ABCB19:GFP. Canthardin also affects the location at which adventitious
roots emerge, in a partially ABCB19 independent manner. Thus, a change in protein
phosphorylation state of ABCB19 may be a mechanism by which excision- induced
adventitious root development occurs. Together, these results suggest that polar auxin
transport mediated by ABCB19 and PIN1 regulate adventitious root formation in
Arabidopsis.
27
Introduction
The root structure of plants includes a primary root from which lateral roots form,
and may often include adventitious roots that form from the hypocotyl. While primary
roots are formed during embryogenesis, lateral and adventitious roots are formed post
embryonically (Malamy and Benfey, 1997). Both types of root branches function to
increase nutrient and water uptake and anchor plants in soil. Lateral roots emerge from
pericycle cells of the primary root and undergo a precise series of developmental stages
before they emerge through the primary root (Malamy and Benfey, 1997). The ability of
stems to initiate adventitious root formation may depend on many environmental and
physiological factors (reviewed in De-Klerk et al., 1999). Induction of adventitious roots
using excision of stem segments has been widely used in the field of agriculture
(reviewed in De-Klerk et al., 1999). This technique allows clonal propagation of ideal
varieties of various agriculturally-important crop species (reviewed in Li et al., 2009).
Use of auxins to increase the frequency of formation of adventitious roots is common
practice. Even though this technique of using stem cuttings has been used for many years
to propagate plants, the mechanism by which auxin induces adventitious root formation
after excision is unknown. While many studies have explored the development of lateral
roots (reviewed in Peret et al., 2009), few studies have utilized the genetic tools available
in Arabidopsis to examine the mechanisms that control adventitious root formation.
Auxin synthesis, transport, and signaling all positively regulate lateral root
formation (reviewed in Peret et al., 2009). Increased auxin concentration through
exogenous application or genetic manipulations has been shown to result in enhanced
lateral root formation (reviewed in Malamy, 2005). In addition, the Arabidopsis mutants,
28
superroot and rooty have endogenously high levels of IAA and a proliferation of lateral
and adventitious roots (Boerjan et al., 1995; Celenza et al., 1995). Defects in the genes
encoding auxin signaling proteins reduce lateral root formation including the auxin
receptor, TRANSPORT INHIBITOR RESPONSE 1 (TIR1), auxin response factors
(ARF), and auxin induced genes (IAA/AUX) (reviewed in Casimiro et al., 2003).
Moreover, auxin transport is required for initiation and elongation of lateral roots as
judged by chemical, physical and genetic methods to block auxin flow (Reed et al., 1998;
Casimiro et al., 2001). Auxin movement is mediated by influx proteins such as AUX1
(AUXIN RESISTANT 1) and LAX (Like AUX), which helps auxin enter cells (Marchant
et al., 1999; Swarup et al., 2008), and efflux proteins such as PIN and ABCB/MDR/PGP
proteins, which are required for auxin to exit from cells (Galweiler et al., 1998;Noh et al.,
2001; Teale et al., 2006). Defects in AUX1, LAX , PIN1 (PIN FORMED1), and
ABCB19/PGP19/MDR1 (ATP BINDING CASSETTE B 19/P-GLYCOPROTEIN
19/MULTIDRUG RESISTANT 1) reduce initiation and/or elongation of lateral roots due
to reduced movement of auxin (Marchant et al., 2002; Swarup et al., 2008; Wu et al.,
2007; Benkova et al., 2003). Additionally, lateral root development has been shown to
depend on complex changes in expression of PIN proteins in developing primordia
(Sauer et al., 2006; Benkova et al., 2003). Examination of PIN3- and PIN7-GFP fusions
in roots bent to initiate lateral roots has revealed that the expression of PIN3 and PIN7
proteins is reduced in the roots below the point of the bend, while, AUX1-YFP is
increased at the point of root formation, creating auxin maxima driving primordia
formation (Laskowski et al., 2008). These results suggest that regulation of carrier
protein-mediated auxin transport plays an important role in lateral root development.
29
Although the primary and lateral root phenotypes of auxin transport and signaling
mutants have been reported, the adventitious root and other hypocotyl phenotypes are not
well characterized. ABCB19 is expressed in cotyledons, shoot apical meristem and
vasculature of light grown seedlings, and it is expressed throughout the hypocotyl tissues
of dark grown seedlings (Blakeslee et al., 2007; Lewis et al., 2009). abcb19 mutants have
reduced basipetal hypocotyl transport and hyper-gravitropic stems (Noh et al., 2003),
while pin3 mutants show reduced hypocotyl gravitropism and phototropism (Friml et al.,
2002). The auxin efflux protein PIN1 is expressed in shoot apical meristem and
vasculature of stem tissues (Galweiler et al., 1998;Blakeslee et al., 2007). Additionally,
pin1 mutants have pinformed inflorescence stems, associated with reduced auxin
transport in these tissue (Okada et al., 1991). Changes in PIN protein localization have
also been reported to be involved in apical hook opening (Zadnikova et al., 2010). More
research is needed to understand the function of these proteins in other physiological
processes in the hypocotyls.
Similar to lateral roots, auxin is an endogenous factor thought to regulate
adventitious root formation. Yet, few studies have explored the importance of auxin in
modulating adventitious root formation in the model system Arabidopsis. The mutant
superroot (sur) has defects in the auxin synthesis pathway and forms many adventitious
roots at random positions along the stem (Boerjan et al., 1995), while the mutant
argonaute (ago1) forms fewer adventitious roots than wild type (Sorin et al., 2005). The
defect in ago1 was traced to over accumulation of an auxin response factor, ARF17,
which negatively regulates auxin induced genes (Sorin et al., 2005). Additionally, protein
profiles of ago1 and sur identified factors that are linked to auxin synthesis and supply as
30
candidates for regulation of adventitious root formation (Sorin et al., 2006). Transcription
factors involved in auxin signaling, ARF6 and ARF8, were found to regulate positively
adventitious root formation (Gutierrez et al., 2009). Studies characterizing seedlings of
the gain of function mutant shy2/iaa3 (short hypocotyl 2) show decreased adventitious
root formation (Tian and Reed, 1999), while axr3/iaa17 (auxin resistant 3) mutants show
increased formation of adventitious roots (Leyser et al., 1996). Variation among different
ecotypes of wild type Arabidopsis in adventitious root formation in response to auxin
suggests that adventitious root formation is a highly plastic process regulated endogenous
and environmental factors (King and Stimart, 1998). Taken together, these studies
suggest an important role for auxin in the regulation of adventitious root formation.
A few genetic studies have examined the mechanisms by which auxin signaling
and transport regulate adventitious root formation. One study isolated temperature
sensitive mutants in Arabidopsis that are defective in initiation, development and
elongation of adventitious roots, a few of which were caused by defective auxin signaling
(Konishi and Sugiyama, 2003). In rice, the adventitious root less (arl1) mutant results in
reduction of the number of adventitious roots, due to a defect in an auxin response factor
gene that acts as an auxin dependent transcription factor (Liu et al., 2005). Consistent
with auxin transport being important for development of adventitious root formation,
OsPIN1 RNAi lines in rice exhibited reduced adventitious root formation (Xu et al.,
2005). Additionally, mutations in the guanine nucleotide exchange factor for ADPribosylation factor (OsGNOM1) reduced the formation of adventitious roots in rice,
possibly due to altered localization and targeting of PIN proteins (Liu et al., 2009). Even
though the importance of auxin in inducing adventitious roots is well known, the
31
components of its signaling, synthesis, and transport involved in the regulation of
adventitious root development are largely unknown, beyond these isolated examples.
Our study utilized Arabidopsis hypocotyls as a model system to understand the
basic mechanisms driving adventitious root formation. Arabidopsis seedlings, when
grown under low light conditions, form elongated hypocotyls that can be induced to form
adventitious roots by excision. We have utilized a wide array of mutants and reporter
constructs available in Arabidopsis to identify underlying processes driving adventitious
root formation. Furthermore, we have examined the expression of auxin transport
proteins to dissect the mechanisms driving this process and utilized inhibitor treatments
to understand the possible involvement of protein phosphorylation during adventitious
root formation. These results help uncover the underlying mechanism and developmental
processes that control the formation of adventitious roots.
32
Results
Root excision from hypocotyls increases adventitious root formation
To examine adventitious root formation, Arabidopsis seedlings were grown under
low light intensity (3-5 µmol m–2 s–1) to induce hypocotyl elongation and then transferred
to high light conditions (85-100 µmol m–2 s–1) on the 5th day after sowing. The number of
adventitious roots formed as a function of time after transfer to high light is shown in
Figure II-1A. Intact hypocotyls form few adventitious roots with an average of less than
one per plant by the 8th day after transfer. The excision of the basal half of the shoot and
the root system (from here on referred to as root excised hypocotyls) induces a
significantly greater number of adventitious roots. Adventitious roots began to form in
root excised hypocotyls 3-4 days after excision and continued to increase in number for at
least 8 days. Adventitious roots formed at middle intact hypocotyls, as shown in Figure
II-1B. In contrast, adventitious roots formed after root excision reproducibly form at a
position 1-2 mm above the site of excision. Root excised hypocotyls were used as a
model to study the role of auxin in adventitious root formation, as they formed
substantially greater numbers of adventitious roots.
Adventitious roots emerge from the central tissues of the hypocotyl
Lateral roots emerge from the pericycle cells of root tissue. We asked whether
adventitious roots emerge from similar tissue in the hypocotyl using DIC (Differential
interference contrast) light microscopy images of primordia and emerged adventitious
roots in cleared hypocotyls. Figure II-2A shows adventitious roots at a number of
developmental stages that parallel the stages of lateral roots. The development of
33
Figure II-1: Removal of basal portion of hypocotyl and root increases adventitious root
formation in Arabidopsis.
(A) The number of adventitious roots was determined in the intact hypocotyl or
hypocotyls excised at 0.5-0.75 cm from the apex. The average and SE of 20-30 seedlings
are reported.
(B) Adventitious root formation on intact (left) and excised (right) cleared hypocotyls is
shown after 7 days. Arrow points to adventitious root in the intact hypocotyl, and arrow
head points to site of excision. Scale bar is 5 mm.
34
A
B
C
Figure II-2: Adventitious roots emerge from pericycle tissues of the hypocotyl.
(A)& (B) DIC images of various stages of primordia development in cleared hypocotyl.
(C) Images of pericycle marker J0121::GFP with emerged adventitious roots taken using
confocal laser scanning microscope using channel setting. Scale bar is 50 µm.
35
adventitious roots close to the vascular tissue is evident in Figure 2B. Additionally, we
used the enhancer trap line J0121, which expresses GFP in pericycle cells of the
hypocotyl and root (Laplaze et al., 2005), to understand the tissue origin of adventitious
roots. J0121 seedlings were grown under the above mentioned conditions and were
excised to induce adventitious root formation. Images of emerging and elongating
adventitious roots were taken using a confocal laser scanning microscope, using channel
settings as shown in Figure II-2C. GFP fluorescence was observed in pericycle tissue,
while the fluorescence seen in epidermal tissue is due to chlorophyll auto-fluorescence.
Thus, like lateral roots, adventitious roots develop from pericycle tissue in Arabidopsis
and show similar developmental progression, as lateral roots. But, unlike lateral roots, in
which other roots are inhibited near the site of root formation, adventitious roots seem to
emerge very close and at times adjacent to each other as seen in Figure II-2A and II-2C.
These images suggest that adventitious and lateral roots arise from pericycle cells, and
exhibit a similar development program but have unique regulatory mechanisms defining
spatial patterning.
Mutants scr1 and shr1 have reduced adventitious root formation
scr (scarecrow) and shr (short root) mutants were isolated for their altered root
and shoot radial organization phenotypes (Scheres et al., 1995; Fukaki et al., 1998). They
are defective in transcriptional factors involved in tissue development and radial
organization (DiLaurenzio et al., 1996). These mutants lack normal endodermis and
cortical layers and were also identified in a separate screen for defective shoot gravitropic
responses, tied to the absence of the starch statolyths containing cell layer in which
36
gravity is perceived and which basipetal and lateral auxin transport occurs (Fukaki et al.,
1998). Even though these mutants have a normal pericycle layer, lateral root formation is
reduced (data not shown). We asked if these mutants were defective in adventitious root
formation. The number of adventitious roots formed seven days after root excision was
quantified in scr-1 and shr-1, as reported in Figure II-3A. scr-1, but not shr1, forms
statistically significantly fewer adventitious roots than wild type. This result suggests a
role for the cortex of the hypocotyl either directly or indirectly affecting auxin
distribution influencing adventitious root formation.
In addition, we examined the expression pattern of SCR during adventitious root
formation, using the transgenic line pSCR::GFP, as shown in Figure II-3B. pSCR::GFP
expression was increased by 30% after excision in the endodermis tissue layer and also
was found to be expressed in developing primordia. This suggests that, in addition to
modulating radial tissue differentiation, SCR is expressed in tissue from which
adventitious roots form, with enhanced expression associated with conditions in which
there is an increase in root formation.
Auxin from the shoot apex is required for adventitious root formation
We asked if adventitious root formation is dependent on auxin transport in an analogous
manner to lateral root formation. Root excised hypocotyls were treated with 10 µM of the
IAA efflux inhibitor 1-N-naphthylphthalamic acid (NPA) added to the agar upon which
plants were grown, or their shoot apices were removed, to eliminate the source of auxin.
The number of adventitious roots formed in response to these treatments was quantified
on the 7th day after treatment, as shown in Table II-I. Both treatments prevented
37
Number of adventitious roots
A
B
7
6
5
4
**
3
2
1
0
WT
scr1
shr1
Figure II-3: Effect of scr1 and shr1 mutations on adventitious root formation.
(A) Low light grown wild type and scr1 and shr1 mutant seedlings were excised at 5 days
and the number of adventitious roots formed 7 days after excision was determined. The
average and SE of 32-50 seedlings are given. * Indicates p≤ 0.05 between genotypes as
determined by Student’s t-test.
(B) pSCR::GFP expression were observed in excised hypocotyls using confocal laser
scanning microscope. Numbers on the bottom correspond to average GFP fluorescence
relative to intact hypocotyls. Scale bar is 50 µm.
38
Table II-I: Auxin from the shoot is important for adventitious root formation.
Shoot apex
Treatment
Number of
adventitious roots
Present
None
5.8±0.4
Present
10µM NPAa
0±0c
Absent
None
0±0c
Absent
100µM IAAb
4.8±0.4
Absent
100µM IAA+100µM NPAb
1.1±0.3c
Seedlings were grown for 5 days in low light with or without their shoot apex.
Values are average and SE from 18-20 seedlings.
a. Seedlings were treated globally.
b. Seedlings were treated locally with agar containing these compounds applied at
the shoot apex.
c. Values are significantly different from control with, p<0.05, as determined by
Student’s t- test.
39
adventitious root formation, suggesting that polar transport of IAA derived from the
shoot apex and/or cotyledons is necessary for adventitious root formation.
To further confirm that apex-derived auxin is essential for adventitious root formation,
the shoot apex of root excised hypocotyls was removed and the resulting hypocotyl
segments, or explants, were given a localized IAA treatment as an agar line at the apical
end of the hypocotyl (Table II-I). Local application of exogenous IAA (100 µM) to the
apical end of upright hypocotyls was able to restore adventitious root formation in these
hypocotyls. Additionally, application of 100 µM NPA locally below the site of
application of IAA reduced the induction of adventitious roots, indicating that auxin
movement from the shoot apex is required for adventitious root formation.
Induction of adventitious roots by exogenous IAA is dose dependent
To test whether various levels of auxin regulate the degree of adventitious root
formation, we treated 5 day old excised and intact hypocotyls with a range of
concentrations of IAA added to the agar medium upon which the seedlings were grown.
The number of adventitious roots formed under different treatments was quantified 7
days later and is reported in Figure II-4A. IAA treatment of intact hypocotyls and root
excised hypocotyls formed more adventitious roots than untreated hypocotyls at
concentrations ranging from 0.1µM to 25µM IAA, suggesting that IAA positively
regulates this process. The magnitude of induction of root formation by IAA was 1.6-fold
in root excised hypocotyl and was greater in intact hypocotyls (13.5- fold) as there are
fewer roots in untreated controls. With a global application of 100µM, there was
inhibition of root formation (data not shown), as opposed to the local application of this
40
Figure II-4: The effect of IAA on adventitious root formation.
41
(A) The number of adventitious roots formed in control or seedlings treated with a range
of concentration of IAA. The average and SE for 10-31 seedlings are reported.
(B) Images of cleared wild type hypocotyls; control and treated with 25 µM IAA, 7 days
after root excision.
(C) Hypocotyls of AtGH3:GUS transgenic seedlings were stained 9, 18, 24 and 48 hrs
after root excision. Arrow head points to field of view in insets.
(D) Root excised hypocotyls of AtCYCB1;1:GUS transgenic seedlings were stained after
9, 18, 24 and 48 hrs. Arrow heads point to positions of GUS expression.
Scale bars are 1 mm.
42
dose which stimulates adventitious root formation. The adventitious roots that emerged
from global IAA treatments were distributed all along the hypocotyls, as shown in Figure
II-4B. This result suggests that adventitious root formation is positively regulated by IAA
treatment and that hypocotyls are capable of forming adventitious roots in response to
auxin at multiple positions.
Local increases in auxin-induced GUS expression occur after excision at position of
adventitious root formation.
We hypothesized that the effect of excision is to increase local auxin signaling at
the base of the hypocotyl which then drives adventitious root formation. Root excised
hypocotyls of Arabidopsis plants transformed with an auxin responsive promoter-GUS
fusion, AtGH3:GUS (Li et al., 1999), were excised every hour for 9 hrs and at 24 and 48
hrs, as shown in Figure II-4C. No expression was detected 1-8hrs after excision (data not
shown). The earliest time at which AtGH3:GUS expression was detected 9 hrs after
excision. The expression appeared above the point of excision. AtGH3:GUS was also
expressed in the apex of developing adventitious roots (data not shown).
Additionally, we examined the initiation of cell division at similar time points
after excision in a reporter line with the cyclinB1 promoter driving GUS, which is only
expressed in actively dividing cells, AtCYCB1;1:GUS (DiDonato et al., 2004). We find
that AtCYCB1;1:GUS expression is detected at 18hrs-24hrs (Figure II-4D), which is
much later than AtGH3:GUS. When the time line of expression of GH3- and CYC- GUS
expression are analyzed, the results suggest that local auxin induction precedes cell
division.
43
As there are changes in auxin-induced gene expression after excision, we asked if
there were also changes in the level of free IAA with excision. 5 day old seedlings were
left intact or were root excised, and free IAA level was quantified in the entire hypocotyl
at 0 hrs, 24 hrs, and 48 hrs after root excision and compared to intact seedlings, as shown
in Supplemental Figure II-S1. The levels of free IAA in both intact and excised tissues
increased during the treatment period. There were slight, but not significant, increases in
free IAA levels with excision. Although we expected elevated free IAA after excision to
parallel the local AtGH3:GUS increases, it is likely that free IAA only changes locally,
not in the entire hypocotyl used for these measurements of free IAA.
Adventitious root phenotype of auxin signaling mutants
Several auxin signaling mutants including tir1, axr1, axr4, iaa14, arf7, and arf19
have defective lateral root formation, indicating a role of auxin signaling during
induction of cell differentiation and cell division in post embryonic organ development
(reviewed in Casimiro et al., 2003). We asked if adventitious root development is
regulated by similar auxin signaling proteins in these mutants. The average number of
adventitious roots in these mutants was compared to wild type, 7 days after root excision,
as shown in Figure II-5A. The tir1 and axr1 mutants have defects in an auxin receptor
complex, but we find that these mutants produce a similar number of adventitious roots to
wild type. iaa3, iaa14, and iaa17 are defective in members of the AUX/IAA family of
auxin induced genes (Fukaki et al., 2002, Leyser et al., 1996), and while iaa14 and iaa17
mutants form wild type numbers of adventitious root formations, iaa3 has reduced
development of adventitious roots. A previous characterization of iaa17/axr3-3 mutant
44
Free IAA levels ng/gFW
S1
25
20
Intact
Excised
15
10
5
0
0hrs
24hrs
48hrs
Supplemental Figure II-1: Free IAA levels were quantified in hypocotyls using IAA
extraction followed by detection using GC-MS. Average and SE are given, but no
significant differences between intact and excised samples were detected.
45
C
160
Relative basipetal
hypocotyl transport, %
*
140
120
100
*
80
60
*
40
20
0
B
Number of adventitious roots,
% of wild type
Col 8
T 1 1 3 4 7 f7 9 9 4
W tir axr iaa aa1 aa1 ar arf1 arf1 axr
i i
f7
ar
140
100
60
*
*
200
150
100
50
0
Intact
*
400
*
*
Excised
WT
35S:ABCB19
*
300
40
200
100
20
0
*
250
500
120
80
300
D
Effect of ABCB19 over expression,
relative to wild type, %
Number of adventitious roots,
% of wild type
A
1
1
3
9
2
T
7
W aux pin pin pin pin cb1
b
a
0
Number of Basipetal
adventitious
IAA
roots
transport
Figure II-5: Auxin signaling and transport are required for adventitious root formation.
(A) The effect of mutations in genes encoding auxin signaling proteins was determined
for 9-34 root excised seedlings with average and SE presented.
(B) The effect of mutations in genes encoding auxin transport proteins with average and
SE for 10-31 root excised seedlings are reported.
(C) Hypocotyl basipetal IAA transport was measured in intact and root excised seedlings
and is normalized relative to intact seedlings. Average and SE of 18-20 seedlings are
reported.
46
(D) The effect of 35S-ABCB19 on auxin transport and root excision was compared, 2 or
7 days after excision, respectively. Average and SE are given.
* Indicates p≤ 0.05 as determined by Student’s t-test, with comparisons in panel A, B, D,
between indicated genotypes and wild type, and in panel C, intact and excised seedlings
are compared.
47
had reported increased adventitious root formation relative to wild type (Leyser et al.,
1996), but we did not observe this increase under our growth conditions possibly because
of differences in the way plants were grown. Auxin response factors (ARFs) are
transcriptional regulators of auxin induced genes. We found that the arf7 mutant has
increased adventitious root formation. Additionally, the arf7-arf19 double mutant has
reduced adventitious root formation, even though the arf19 single mutant did not show a
phenotype. The auxin resistant mutant, axr4, has defective root and shoot branching,
defective leaf morphology and apical dominance (Hobbie and Estelle, 1995). However,
axr4-2 had slightly increased numbers of adventitious roots relative to wild type.
To understand whether the relative effects of these mutations is due to their
expression pattern in hypocotyls, we examined previously published microarray data
using the GEO database, as shown in Supplemental Figure II-S2 (Van Hoewyk et al.,
2008). All of the genes for which we examined mutant lines, except PIN2, were
expressed in the hypocotyls, but there was variability in the level at which they were
expressed. The absence of correlation between phenotypes and expression patterns in the
signaling mutants is not surprising, due to the complex gene families encoding these
proteins and redundant functions of family members. But for many of these signaling
mutants, hypocotyl phenotypes have not been reported, suggesting that alternative
signaling molecules may function in hypocotyl tissue and regulate adventitious root
formation.
Excision increases auxin transport
We examined auxin transport in intact and root excised hypocotyls to see if there are
48
S2
2000
Abundance
1500
1000
500
0
1 1
1 2 3 7 9
4 1
3 4 7 7 9
R XR AA A1 A1 RF F1 XR UX IN IN IN IN B1
I
I IA IA A R A A
T A
P P P P C
A
AB
Supplemental Figure II-2: Transcript abundance of IAA signaling and IAA transport
genes from previously published microarray data (Van Hoewyk et al., 2008).
49
changes in auxin transport after root excision that might drive adventitious root
formation. Intact and root excised 5 day old, low light grown seedlings were transferred
to control plates, their cotyledons and shoot apices were removed, and radioactive IAA
was applied locally in an agar line at the apical end. Radioactive IAA transport in
hypocotyls after 3 hrs of application was quantified using a 3 mm section taken from the
basal end of root excised hypocotyls or sections at similar position in the hypocotyl of
intact plants. Figure II-5C compares the IAA transport in intact hypocotyls and hypocotyl
explants in wild type plants and shows that basipetal IAA transport increases 2.5- fold in
the hypocotyls after excision. This result is consistent with removal of the root portion of
the plant leading to increase in auxin flow, which might lead to local auxin accumulation,
driving adventitious root formation.
Mutants defective in IAA efflux carriers have reduced adventitious root formation
Because root excision increases auxin transport and thereby drives adventitious
root formation, we asked which auxin transport proteins are involved in this process.
Auxin transport mutants aux1, pin3, pin7, and abcb19 have lateral root defects (Marchant
et al., 2002; Laskowski et al., 2008; Wu et al., 2007). We tested whether AUX1, PIN1,
PIN2, PIN3, and ABCB19 mediated auxin transport are necessary for adventitious root
formation. For this, low light grown wild type and aux1, eir1-1 (a pin2 allele), pin3-4,
mdr1-1 (an abcb19 allele), pin7 and pin1-1 hypocotyls were root excised and their
adventitious root formation was quantified 7 days after excision, as shown in Figure 5B.
As the abcb19 mutant is in the Ws background, pin1-1 in Ler, and all other mutants are in
Col, the result is reported relative to the appropriate wild type control. aux1-7 and pin2
50
showed no significant difference in adventitious root formation, while pin3-3, but not
pin3-4 (data not shown), showed slight but significant reduction. pin7 showed a
significant 20% reduction in adventitious root formation. In contrast, abcb19 and pin1-1
formed 50% fewer adventitious roots than wild type (p< 0.05). This suggests that
adventitious root formation in hypocotyls depends strongly on ABCB19 and PIN1
regulated auxin transport.
Previously published microarray data shows that AUX1, ABCB19, and PIN3 are
the transport proteins most highly expressed in hypocotyls (Van Hoewyk et al., 2008,
supplemental figure II-S2). Mutations in genes encoding two of these auxin transport
proteins, ABCB19 and PIN3, have adventitious root phenotypes, while AUX1 had no
phenotype. This is not surprising, when one considers that AUX1::YFP is expressed only
in the epidermal cells of hypocotyls, a tissue layer not tied to adventitious root
development (data not shown). The low level expression of PIN1 is consistent with the
absence of a detected PIN1:GFP signal in this tissue, except at the shoot apex (Heisler et
al., 2005). This result suggests that the role of PIN1 in this process may be highly local,
rather than along the whole hypocotyl.
ABCB19 over-expression increases adventitious root formation
To confirm the role of ABCB19 in auxin transport required for adventitious root
formation, we quantified adventitious root numbers in an ABCB19 over-expression line,
35S-ABCB19 seedlings (Wu et al., 2007), as shown in Figure II-5D. Even without
excision, over expressing lines of 35S-ABCB19 formed approximately 3-fold more
adventitious roots than intact wild type. We examined basipetal auxin transport in intact
51
seedlings of wild type and 35S-ABCB19, as shown in Figure II-5D. It is has been
previously reported that hypocotyls of abcb19/mdr1 mutant have reduced basipetal auxin
transport (Noh et al., 2001). Consistent with the overexpression of an auxin transport
protein 35S-ABCB19 had a significant 3-fold greater transport than wild type. This
suggests that ABCB19 mediated auxin transport drives adventitious root formation.
pABCB19:ABCB19:GFP fluorescence increases after excision
PIN1 and ABCB19 are required for wild type levels of adventitious root
formation and IAA transport is increased with root excision, suggesting that PIN1 and
ABCB19 expression may be increased by excision. 5 day old low light grown
pPIN1::PIN1:GFP, and pABCB19::ABCB19:GFP seedlings were transferred to high
light conditions with or without excision. Although the PIN1 transcripts were detected in
this tissue, PIN1:GFP signal was not detected in hypocotyl tissue (data not shown),
possibly due to a less intense GFP construct. Images of pABCB19::ABCB19:GFP intact
and excised hypocotyls were captured 48 hrs later using laser scanning confocal
microscopy, under identical settings as shown in Figure II-6A. GFP fluorescence was
quantified in images of intact and excised hypocotyls using line profile along the
longitudinal sides of cells in the Zeiss Zen software. In hypocotyls, root excised
pABCB19::ABCB19:GFP had enhanced signals compared with intact hypocotyls, as
shown in Figure II-6A and Table II- II. In 6 out of 9 experiments, average GFP intensity
of excised hypocotyls was significantly more than in intact controls. Among the
experiments that showed significant increase at 48 hrs, 83% of excised hypocotyls had
enhanced ABCB19:GFP fluorescence relative to intact hypocotyls (Table II-II).
52
C
Relative transcript levels
A
B
3.5
3.0
2.5
0 hrs
6 hrs
2.0
1.5
1.0
0.5
0.0
ABCB19
PIN1
D
Figure II-6: PIN1 transcription and pABCB19::ABCB19:GFP protein accumulation is
enhanced with excision.
(A), (B) Confocal images of intact and root excised hypocotyls of
pABCB19::ABCB19:GFP 48 hrs (A) or 6 hrs (B) after root excision. Images of intact and
excised hypocotyls were taken with identical settings. Scale bars are A:50 µm, B: 200 µm.
(C) Fold changes in relative transcript levels of PIN1 and ABCB19 in hypocotyls, 6 hrs
after root excision compared to levels in hypocotyls at the time of excision, determined
using qRT-PCR.
53
(D) Confocal images of intact and root excised hypocotyls of pABCB19::GFP 6hrs after
root excision. Images of intact and excised hypocotyls were taken with identical confocal
settings. Scale bar is 50 µm.
54
Table II-II: Root excision alters ABCB19:GFP fluorescence
GFP construct used
Treatment
Intensity relative to
control (%)
pABCB19::ABCB19:GFP
Excision
160.6 ± 11.2a,c
pABCB19::GFP
Excision
87.5 ± 3.7a
pABCB19::ABCB19:GFP
Excision &
66.0 ± 4.3b,c
10µM Canthardin
Quantification of intensity performed using linear profile on the lateral sides of cells,
with the values normalized relative to indicated control and are average and SE from 1221 seedlings.
a. Controls are intact hypocotyls.
b. Controls are untreated excised hypocotyls.
c. Values are significantly different from controls with p<0.05, as determined by Students
t test
55
This increase was observed as early as 6 hrs after excision (data not shown). This
suggests that pABCB19::ABCB19:GFP expression may be enhanced in excised
hypocotyls, consistent with the role of ABCB19 in regulating auxin transport necessary
for adventitious root formation.
Additionally, we asked if the changes in pABCB19::ABCB19:GFP observed were
local or global in relation to site of excision. Images of intact and excised hypocotyls
were captured 6 hrs after excision using the tile scan setting of the laser scanning
confocal microscope, which takes multiple pictures horizontally and vertically adjacent to
each other at a given magnification, as shown in Figure II-6B. We found that the increase
in pABCB19::ABCB19:GFP expression occurred throughout the hypocotyl and was not
localized to any particular site in relation to excision, suggesting that an overall change in
ABCB19 protein accumulation drives the increased auxin transport after excision.
Excision increases PIN1 but not ABCB19 transcription
To further test if there is increase in expression of PIN1 and ABCB19 after
excision, we examined the relative transcript levels of PIN1 and ABCB19 after excision
using qRT-PCR. Total RNA was extracted from root excised hypocotyls at the time of
excision (control) or 6 hrs after excision. cDNA reactions were performed, followed by
qRT-PCR, results of which are shown in Figure II-6C. There was a 2-fold increase in
PIN1 messages in excised hypocotyls, compared to control. Although this response was
not statistically significant, this increase was found in four separate samples, due to
variability in the magnitude of the PIN1 changes in response to treatments. These results
56
suggest that enhanced PIN1 synthesis plays a role in excision induced increase in auxin
transport and adventitious root formation.
Surprisingly, no differences were detected in relative expression of ABCB19, 6
hrs after excision in 3 separate experiments. To test if the changes in transcripts occurred
earlier or later than 6 hrs, other time points after excision were examined, but no
significant changes were detected after 2, 4, 9, 18, 24, or 48 hrs after excision (data not
shown). Since we did not observe significant changes in transcripts of ABCB19,
pABCB19::GFP; a transcriptional fusion, was examined to ask how excision affected
ABCB19 expression. There was no change in intensity of fluorescence 6 hrs after
excision, compared to intact hypocotyls in 5 day old seedlings as shown in Figure II-6D
and Table II-II. Increases in ABCB19 as suggested by pABCB19::ABCB19:GFP
fluorescence changes after excision, together with consistent ABCB19 transcripts levels
suggests a possible post transcriptional modification in ABCB19 protein which enhances
its accumulation, controlling auxin flow needed for adventitious root formation.
Protein phosphatase activity regulates auxin transport and localization of adventitious
root emergence
We asked if protein phosphorylation could be involved in post translational
regulation of ABCB19 function. Wild type seedlings treated with 10µM canthardin, a
broad spectrum phosphatase inhibitor, were examined for adventitious root formation, as
shown in Figure II-7A. Surprisingly, in canthardin treated wild type hypocotyls,
adventitious roots emerged from locations distributed along the entire hypocotyl in
contrast to the localized formation in untreated seedlings, as shown in Figure II-7B. This
57
A
D
120
Relative % of wild type
B
WT Control
WT+Canth
100
C
80
60
*
40
20
0
Number of Basipetal
IAA
adventitious
transport
roots
Figure II-7: Phosphorylation regulates localization of adventitious roots.
58
(A) Wild type and abcb19 seedlings were treated with or without 10 µM canthardin for 7
days and the resulting cleared images are shown. Numbers at the bottom right corner
indicate the % of seedlings with that particular phenotype. Scale bar is 1 mm.
(B) The number of adventitious roots formed at 7 days, or IAA basipetal transport at 48
hrs, after root excision, in control and seedlings treated with 10 µM canthardin are
presented relative to untreated controls. Average and SE are given. * Indicates significant
differences with and without cantharidin treatment as determined by Student’s t-test with
p<0.05.
(C) Confocal images of pABCB19::ABCB19:GFP seedlings treated with or without 10
µM canthardin, 6 hrs after root excision. Images of control and treated were taken at
same settings. Scale bar is 50 µm.
(D) Root excised hypocotyls of AtGH3:GUS transgenic seedlings were treated with or
without 10 µM canthardin, and were stained 72 hrs later. Scale bars are 1 mm.
59
phenotype was seen in 90% of canthardin treated wild type seedlings. Additionally, only
50% of abcb19 mutants showed this phenotype, suggesting that the abcb19 mutation
causes partial insensitivity to canthardin induced de-localization of adventitious root
emergence. No changes were observed in the absolute number of adventitious roots
formed in any of the treatments compared to wild type. These results point to the
involvement of protein phosphorylation in defining the position of adventitious root
emergence through modification of ABCB19 protein function.
To test if changes in localization of adventitious roots during cantharidin
treatment are due to changes in auxin transport, hypocotyl basipetal transport was
measured in wild type low light grown seedlings transferred to high light conditions for
48hrs and treated with canthardin, as shown in Figure II-7A. Canthardin treatment caused
a reduction in basipetal transport compared to wild type. Consistent with this, we saw a
reduction in pABCB19::ABCB19:GFP fluorescence 6 hrs after excision when treated
with canthardin, compared to untreated, as shown in Figure II-7C and Table II-II. This
suggests that protein dephosphorylation reduces auxin transport, which regulates the
position of adventitious root formation, and these changes might partially occur thorough
ABCB19.
To test if the changes in local auxin accumulation seen 9hrs after excision were
affected with canthardin treatment, we looked at AtGH3::GUS expression with and
without canthardin treatment as shown in Figure II-7D. At 72hrs after excision, untreated
seedlings show GH3::GUS expression above the site of excision, while no such
expression was seen in canthardin treated seedlings. The GUS expression seen in
canthardin treated hypocotyls was more diffused and closer to the shoot apex than control.
60
This suggests that the effects of canthardin on longitudinal auxin transport may prevent
the formation of local auxin maxima at the base and lead to auxin distribution along the
hypocotyl, thereby altering the position of adventitious root formation.
61
Discussion
Plants form two types of post-embryonic roots, lateral and adventitious roots,
which arise from two different tissues, but share substantial structural similarities.
Lateral roots form as branches along a primary root, while adventitious roots form from
shoot or other aerial tissues. Both types of root structures serve important functions in
plants providing an extensively branched network that absorbs moisture and nutrients and
provides additional support to keep plants upright. Despite the apparent structural
similarities between adventitious and lateral roots, much less is known about the
mechanisms by which adventitious root development and initiation occur. The
developmental sequence (Malamy and Benfey, 1997), environmental (reviewed in
Malamy, 2005), and hormonal controls (reviwed in Casimiro et al., 2003) of lateral root
formation are well studied in Arabidopsis thaliana, yet the low frequency of adventitious
root formation (with only 1 to 2 adventitious roots forming per plant) in Arabidopsis has
limited the studies of this process (Gutierrez et al., 2009).
These experiments explored the developmental sequence and hormonal controls
of adventitious root formation in Arabidopsis. We manipulated the growth of
Arabidopsis to maximize adventitious root formation through growth of seedlings under
low light followed by excision of the lower half of the hypocotyl (termed root excision)
and transfer to high light. Adventitious roots form with 10-fold higher frequency when
the primary root and lower half of hypocotyls have been removed as compared to intact
controls. This root excision also alters the position of adventitious root formation from a
random localization along intact hypocotyls to a single position localized to 2-3 mm
above the site of excision. This enhanced root formation after root excision facilitates
62
study of this process and is consistent with induced root formation by root excision used
for vegetative propagation of horticultural plant species (reviewed in De-Klerk et al.,
1999). We have examined adventitious root development under our growth and induction
conditions and found that like the well characterized process of lateral root formation,
adventitious roots emerge from hypocotyl pericycle cells that are expressing the pericycle
marker J0121. This finding is consistent with a previous study that used histological
analysis and suggested adventitious roots initiate from pericycle cells (Falasca and
Altamura, 2003). We examined the development of primordia in multiple developmental
stages using DIC light microscopy images and find that they follow a similar
developmental progression as lateral roots. Unlike lateral roots, adventitious roots emerge
close together with no apparent position-specific inhibition of primordia formation. We
also examined the role of the SHR and SCR genes in this process, as these genes are
involved in regulating radial patterning of both shoot and root tissue, and whose mutants
have reduced lateral root formation (data not shown). The scr mutant, which has a defect
in radial pattern in the root and hypocotyl lacking normal endodermal and cortical layers,
has reduced adventitious root formation. Additionally, we find enhanced expression of
SCR-GFP in excised seedlings in the endodermal layer compared to the expression in an
intact hypocotyl. This finding is consistent with a previous study which found that
SCARECROW- like GRAS transcription factors were induced by auxin in rooting
competent stem cuttings of Pinus radiata and Castanea sativa (Sanchez et al., 2007).
We examined the role of auxin in adventitious root formation, as this hormone has
been shown to have an essential role in initiation and development of lateral root
formation. Adventitious root formation is dependent on shoot derived auxin, as removal
63
of shoot apex or treatment with NPA inhibits adventitious root formation. Additionally,
we have found that exogenous IAA treatment enhances adventitious root formation in
both intact and root excised seedlings. To define the mechanisms by which auxin controls
this process, we examined the adventitious rooting phenotype of a number of mutants
altered in auxin signaling, with a particular focus on mutants that alter lateral root
development. A surprisingly large number of mutants showed no defect in adventitious
root formation (tir1, axr1, iaa14, iaa17, and axr4). The most profound phenotypes were
found in the iaa3, arf7, and arf19 mutants. These mutants, particularly iaa3 and arf7,
have been isolated for their strong shoot phenotype, altered hypocotyl growth, and altered
shoot gravity response, respectively (Tian and Reed, 1999; Stowe-Evans et al., 1998).
These adventitious root phenotypes suggest that these auxin signaling components are
involved in additional aspects of hypocotyl physiology.
Our finding that auxin regulates adventitious root formation is consistent with the
few studies looking at adventitious root formation in Arabidopsis and the large amount of
research in other species (reviewed in Li et al., 2009). The Arabidopsis mutants
argonoute and superroot have reduced and enhanced adventitious root formation,
respectively, due to altered auxin signaling and enhanced IAA synthesis (Sorin et al.,
2006; Sorin et al., 2005). Additionally, adventitious root formation was found to be
regulated by a network of auxin response factors (ARFs), as arf17 mutant has enhanced,
while arf6 and arf8 mutants have reduced development of adventitious root formation
(Gutierrez et al., 2009). Moreover these auxin response factors were regulated through
miRNA mediated post transcriptional modifications. These results indicate that
64
development of adventitious root formation is controlled by a complex network of auxin
signaling.
We asked if the mechanism by which excision enhanced root formation is to
change auxin distribution and/or signaling. Induction of adventitious root formation after
root excision is preceded by enhanced expression of auxin induced reporters with
temporal and spatial resolution that suggests a role in root formation. This localized
auxin induced gene expression is above the position of root excision and at the location
of adventitious root formation. Moreover, IAA transport increased after removal of roots
compared to intact hypocotyls and this change preceded initiation of adventitious roots.
We did not see an overall change in free IAA levels with excision. These results are
consistent with auxin transport and local accumulation mediating formation of
adventitious roots.
To understand the mechanisms for excision increased auxin transport, we used a
genetic approach to identify auxin transport proteins that provide the auxin needed for
adventitious root formation after root excision. The abcb19/mdr1/pgp19 and pin1-1
mutants have reduced adventitious root formation indicating that ABCB19 and PIN1
mediate auxin transport required for adventitious root formation. Over-expressing lines of
ABCB19 had enhanced auxin transport and adventitious root formation, consistent with
ABCB19 mediating auxin transport required for adventitious root formation. On the
other hand, aux1, pin2, pin3, and pin7 mutants did not show any reduction in adventitious
root formation, suggesting a limited role of these transport proteins in development of
adventitious roots. We also find that root excision leads to an increase in transcript
abundance of an auxin transport protein PIN1, while ABCB19 transcript levels were
65
unaltered. Only one report has implicated a specific auxin transport protein in regulation
of adventitious root formation, with a pin1 mutant in rice showing reduced number of
adventitious roots (Xu et al., 2005).
The finding of a specific role for PIN1 and ABCB19 in adventitious root
formation is consistent with genetic studies of lateral root formation that have identified
specific auxin transport proteins that regulate this process. aux1 mutants, defective in an
influx carrier, have reduced number of lateral roots while an increase in AUX1
expression in pericycle cells drives formation of lateral roots (Laskowski et al., 2008).
Additionally, localized auxin-induced expression of LAX3 has been shown to drive
emergence of lateral root primordia (Swarup et al., 2008). Defects in efflux carriers have
been shown to affect lateral root formation as mutants pin2, and pin3 have altered lateral
root density (Laskowski et al., 2008). These results suggest that changes in expression of
IAA transport proteins modulate primordia formation in roots.
To further understand the mechanism of enhanced IAA transport after excision,
we looked at pABCB19::ABCB19:GFP, a protein GFP fusion, and found that it was
expressed more in the cells of hypocotyls of excised seedlings than in intact hypocotyls.
This enhanced expression of this protein fusion was not associated with parallel changes
in ABCB19 transcript levels, as judged by qRT-PCR or by fluorescent measurements
with a pABCB19::GFP transcriptional construct, suggesting a possible involvement of
post-transcription stabilization of ABCB19 protein during adventitious root formation.
We examined the role of protein phosphorylation in development of adventitious roots
using inhibitor treatments, and found that treatment of wild type with the phosphatase
inhibitor, canthardin, delocalizes emergence of adventitious root formation without
66
altering the absolute numbers of roots formed relative to untreated wild-type. Consistent
with this, wild-type hypocotyl transport is reduced with canthardin treatment. But no
effect on adventitious root formation was seen with treatment of the kinase inhibitor
staurosporine, and in the pid-9 mutant defective in protein kinase (Bennett et al., 1995)
(data not shown), or in the rcn1 mutant defective in the phosphatase 2A subunit, which
regulates hypocotyl growth and gravity responses (Deruere et al., 1999; Muday et al.,
2006) (data not shown). The absence of cantharidin effects in the abcb19 mutant
suggests that this protein may be a target of dephosphorylation. Consistent with this
hypothesis, pABCB19:: ABCB19:GFP fluorescence was reduced with canthardin
treatment. This suggests that dephosphorylation might activate ABCB19, which then
drives auxin transport required for localized auxin accumulation above the site of
excision, resulting in formation of adventitious roots above the site of excision.
Our results are consistent with the previously established role of protein
phosphorylation in regulation of auxin transport and related physiology (Friml et al.,
2004; Rashotte et al., 2001; DeLong et al., 2002). The pid 9 and rcn1 mutants have
decreased and increased root basipetal transport, respectively, and altered gravity
response (Sukumar et al., 2009; Rashotte et al., 2001). Additionally, treatments that
inhibit kinase and phosphatase activities alter auxin gradients required for gravity
response (Sukumar et al., 2009). Furthermore, kinase inhibitor treatments and PID
mutations resulted in enhanced accumulation of PIN2 in endomembrane structures,
without altering the PIN2 polarity (Sukumar et al., 2009), while in several studies overexpression of PID9 has been shown to alter polar localization of PIN1 (Friml et al., 2004;
Michniewicz et al., 2007; Sukumar et al., 2009; Zhang et al., 2010). Triple mutants of
67
rcn1pgp19pgp1 show severe defects in development suggesting that phosphorylation
may also regulate activity of ABCB transport proteins (Mravec et al., 2008). Moreover,
both PIN and ABCB proteins have possible phosphorylation sites in their sequences
(reviewed in Titapiwatanakun and Murphy, 2009; Zhang et al., 2010). Additionally,
transcripts homologous to protein phosphatase 2A were found during IBA induced
adventitious root formation in Arabidopsis hypocotyl explants (Ludwig-Muller et al.,
2005). Moreover, characterization of PID over-expression lines in rice have revealed that
theses lines have delayed formation of adventitious roots (Morita and Kyozuka, 2007).
Absence of the rcn1 mutation showing an effect on adventitious root formation suggests
that other phosphatases or its subunits might be involved in regulation of adventitious
root development in our system. In essence, our experiments have uncovered an
additional role for protein phosphorylation of auxin transport proteins regulating auxindependent growth physiological processes, yet the precise protein target of this
modification remains unknown.
These results give information on the mechanistic aspects by which root excision,
a horticulturally important process, induces adventitious root formation. We have
dissected the components of auxin signaling, accumulation, and transport driving this
process. Excision-induced adventitious root formation is regulated by enhanced auxin
movement mediated by PIN1 and ABCB19 and by localized changes in auxin
accumulation. Additionally, we have found that post-transcription regulation of ABCB19
modulates auxin transport as well as the location of adventitious root development.
Together these results reveal a new role for ABCB19-mediated auxin transport in
regulating root formation from hypocotyls.
68
Methods
Plant materials and chemicals
Columbia and Wassilewskija ecotypes were mainly used in this study. scr-1, shr1, pSCR::GFP were generously provided by Philip Benfey (Scheres et al., 1995;
Helariutta et al., 2000). Seeds of abcb19, pin1-1, 35S-ABCB19, pABCB19::GFP, and
pABCB19::ABCB19:GFP were kindly provided by Guosheng Wu and Edgar Spalding
(Wu et al., 2007). AtGH3-2GUS line19 was provided by Gretchen Hagen (Li et al., 1999).
AtCYC B1;1:GUS was provided by Maria Ivanchenko (DiDonato et al., 2004). pin7
seeds were provided by Marta Laskowski (Laskowski et al., 2008). arf7, arf19, arf7arf19, and iaa3 were provided by Jason Reed (Wilmoth et al., 2005;Tian et al., 2002). All
the other mutants were received from the ABRC stock center.
IAA was purchased from MP Biochemicals (Solon, Ohio). [3H]IAA (24 and 20 Ci
mmol–1) was purchased from Amersham or American Radiolabeled Chemicals. NPA was
purchased from Chemical Services (West Chester, PA). 5 Bromo-4chloro-3indoyl-β-DGlu UA cyclohexylamine salt was purchased from Gold biotechnology (St. Louis, MO).
RNA isolation kit was purchased from Qiagen (Qiagen plant RNeasy kit). Components of
RNAse treatment, and cDNA synthesis were purchased from Invitrogen (Carlsbad, CA).
Reagents for DNAse treatment was purchased from Promega (Madison, Wisconsin).
SYBRgreen reagent was purchased from Applied Biosystems. All other chemicals were
purchased from Sigma (St. Louis, MO).
Plant growth conditions and quantification of adventitious roots
Seeds were sterilized by soaking in 95% ethanol (v/v) and 20% Bleach (v/v) with
69
10% Triton X-100(v/v) for 5 min each and then washed 5 times with sterilized water.
Seeds were then plated in sterile agar medium containing 0.8% (w/v) Type M agar (A4800, Sigma), 1× MS nutrients (macro and micro salts), vitamins (1 µg⋅mL−1 thiamine, 1
µg⋅mL−1 pyridoxine HCl, and 0.5 µg⋅mL−1 nicotinic acid), 1.5% (w/v) sucrose, 0.05%
(w/v) MES, with pH adjusted to 5.8 with 1N KOH before autoclaving. Plates were placed
in racks in a vertical orientation under light intensity of 3-5µmol m–2 s–1 for 5 days to
induce hypocotyl elongation.
Five day old low light grown seedlings were used in the experiments with or
without excision using Neuro clipper scissors (Fine Science Tools) at a position 5-7.5
mm from shoot apex excision. They were allowed to grow for 7 more days under a light
intensity of 85-100 µmol m–2 s–1. Adventitious roots were quantified on the 7th day unless
otherwise indicated using a dissecting microscope. DIC images of developing
adventitious roots were taken using a Zeiss Axio observer inverted microscope.
Fixing and clearing
Seedlings were fixed in a solution containing 10% (v/v) formaldehyde, 5% (v/v)
acetic acid and 50% (v/v) ethanol, overnight at 4 0C. Then clearing was done using
chloral hydrate:glycerol:water solution (8:1:2, w:v:v), at room temperature, as described
in Fukaki et. al (1998). Cleared seedlings were mounted in 95% ethanol and visualized.
β –Glucuronidase staining
AtGH3:GUS or AtCYCB1;1:GUS transgenic seedlings were incubated in 2 mM
GUS substrate (100 mM sodium phosphate buffer, 0.5% Triton X, 2 mM X-gluc salt, 0.5
70
mM ferricyanide and 0.5 mM ferrocyanide) at 37o C overnight. Samples were then
washed with 100mM sodium phosphate buffer, pH 7 and stored in 95% ethanol. The
samples were cleared, and analyzed for localization of GUS staining using an EpiFluorescent Stereomicroscope (Leica MZ16 FA).
Applications of IAA, NPA, canthardin, and staurosporine
10mM stocks of IAA and NPA were made in ethanol and DMSO, respectively.
For global treatment, IAA or NPA were added to the agar growth medium cooled to 50o
C at indicated concentrations. All experiments involving IAA treatments were placed
under fluorescent lights with yellow filters (Stasinopoulos and Hangarter, 1989) to
prevent white light induced degradation of IAA. For local applications, indicated
chemicals were added in 1% agar in 5mM MES, pH 5.5 at 50o C and placed in
scintillation vials. 1mm agar cylinders were obtained by using sterile plastic transfer
pipettes to cut cores from the solidified agar. Localized application of NPA was done as a
second agar cylinder below the agar cylinder containing IAA. Observations on position
and number of emerged adventitious roots were performed after 7 days using a dissecting
microscope.
10mM stock solutions of canthardin and staurosporine were made in DMSO.
Canthardin or staurosporine was added to the agar growth media cooled to 50o C at
indicated concentrations for 48hrs and 7days to measure IAA transport and adventitious
root formation, respectively.
71
Confocal Microscopy
GFP fluorescence was observed using Zeiss LSM710 Meta fluorescence laser
scanning confocal microscope using either the GFP channel (J0121:GFP, SCR::GFP) or
lambda scanning (ABCB19 lines) at 494-649nm, with samples mounted in deionized
water. Chloroplast and GFP signals were separated using linear unmixing settings of
Zeiss Zen software. Quantification of GFP signals were performed using linear profiles
through the longitudinal sides of the cells using Zeiss Zen software. Tile scanning of
hypocotyls were done using 3 vertical and 7 horizontal setting in the Zeiss software. All
pictures within an experiment were taken under similar settings, unless indicated
otherwise.
Auxin transport
Auxin transport measurements in the hypocotyls were done by modifying a
previously published method (reviewed in Lewis and Muday, 2009). 5 day old low light
grown seedlings; either intact or excised, were transferred to control plates and their
shoot apex was removed. An agar cylinder or agar droplets with tritiated IAA with
approximate concentration of 100nM was applied at the shoot end and incubated in the
dark for 3 hrs. 3mm sections were removed from the basal end from the excised (and at a
similar position from the intact) hypocotyls after 3 hrs and were used for quantification
using a Beckman LS 6500 scintillation counter.
RNA isolation and Quantitative Real time PCR measurements
Low light grown seedlings were transferred to high light conditions for 6hrs.
72
Hypocotyl tissues were harvested from excised seedlings and were frozen in liquid
nitrogen. As controls, intact seedlings were excised and were frozen immediately. Total
RNA was isolated using Qiagen plant minieasy kit, after homogenization of tissue
samples. DNAase treatments were performed and RNA samples were equilibrated.
cDNA reactions were performed followed by RNAase treatment. cDNA samples were
run in 96 well plate in a real time PCR machine (Applied Biosystems 7600-fast thermal
cycler) using target specific primers, deionized water, and SYBR green reagent.
Transcript levels were calculated relative to actin in each sample using the standard curve
meghod.
The primers used were ABCB19- Forward: CAGGAAATGGTTGGTACTCGAGAT,
Reverse: GAATGGCTCAAACGGGTT. PIN1-Forward:
ATCACCTGGTCCCTCATTTC, Reverse: CCATGAACAACCCAAGACTG. ActinForward: TGAGAGATTCAGATGCCCAGAA, Reverse:
GCAGCTTCCATTCCCACAA.
Supplemental Methods:
Quantification of free IAA
For quantification of free IAA levels, 5 day old low light seedlings were
transferred to high light conditions with or without excision, and hypocotyl tissues were
harvested at various time points and frozen in liquid nitrogen. About 50-80mg of frozen
tissues were homogenized using 150µl of homogenization buffer (65% isopropanol, 35%
0.2M imidazole, pH 7), incubated with internal standard (13C6)- IAA, followed by
centrifugation at 10,000g for 8 min. Free IAA was extracted by running through two
73
automated successive columns followed by methylation, drying and redissolving in ethyl
acetate (Barkawi et al., 2008). Quantification was done using GC-SIM-MS through
isotope dilution analysis and values are reported relative to fresh weight in ng/gFW.
Acknowledgements
We appreciate Sangeeta Negi, Daniel Lewis, and Hanya Chrispeels for their
thoughtful comments. We thank Marta Laskowski, Philip Benfey, Gretchen Hagen, and
Edgar Spalding for sharing mutant and transgenic Arabidopsis seeds. We appreciate the
microscopy assistance of Anita McCauley and Daniel Lewis.
74
Literature cited
Barkawi LS, Tam YY, Tillman JA, Pederson B, Calio J, Al-Amier H, Emerick M,
Normanly J, Cohen JD (2008) A high-throughput method for the quantitative analysis
of indole-3-acetic acid and other auxins from plant tissue. Anal Biochem 372: 177-188
Benkova E, Michniewicz M, Sauer M, Teichmann T, Seifertova D, Jurgens G, Friml
J (2003) Local, efflux-dependent auxin gradients as a common module for plant organ
formation. Cell 115: 591-602
Bennett SRM, Alvarez J, Bossinger G, Smyth DR (1995) Morphogenesis in pinoid
mutants of Arabidopsis thaliana. Plant J. 8: 505-520
Blakeslee JJ, Bandyopadhyay A, Lee OR, Mravec J, Titapiwatanakun B, Sauer M,
Makam SN, Cheng Y, Bouchard R, Adamec J, Geisler M, Nagashima A, Sakai T,
Martinoia E, Friml J, Peer WA, Murphy AS (2007) Interactions among PINFORMED and P-glycoprotein auxin transporters in Arabidopsis. Plant Cell 19: 131-147
Boerjan W, Cervera M-T, Delarue M, Beeckman T, Dewitte W, Bellini C, Caboche
M, van Onckelen H, Van Montagu M, Inze D (1995) Superroot, a recessive mutation
in Arabidopsis, confers auxin overproduction. Plant Cell 7: 1405-1419
Casimiro I, Beeckman T, Graham N, Bhalerao R, Zhang HM, Casero P, Sandberg
G, Bennett MJ (2003) Dissecting Arabidopsis lateral root development. Trends in Plant
Science 8: 165-171
Casimiro I, Marchant A, Bhalerao RP, Beeckman T, Dhooge S, Swarup R, Graham
N, Inze D, Sandberg G, Casero PJ, Bennett M (2001) Auxin transport promotes
Arabidopsis lateral root initiation. Plant Cell 13: 843-852
75
Celenza JL, Grisafi PL, Fink GR (1995) A Pathway for Lateral Root-Formation in
Arabidopsis-Thaliana. Genes & Development 9: 2131-2142
De-Klerk G, Krieken W, DeJong J (1999) The formation of adventitious roots: New
concepts, new possibilities. In Vitro Cell Dev Biol-Plant 35: 189-199
DeLong A, Mockaitis K, Christensen S (2002) Protein phosphorylation in the delivery
of and response to auxin signals. Plant Mol Biol 49: 285-303
Deruere J, Jackson K, Garbers C, Soll D, Delong A (1999) The RCN1-encoded A
subunit of protein phosphatase 2A increases phosphatase activity in vivo. Plant J 20: 389399
DiDonato RJ, Arbuckle E, Buker S, Sheets J, Tobar J, Totong R, Grisafi P, Fink
GR, Celenza JL (2004) Arabidopsis ALF4 encodes a nuclear-localized protein required
for lateral root formation. Plant Journal 37: 340-353
DiLaurenzio L, WysockaDiller J, Malamy JE, Pysh L, Helariutta Y, Freshour G,
Hahn MG, Feldmann KA, Benfey PN (1996) The SCARECROW gene regulates an
asymmetric cell division that is essential for generating the radial organization of the
Arabidopsis root. Cell 86: 423-433
Falasca G, Altamura M (2003) Histological analysis of adventitious rooting in
Arabidopsis thaliana (L.) Heynh seedlings. Plant Biosystems 137: 265-274
Friml J, Wisniewska J, Benkova E, Mendgen K, Palme K (2002) Lateral relocation of
auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 415: 806-809
Friml J, Yang X, Michniewicz M, Weijers D, Quint A, Tietz O, Benjamins R,
Ouwerkerk PBF, Ljung K, Sandberg G, Hooykaas PJJ, Palme K, Offringa R (2004)
76
A PINOID-dependent binary switch in apical-basal PIN polar targeting directs auxin
efflux. Science 306: 862-865
Fukaki H, Tameda S, Masuda H, Tasaka M (2002) Lateral root formation is blocked
by a gain-of-function mutation in the SOLITARY-ROOT/IAA14 gene of Arabidopsis.
Plant Journal 29: 153-168
Fukaki H, Wysocka-Diller J, Kato T, Fujisawa H, Benfey PN, Tasaka M (1998)
Genetic evidence that the endodermis is essential for shoot gravitropism in Arabidopsis
thaliana. Plant J 14: 425-430
Galweiler L, Guan CH, Muller A, Wisman E, Mendgen K, Yephremov A, Palme K
(1998) Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue.
Science 282: 2226-2230
Gutierrez L, Bussell JD, Pacurar DI, Schwambach J, Pacurar M, Bellini C (2009)
Phenotypic Plasticity of Adventitious Rooting in Arabidopsis Is Controlled by Complex
Regulation of AUXIN RESPONSE FACTOR Transcripts and MicroRNA Abundance.
Plant Cell 21: 3119-3132
Heisler MG, Ohno C, Das P, Sieber P, Reddy GV, Long JA, Meyerowitz EM (2005)
Patterns of auxin transport and gene expression during primordium development revealed
by live imaging of the Arabidopsis inflorescence meristem. Current Biology 15: 18991911
Helariutta Y, Fukaki H, Wysocka-Diller J, Nakajima K, Jung J, Sena G, Hauser
MT, Benfey PN (2000) The SHORT-ROOT gene controls radial patterning of the
Arabidopsis root through radial signaling. Cell 101: 555-567
77
Hobbie L, Estelle M (1995) The Axr4 Auxin-Resistant Mutants of Arabidopsis-Thaliana
Define a Gene Important for Root Gravitropism and Lateral Root Initiation. Plant Journal
7: 211-220
King JJ, Stimart DP (1998) Genetic analysis of variation for auxin-induced adventitious
root formation among eighteen ecotypes of Arabidopsis thaliana L. Heynh. J Hered 89:
481-487
Konishi M, Sugiyama M (2003) Genetic analysis of adventitious root formation with a
novel series of temperature-sensitive mutants of Arabidopsis thaliana. Development 130:
5637-5647
Laplaze L, Parizot B, Baker A, Ricaud L, Martiniere A, Auguy F, Franche C,
Nussaume L, Bogusz D, Haseloff J (2005) GAL4-GFP enhancer trap lines for genetic
manipulation of lateral root development in Arabidopsis thaliana. Journal of
Experimental Botany 56: 2433-2442
Laskowski M, Grieneisen VA, Hofhuis H, Hove CA, Hogeweg P, Maree AF, Scheres
B (2008) Root system architecture from coupling cell shape to auxin transport. PLoS Biol
6: e307
Lewis DR, Muday GK (2009) Measurement of auxin transport in Arabidopsis thaliana.
Nat Protoc 4: 437-451
Lewis DR, Wu GS, Ljung K, Spalding EP (2009) Auxin transport into cotyledons and
cotyledon growth depend similarly on the ABCB19 Multidrug Resistance-like transporter.
Plant Journal 60: 91-101
78
Leyser HMO, Pickett FB, Dharmasiri S, Estelle M (1996) Mutations in the AXR3
gene of Arabidopsis result in altered auxin response including ectopic expression from
the SAUR-AC1 promoter. Plant Journal 10: 403-413
Li S, Xue L, Xu S, Feng H, An L (2009) Mediators, Genes and signaling in
Adventitious rooting. Bot.Rev 75: 230-247
Li Y, Wu Y, Hagen G, Guilfoyl T (1999) Expression of the auxin-inducible GH3
promoter/GUS fusion gene as a useful molecular marker for auxin physiology. Plant Cell
Physiol 40: 675-682
Liu HJ, Wang SF, Yu XB, Yu J, He XW, Zhang SL, Shou HX, Wu P (2005) ARL1, a
LOB-domain protein required for adventitious root formation in rice. Plant Journal 43:
47-56
Liu SP, Wang JR, Wang L, Wang XF, Xue YH, Wu P, Shou HX (2009) Adventitious
root formation in rice requires OsGNOM1 and is mediated by the OsPINs family. Cell
Research 19: 1110-1119
Ludwig-Muller J, Vertocnik A, Town CD (2005) Analysis of indole-3-butyric acidinduced adventitious root formation on Arabidopsis stem segments. Journal of
Experimental Botany 56: 2095-2105
Malamy J (2005) Intrinsic and environmental response pathways that regulate root
system architecture. Plant Cell Environ 28: 67-77
Malamy J, Benfey P (1997) Organization and cell differentiation in lateral roots of
Arabidopsis thaliana. Development 124: 33-44
Malamy JE, Benfey PN (1997) Down and out in Arabidopsis: the formation of lateral
roots. Trends Pl. Sci. 2: 390-396
79
Marchant A, Bhalerao R, Casimiro I, Eklof J, Casero PJ, Bennett M, Sandberg G
(2002) AUX1 promotes lateral root formation by facilitating indole-3-acetic acid
distribution between sink and source tissues in the Arabidopsis seedling. Plant Cell 14:
589-597
Marchant A, Kargul J, May ST, Muller P, Delbarre A, Perrot-Rechenmann C,
Bennett MJ (1999) AUX1 regulates root gravitropism in Arabidopsis by facilitating
auxin uptake within root apical tissues. Embo Journal 18: 2066-2073
Michniewicz M, Zago M, Abas L, Wijers D, Schweighofer A, Meskiene I, Heisler M,
Ohno C, Zhang J, Huang F, Schwab R, Weigle D, Meyerowitz E, Luschnig C,
Offringa R, Friml J (2007) Antagonistic regulation of PIN phosphorylation by PPSA
and PINOID directs auxin flux. Cell 130: 1044-1056
Morita Y, Kyozuka J (2007) Characterization of OsPID, the rice ortholog of PINOID,
and its possible involvement in the control of polar auxin transport. Plant and Cell
Physiology 48: 540-549
Mravec J, Kubes M, Bielach A, Gaykova V, Petrasek J, Skupa P, Chand S, Benkova
E, Zazimalova E, Friml J (2008) Interaction of PIN and PGP transport mechanisms in
auxin distribution-dependent development. Development 135: 3345-3354
Muday GK, Brady SR, Argueso C, Deruere J, Kieber JJ, DeLong A (2006) RCN1regulated phosphatase activity and EIN2 modulate hypocotyl gravitropism by a
mechanism that does not require ethylene signaling. Plant Physiol 141: 1617-1629
Noh B, Bandyopadhyay A, Peer WA, Spalding EP, Murphy AS (2003) Enhanced
gravi- and phototropism in plant mdr mutants mislocalizing the auxin efflux protein PIN1.
Nature 423: 999-1002
80
Noh B, Murphy AS, Spalding EP (2001) Multidrug resistance-like genes of
Arabidopsis required for auxin transport and auxin-mediated development. Plant Cell 13:
2441-2454
Okada K, Ueda J, Komaki MK, Bell CJ, Shimura Y (1991) Requirement of the auxin
polar transport system in early stages of Arabidopsis floral bud formation. Plant Cell 3:
677-684
Peret B, De Rybel B, Casimiro I, Benkova E, Swarup R, Laplaze L, Beeckman T,
Bennett MJ (2009) Arabidopsis lateral root development: an emerging story. Trends
Plant Sci 14: 399-408
Rashotte AM, DeLong A, Muday GK (2001) Genetic and chemical reductions in
protein phosphatase activity alter auxin transport, gravity response, and lateral root
growth. Plant Cell 13: 1683-1697
Reed RC, Brady SR, Muday GK (1998) Inhibition of auxin movement from the shoot
into the root inhibits lateral root development in arabidopsis. Plant Physiology 118: 13691378
Sanchez C, Vielba J, Ferro E, Covelo G, Sole A, Abarca D, Demier B, Diaz-Sala C
(2007) Two SCARE CROW-LIKE genes are induced in response to exogenous auxin in
rooting-competent cuttings of distantly related forest species. Tree Physiology 27: 14591470
Sauer M, Balla J, Luschnig C, Wisniewska J, Reinohl V, Friml J, Benkova E (2006)
Canalization of auxin flow by Aux/IAA-ARF-dependent feedback regulation of PIN
polarity. Genes & Development 20: 2902-2911
81
Scheres B, Dilaurenzio L, Willemsen V, Hauser MT, Janmaat K, Weisbeek P,
Benfey PN (1995) Mutations Affecting the Radial Organization of the Arabidopsis Root
Display Specific Defects Throughout the Embryonic Axis. Development 121: 53-62
Sorin C, Bussell JD, Camus I, Ljung K, Kowalczyk M, Geiss G, McKhann H,
Garcion C, Vaucheret H, Sandberg G, Bellini C (2005) Auxin and light control of
adventitious rooting in Arabidopsis require ARGONAUTE1. Plant Cell 17: 1343-1359
Sorin C, Negroni L, Balliau T, Corti H, Jacquemot MP, Davanture M, Sandberg G,
Zivy M, Bellini C (2006) Proteomic analysis of different mutant genotypes of
Arabidopsis led to the identification of 11 proteins correlating with adventitious root
development. Plant Physiology 140: 349-364
Stasinopoulos TC, Hangarter RP (1989) Preventing photochemistry in culture media
by long-pass light filters alters growth of cultured tissues. Plant Physiol 93: 1365-1369
Stowe-Evans EL, Harper RM, Motchoulski AV, Liscum E (1998) NPH4, a
conditional modulator of auxin-dependent differential growth responses in Arabidopsis.
Plant Physiol 118: 1265-1275
Sukumar P, Edwards KS, Rahman A, Delong A, Muday GK (2009) PINOID kinase
regulates root gravitropism through modulation of PIN2-dependent basipetal auxin
transport in Arabidopsis. Plant Physiol 150: 722-735
Swarup K, Benkova E, Swarup R, Casimiro I, Peret B, Yang Y, Parry G, Nielsen E,
De Smet I, Vanneste S, Levesque MP, Carrier D, James N, Calvo V, Ljung K,
Kramer E, Roberts R, Graham N, Marillonnet S, Patel K, Jones JDG, Taylor CG,
Schachtman DP, May S, Sandberg G, Benfey P, Friml J, Kerr I, Beeckman T,
82
Laplaze L, Bennett MJ (2008) The auxin influx carrier LAX3 promotes lateral root
emergence. Nature Cell Biology 10: 946-954
Swarup K, Benková E, Swarup R, Casimiro I, Péret B, Yang Y, Parry G, Nielsen E,
De Smet I, Vanneste S, Levesque MP, Carrier D, James N, Calvo V, Ljung K,
Kramer E, Roberts R, Graham N, Marillonnet S, Patel K, Jones JDG, Taylor CG,
Schachtman DP, May S, Sandberg G, Benfey P, Friml J, Kerr I, Beeckman T,
Laplaze L, Bennett MJ (2008) The auxin influx carrier LAX3 promotes lateral root
emergence. Nature Cell Biology In Press
Teale WD, Paponov IA, Palme K (2006) Auxin in action: signalling, transport and the
control of plant growth and development. Nature Reviews Molecular Cell Biology 7:
847-859
Tian Q, Reed JW (1999) Control of auxin-regulated root development by the
Arabidopsis thaliana SHY2/IAA3 gene. Development 126: 711-721
Tian Q, Uhlir NJ, Reed JW (2002) Arabidopsis SHY2/IAA3 inhibits auxin-regulated
gene expression. Plant Cell 14: 301-319
Titapiwatanakun B, Murphy AS (2009) Post-transcriptional regulation of auxin
transport proteins: cellular trafficking, protein phosphorylation, protein maturation,
ubiquitination, and membrane composition. Journal of Experimental Botany 60: 10931107
Van Hoewyk D, Takahashi H, Inoue E, Hess A, Tamaoki M, Pilon-Smits E (2008)
Transcriptome analyses give insights into selenium-stress responses and selenium
tolerance mechanisms in Arabidopsis. Physiol Plant 132: 236-253
83
Wilmoth JC, Wang S, Tiwari SB, Joshi AD, Hagen G, Guilfoyle TJ, Alonso JM,
Ecker JR, Reed JW (2005) NPH4/ARF7 and ARF19 promote leaf expansion and auxininduced lateral root formation. Plant J 43: 118-130
Wu G, Lewis DR, Spalding EP (2007) Mutations in Arabidopsis multidrug resistancelike ABC transporters separate the roles of acropetal and basipetal auxin transport in
lateral root development. Plant Cell 19: 1826-1837
Xu M, Zhu L, Shou HX, Wu P (2005) A PIN1 family gene, OsPIN1, involved in auxindependent adventitious root emergence and tillering in rice. Plant and Cell Physiology
46: 1674-1681
Zadnikova P, Petrasek J, Marhavy P, Raz V, Vandenbussche F, Ding ZJ,
Schwarzerova K, Morita MT, Tasaka M, Hejatko J, Van Der Straeten D, Friml J,
Benkova E (2010) Role of PIN-mediated auxin efflux in apical hook development of
Arabidopsis thaliana. Development 137: 607-617
Zhang J, Nodzynski T, Pencik A, Rolcik J, Friml J (2010) PIN phosphorylation is
sufficient to mediate PIN polarity and direct auxin transport. Proceedings of the National
Academy of Sciences of the United States of America 107: 918-922
84
CHAPTER III
AUXIN-ETHYLENE CROSS TALK DRIVES ADVENTITIOUS ROOT FORMATION
IN ARABIDOPSIS
Sukumar P., Lewis D.R., Muday G.K.
The following manuscript is to be submitted for publication. Sukumar P. performed most
of the experiments and prepared the manuscript. Lewis D.R. performed experiments in
Figure 4 D&E. Muday G.K. acted in an advisory and editorial capacity.
85
Abstract
While studies in agriculturally important species of plants have provided
contradictory evidence on the role of ethylene in adventitious root formation, the genetic
tools in Arabidopsis thaliana (Arabidopsis) have not been exploited to provide insight
into this process. We examined the role of ethylene in adventitious root formation using
mutants in ethylene signaling or synthesis, and find that treatment with the ethylene
precursor ACC (1-aminocyclopropane-1-carboxylic acid) or the eto1 (ethylene over
producing1) mutation led to fewer adventitious roots. In contrast, the ethylene insensitive
mutants, ein2-5 and etr1-1, had increased number of adventitious roots. Consistent with
their adventitious root phenotypes, eto1 had reduced auxin transport, while ein2-5 had
enhanced transport, suggesting that ethylene negatively regulates hypocotyl auxin
transport and adventitious root formation. Additionally the fluorescence of an auxin
efflux carrier protein fusion, pABCB19::ABCB19:GFP (ATP BINDING CASSETTE
TYPE B), was reduced by ACC treatment. Moreover, abcb19 mutants were insensitive to
reduction of adventitious roots with ACC treatment, indicating ABCB19 levels regulated
this ethylene response. Excision enhanced accumulation of flavonoids, through increased
expression of the gene encoding the flavonoid biosynthetic enzyme, chalcone synthase
(CHS). We find that the tt4-2 (transparent testa 4) mutant, which has a defect in CHS,
exhibits partial insensitivity to excision-induced adventitious root formation and elevated
auxin transport and ACC inhibition of both processes. These results suggest a possible
auxin-ethylene cross talk regulating adventitious root formation in Arabidopsis, with
ethylene regulating auxin transport and accumulation, through modulating flavonoid
accumulation and ABCB19 protein levels.
86
Introduction
Ethylene is a gaseous plant hormone that regulates various development processes
such as ripening and senescence and whose synthesis is induced upon wounding,
pathogen attack, and other situations of stress, including flooding (reviewed in Bleecker
and Kende, 2000). Recent studies have examined the effects of ethylene on lateral root
development, with ethylene inhibiting lateral root formation in both Arabidopsis and
Solanum lycopersicum (tomato) (Negi et al., 2008; Negi et al., 2010). The effect of
ethylene on adventitious root formation is less clear with ethylene promoting adventitious
root formation in some species, while in other species ethylene decreases adventitious
root formation (reviewed in De-Klerk et al., 1999; Clark et al., 1999; Coleman et al.,
1980; Nordstrom and Eliasson, 1984). No studies have utilized the genetic tools available
in Arabidopsis to identify mechanisms by which ethylene acts in this process.
The pathways of ethylene signaling and synthesis have been identified through
genetic approaches in Arabidopsis. The ethylene signaling pathway is mediated by a
receptor family including ETR1 (ETHYLENE RESISTANT 1) (Bleecker et al., 1988).
Binding of ethylene to its receptor inactivates CTR1 (CONSTITUTIVE TRIPLE
RESPONSE 1), which encodes a kinase that is implicated in a MAPKKK cascade
(Kieber et al., 1993). Both receptors and CTR1 negatively regulate this pathway (Kieber,
1997). Downstream of CTR1 is EIN2 (ETHYLENE INSENSITIVE 2), an Nramp metal
ion transporter, which is required for ethylene signaling (Alonso et al., 1999). EIN3
(ETHYLENE INSENSITVE 3) and EILs (EIN3 LIKE) are a group of transcription
factors that regulate the expression of ethylene induced genes (Chao et al., 1997;
Bleecker and Kende, 2000; Potuschak et al., 2003). Ethylene biosynthesis begins with
87
formation of ACC (Aminocyclopropane-1-carboxylic acid) by the enzyme ACC synthase
(ACS), which is then converted to ethylene by the enzyme ACC oxidase (Argueso et al.,
2007). ACS is modulated by ETO (ETHYLENE OVERPRODUCER), which regulates
its protein stability (Chae et al., 2003). Plants with mutations in ethylene signaling or
synthesis genes have provided valuable insights into the physiological processes
mediated by ethylene.
One such process tied to ethylene signaling is the triple response, which was
exploited in the isolation of mutants altered in ethylene signaling and synthesis. The triple
response consists of reduced elongation of the root and shoot, swelling of the stem, and
exaggerated hook formation in etiolated seedlings treated with ethylene (Bleecker et al.,
1988; reviewed in Bleecker and Kende, 2000; Knee et al., 2000). This ethylene mediated
hypocotyl growth regulation is not only involved in growth of plants in the dark, but also
while growing in light and is shown to occur through crosstalk with auxin in some, but
not all, studies (Smalle et al., 1997; Collett et al., 2000). Additionally, light induced
changes in ethylene sensitivity were shown to be important in opening of hypocotyl
hooks (Knee et al., 2000). Therefore numerous aspects of hypocotyl growth and
development are ethylene regulated.
Ethylene is also involved in regulating root elongation and development. Root
elongation is synergistically inhibited by auxin and ethylene (Ruzicka et al., 2007;
Stepanova et al., 2007; Swarup et al., 2007). Auxin and ethylene promote root hair
formation in an interdependent manner requiring both auxin and ethylene signaling
pathways for this induction (Rahman et al., 2002). Additionally, auxin and ethylene were
shown to oppositely modulate lateral root development (Negi et al., 2008; Ivanchenko et
88
al., 2008). In Arabidopsis, etr1 and ein2 have enhanced lateral root formation, while eto1
and ctr1 have reduced formation of lateral roots (Negi et al., 2008). Similarly, the tomato
NR (Never ripe) mutant, which has a defect in a gene encoding an ethylene receptor, has
enhanced formation of lateral roots (Negi et al., 2010). Moreover, in tomato, NR mutants
had reduced formation of adventitious roots (Negi et al., 2010). Consistent with a
promotive effect of this hormone, treatment with the ethylene precursor ACC, caused
enhanced formation of adventitious roots (Negi et al., 2010). Moreover development of
adventitious roots has been shown to involve auxin-ethylene crosstalk (Negi et al., 2010).
In Rumex plants, flooding induced adventitious root formation is mediated by ethylene
enhanced auxin sensitivity (Visser et al., 1996). These results indicate that ethylene is an
important regulator of plant growth and development and several of these physiological
processes requires complex interaction of auxin and ethylene.
Few studies have examined the mechanisms by which ethylene-auxin crosstalk
occurs at the level of signaling, synthesis, and/or transport of these hormones. Defects in
auxin signaling and transport render roots less sensitive to the inhibition of root
elongation via ethylene treatment (Rahman et al., 2001). Conversely, defects in ethylene
signaling can alter root development in response to auxin (Negi et al., 2010; Negi et al.,
2008; Clark et al., 1999). Auxin accumulation is enhanced with ethylene precursor
treatments in roots and seedlings (Stepanova et al., 2007; Swarup et al., 2007). Moreover,
the weak ethylene insensitive mutants, wei1 and wei7, defective in ethylene inhibition of
root elongation, have mutations in genes encoding enzymes involved in auxin
biosynthesis (Stepanova et al., 2005). Additionally, auxin can induce ethylene
biosynthesis during adventitious root formation (Riov and Yang, 1989; Visser et al.,
89
1996). Furthermore, ethylene enhances auxin transport, while it inhibits the formation of
lateral roots in Arabidopsis and tomato. The ethylene effect on lateral root formation is
lost in auxin transport mutants, suggesting that the effect acts through these auxin
transport proteins (Negi et al., 2008). One mechanism by which ethylene regulates auxin
transport is through enhanced accumulation of flavonoids (Buer et al., 2006; Lewis et al.,
in review). Flavonoids negatively regulate auxin transport and alter root gravity response
and lateral root formation (Buer and Muday, 2004; Buer et al., 2006; Brown et al., 2001).
These results suggest that flavonoids are important in auxin-ethylene cross talk. The
diversity of Arabidopsis mutants with altered ethylene and auxin signaling, synthesis, and
transport can be used to identify mechanisms of auxin-ethylene cross talk driving
adventitious root formation.
Our previous research has revealed the role of auxin in regulating adventitious
root formation in Arabidopsis (Sukumar and Muday, in review). Moreover, research from
other species of plants suggests that ethylene might also be involved in regulation of
adventitious root development (Clark et al., 1999; reviewed in De-Klerk et al., 1999; Li et
al., 2009). The purpose of these experiments is to understand the role of ethylene in
regulation of development of adventitious roots and to uncover possible cross talk
between the two plant hormones auxin and ethylene. These studies use a method to
induce adventitious root formation (Sukumar and Muday, in review) and have examined
this phenotype in mutants defective in ethylene signaling or synthesis. Using these
mutants, a role for ethylene in this process has been identified. We have observed
changes in auxin transport in these mutants and have identified ethylene-induced changes
in abundance of an auxin transport protein and flavonoids, endogenous auxin transport
90
regulators, which are required for maximal development of adventitious roots. Together
these results have provided new insights into ethylene regulation of auxin transport and
accumulation driving the formation of adventitious roots.
91
Results
Ethylene negatively regulates adventitious root formation
We have utilized the genetic tools in Arabidopsis to ask if ethylene regulates
adventitious root development. Arabidopsis seedlings were grown under low light
conditions (5-10 µmoles/m2/min) for 5 days and were transferred to high light conditions
(80-100 µmoles/m2/min) on media with or without ACC. At the time of transfer, the
basal half of the shoot and the root system were excised (from here on referred to as root
excised hypocotyls), as this regime was found to enhance adventitious root formation 10fold relative to intact hypocotyls (Sukumar and Muday, in review). The number of
emerged adventitious roots on control media and media with the indicated concentrations
of the ethylene precursor, ACC, was quantified after seven days of growth, as shown in
Figure III-1A. At concentrations of 10 and 25 µM, ACC significantly reduced
adventitious root formation (p< 0.005), suggesting a negative role of ethylene on
development of adventitious roots. The magnitude of the inhibition was approximately
25%, consistent with significant endogenous ethylene present in these seedlings.
To confirm the effect of ACC on adventitious root formation, we examined the
adventitious root phenotype in ethylene signaling and synthesis mutants; the ethylene
insensitive mutants: ein2-5 and etr1-1, the ethylene over producer: eto1-1, and the
constitutive ethylene signaling mutant: ctr1-1, as shown in Figure III-1B. The ein2-5
mutant had significantly greater number of adventitious roots (1.4-fold increase), while
eto1-1 and ctr1-1 had significantly fewer adventitious roots, with 20% and 50%
inhibition, respectively (p< 0.005). These effects are consistent with endogenous ethylene
negatively regulating adventitious root formation in Arabidopsis.
92
Number of adventitious roots
A
D
6
*
5
*
4
3
2
1
0
0
Number of adventitious
roots, % of wild type
B
160
1
10
[ACC], µM
*
140
25
Untreated
120
100
*
80
*
60
40
20
0
WT ein2-5 eto1-1 ctr1-1
Number of adventitious roots
with canthardin,% of untreated
C
160
140
Canthardin
120
100
80
60
*
40
20
0
WT ein2-5 eto1-1 ctr1-1
Figure III-1: Ethylene negatively affects adventitious root formation and is induced with
excision.
93
(A) Adventitious root formation was quantified in root excised seedlings treated with the
indicated concentrations of ACC. Average ± SE of 15-69 seedlings are given. Values are
compared to untreated controls by Student’s t test. *p≤ 0.05.
(B) Adventitious root formation was quantified in root excised seedlings of ethylene
mutants. Average ± SE of 19-30 seedlings are given. Values are compared to wild-type
by Student’s t-test. * p≤ 0.05.
(C) Quantification of adventitious root formation, 7 days after excision, in wild type,
ein2-5, eto1-1, and ctr1-1 mutants with canthardin treatment. Average ± SE of 9-31
seedlings are given. Values are compared by Student’s t-test. *p≤ 0.05.
(D) Images of wild type, ein2-5, and eto1-1 mutants with or without canthardin treatment
taken using a stereomicroscope. Arrows point to the site of excision and arrow heads
point to the uppermost emerged adventitious roots relative to shoot apex. Scale bar is 1
mm.
94
When roots are excised from seedlings grown under these conditions, adventitious
roots emerge clustered together, 1-2 mm above the site of excision, as evident in Figure
III-1D. We asked if ethylene alters the localization of excision induced adventitious root
formation, in addition to its effect on the number of adventitious roots. To test this, we
examined the adventitious root formation in the ethylene mutants: ein2-5, eto1-1, ctr1-1,
and wild type treated with and without 25µM ACC, as shown in Figure III-1Cand D. In
all these seedlings, adventitious roots emerged approximately 1-2 mm above the site of
excision, as detected in cleared hypocotyls, suggesting that altered ethylene signaling or
synthesis does not affect the position of adventitious root formation.
Furthermore, the position of adventitious roots in root excised hypocotyls is delocalized if seedlings are treated with the protein phosphatase inhibitor canthardin
(Sukumar and Muday, in review). We examined the adventitious root formation in
ethylene mutants ein2-5, eto1-1, ctr1-1, and wild type treated with and without ACC, in
the presence and absence of canthardin, to ask if altered ethylene signaling or synthesis
would affect this canthardin effect, as shown in Figure III-1C, 1D. Interestingly, the delocalization effect of canthardin was seen in all of the ethylene mutants, as well as wild
type treated with ACC. The number of adventitious roots formed with canthardin in all
the mutants, except ein2-5, was similar to their respective untreated controls (Figure III1D), consistent with our previous observation that canthardin does not alter the number of
adventitious roots (Sukumar and Muday, in review). ACC reduced adventitious root
formation in wild type, and a combined treatment with canthardin and ACC neither had
an additional reduction beyond ACC alone in number of adventitious roots nor did this
combination change the longitudinal position of root formation relative to canthardin
95
alone. These results suggest that the canthardin altered position of adventitious root
formation occurs independently of ethylene synthesis or signaling.
ACC reduces auxin induction of adventitious root formation
Previous results have shown that auxin positively regulates adventitious root
formation in Arabidopsis. We asked whether there are interactions between ethylene and
auxin during adventitious root formation using two endogenous auxins: indole-3-acetic
acid (IAA) and indole-3-buytric acid (IBA). Although IAA is the most abundant naturally
occurring auxin in plants (reviwed in Woodward and Bartel, 2005), IBA is commercially
used for induction of adventitious roots, due to its greater stability (reviwed in De-Klerk
et al., 1999). For this experiment we used intact hypocotyls, as our previous experiments
have shown a greater fold enhancement of adventitious root formation with auxin
treatment of intact hypocotyl than of root excised hypocotyls (Sukumar and Muday, in
review). Five day old low light grown hypocotyls were transferred to media with either
IAA, IBA, or ACC or a combination of these compounds. Adventitious roots that
emerged 7 days later in these intact seedlings were quantified and are reported in Figure
III-2A. ACC treatment slightly reduced adventitious root development in intact seedlings,
which form few adventitious roots. Both IAA and IBA alone significantly increased the
number of adventitious roots (p< 0.005), while a combined treatment of IAA and IBA
produced the greatest number of adventitious roots. With a combined treatment of IAA
and ACC, the number of adventitious roots emerged were intermediate relative to the
single treatments, with a 55% reduction in adventitious roots compared to IAA treatment.
Surprisingly, an ACC and IBA combined treatment did not significantly change the
96
Number of adventitious roots
A
14
ad
WT Intact
12
10
ac
8
ab
ac
6
a
ac
4
2
0
25µM
25µM
_
IAA
_
_
IAA
ACC
_
ACC
C
Number of adventitious roots
WT+IAA
ein2-5+IAA
WT+IBA
ein2-5+IBA
-∞ -7
Number of adventitious roots
B
16
14
12
10
8
6
4
2
0
IBA
Intact
-6
-5
Log auxin conc, M
-4
IBA
ACC
16
14
12
10
8
6
4
2
0
_
WT+IAA
ein2-5+IAA
WT+IBA
ein2-5+IBA
-∞ -7
IAA&IBA IAA&IBA
_
ACC
Excised
-6
-5
Log auxin conc, M
-4
Figure III-2: Ethylene can inhibit auxin induction of adventitious root formation.
(A) Adventitious roots formed in intact seedlings treated with IAA, IBA or ACC or
combination of IAA or IBA and ACC. Average ± SE of 10-30 seedlings are given.
a- Indicates significant difference as determined by Student’s t-test between untreated
and treated with p< 0.05.
97
b- Indicates significant difference as determined by Student’s t-test between auxin only
and combined auxin and ACC treatments
c- Indicates significant difference as determined by Student’s t-test between ACC only
and combined ACC and auxin treatments
d- Indicates significant difference as determined by Student’s t-test between single IAA
or IBA and combined auxin treatment
(B), (C) Adventitious roots formed in intact (B) or root excised (C) in wild type and,
ein2-5 treated with the indicated concentrations of IAA or IBA. n=9-32
98
number of adventitious roots relative to IBA added alone. ACC with IAA and IBA
induced a statistically significant 40% reduction in hypocotyls relative to IAA and IBA
treatments (p< 0.05). These results suggest the surprising finding that ethylene can inhibit
the IAA, but not the IBA induction of adventitious root formation in Arabidopsis
seedlings.
Ethylene insensitive mutants are hypersensitive to auxin induction of adventitious root
formation
We further explored auxin-ethylene cross talk by examining the effects of IAA
and IBA on adventitious root formation in the ethylene insensitive mutant ein2-5 in both
intact and root excised hypocotyls. 5 day old low light grown hypocotyls of wild type or
mutants were transferred to media with various concentrations of IAA or IBA.
Adventitious roots that emerged 7 days later were quantified and are reported in Figure
III-2B,C. There was no difference in the formation of adventitious roots between IAA
and IBA in wild type intact hypocotyls, while IAA induced more adventitious roots than
IBA in wild type excised hypocotyls. In both intact and excised hypocotyls, ein2-5
produced a greater number of adventitious roots than wild type at most concentration of
IAA and IBA. Additionally at lower concentrations, IAA had more profound effects than
IBA in both intact and excised ein2-5. Identical results were found with ethylene resistant
mutant etr1-1, as shown in Supplemental Figure III-S1. These results indicate that
ethylene insensitive mutants are hypersensitive to auxin induction of adventitious roots,
particularly IAA, and suggest that the ethylene responsiveness may inhibit the
effectiveness of auxin induction of adventitious root formation. This result is consistent
99
S1B
14
12
10
8
WT+IAA
etr1-1+IAA
WT+IBA
etr1-1+IBA
Intact
6
4
2
0
-∞-7
-6
-5
Log auxin conc, M
-4
Number of adventitious roots
Number of adventitious roots
S1A
14
12
10
8
WT+IAA
etr1-1+IAA
WT+IBA
etr1-1+IBA
Excised
6
4
2
0
-∞ -7
-6
-5
Log auxin conc, M
-4
Supplemental Figure III-1: Adventitious roots formed in intact (S1A) or root excised
(S1B) in wild type and, etr1-1 treated with various concentrations of IAA, or IBA.
100
with ethylene reducing the positive effect of auxin, with interaction between ethylene and
IAA being greater than interactions with IBA, as determined by both exogenous
treatments and examination of an ethylene insensitive mutant. Although IBA can be a
precursor to IAA (reviwed in Woodward and Bartel, 2005), appears to act independently
and be transported by a different set of proteins (Rashotte et al., 2005; Poupart et al.,
2005; Strader and Bartel, 2009). In parallel, IAA and IBA were found to have different
kinetics for inducing ethylene accumulation in stem cuttings of mung bean (Riov and
Yang, 1989). The very different interactions between ACC and these two auxins reported
here suggests that differences between IAA and IBA transport and signaling may lead to
these different interactions with ethylene.
Ethylene negatively regulates basipetal auxin transport in hypocotyls
To test if ethylene affects hypocotyl auxin transport, we examined basipetal IAA
transport in root excised hypocotyls of wild type, ein2-5, and eto1-1. Agar droplets with
3
H-IAA were applied at the shoot apical end of root excised hypocotyls, and the amounts
of 3H-IAA moving into basal sections of the hypocotyls were measured 3 hrs later and
are reported in Figure III-3A. While ein2-5 had significantly increased transport
compared to wild type, eto1-1 had significantly reduced transport relative to wild type
(p< 0.005). This suggests that ethylene negatively modulates IAA hypocotyl basipetal
transport. The enhancement and reduction of IAA transport in these mutants, respectively,
are consistent with their adventitious root phenotype. As a previous study showed that
auxin transport from the shoot apex is essential for adventitious root formation and that
enhanced root formation after root excision increased auxin transport and adventitious
101
B
160
Free IAA levels, ng/gFW
Basipetal hypocotyl transport,
% of wild type
A
*
140
120
100
80
*
60
40
20
0
Col
ein2-5 eto1-1
D
18
16
14
12
10
8
6
4
2
0
Intact
Excised
Control 10µM ACC 25µM ACC
Free IAA levels, ng/gFW
C
18
Col
ein2-5
eto1-1
16
14
*
12
10
*
8
6
4
2
0
Intact
48hrs
Excised
48hrs
Figure III-3: Ethylene inhibits IAA transport and free IAA levels in hypocotyls.
(A) Quantification of basipetal IAA transport in ein2-5 and eto1-1. Average ± SE of 1837 seedlings are given. Values are compared to wild type by Student’s t-test. * p≤ 0.005.
(B), (C) Free IAA levels were quantified in wild type, wild type treated with ACC, ein2-5
and eto1-1 using extraction and quantification using GC-Mass spec. Values are
compared to wild type by Student’s t-test. * p≤ 0.005.
(D) Hypocotyls of wild type DR5:GUS and ein2-5 DR5:GUStransgenic seedlings were
stained after 48hrs after root excision. Arrow head points to region of GUS product
formation. Scale bars are 1mm.
102
root formation (Sukumar and Muday, in review), these results suggest that the
mechanism by which ethylene reduces adventitious root formation may be to reduce
auxin transport.
Mutants with altered ethylene signaling or synthesis have altered free IAA levels in
hypocotyls
Ethylene has been reported to increase free IAA accumulation in root tissues
(Swarup et al., 2007). We asked if ethylene alters free IAA levels after excision in
hypocotyls. Free IAA levels were measured in root excised seedlings treated with 10 µM
ACC or 25 µM ACC for 48 hrs, as shown in Figure III-3B. There was no significant
change in the free IAA levels at either dose of ACC. We also examined the free IAA
levels in intact and excised hypocotyls of the ethylene insensitive mutant ein2-5 and
ethylene over producer mutant, eto1-1, and these levels are compared to wild type in
Figure III-3C. Root excised and intact hypocotyls of eto1-1 mutants had reduced free
IAA levels, but the difference was significant only for root excised samples (p< 0.005).
Surprisingly, ein2-5 had a similar trend in free IAA accumulation, with reduction in
levels compared to wild type, with significant reduction detected only in root excised
hypocotyls (p< 0.05). The reduction of free IAA levels observed in both eto1-1 and ein25 may be due to the differences in size of the seedlings used in the assay. The eto1-1
mutant has smaller hypocotyls relative to wild type, while ein2-5 mutants have slightly
longer hypocotyls. This might have resulted in a greater number of eto1-1 seedlings than
ein2-5 at a similar mass of tissue. The reduction in free IAA levels in eto1-1 contrast with
previous results that ethylene increases IAA accumulation in root tips (Swarup et al.,
103
2007). Our results from hypocotyls suggest the ethylene might regulate IAA
accumulation differently in stem and roots. Alternatively, there might be differences in
measurement techniques, growth conditions, or tissue used in these experiments. These
results indicate that the free IAA levels do not change in a consistent way with the
frequency of adventitious root formation. No significant changes in free IAA levels were
observed in most of the treatments suggesting that the regulation of ethylene might be
more significant at the level of auxin transport required for adventitious root formation,
which changes in a consistent way with adventitious root phenotype.
Ethylene negatively regulates root excision induced local auxin induced gene expression
Our previous experiments have indicated that there are localized increases in
auxin accumulation driving adventitious root formation above the site of excision, as
judged by the expression of an auxin responsive promoter-GUS constuct (Sukumar and
Muday, in review). We asked if those changes in local auxin accumulation are altered in
the ethylene insensitive ein2-5 mutant, by examining the effect of 48 hrs of excision on
DR5:GUS accumulation in wild type and ein2-5, as shown in Figure III-3D. DR5:GUS
(an alternative auxin responsive reporter construct) expression above the site of excision
was enhanced in ein2-5 compared to wild type, suggesting that ethylene insensitivity
increases local auxin expression. These results are consistent with ethylene negatively
regulating auxin transport in hypocotyls, thereby reducing the auxin accumulation above
the site of excision, which drives the formation of adventitious roots.
104
Flavonoids are induced with excision and regulate auxin transport and adventitious root
formation.
Flavonoids have been shown to regulate auxin transport in roots and inflorescence
stems and to be induced with ACC treatment (Brown et al., 2001; Buer et al., 2006). We
tested whether root excision would increase flavonoid accumulation, as visualized by a
confocal laser scanning microscope after staining excised hypocotyls with DPBA
(diphenylboric acid 2-aminoethyl ester), a molecule that fluoresces upon binding to
flavonols. Figure III-4A, B show that excised hypocotyls had flavonoid accumulation at
and near the site of excision, while intact hypocotyls showed minimal DPBA
fluorescence. The accumulation of flavonoids after excision was limited to approximately
1-2 mm above the site of excision. This suggests that flavonoids accumulate below the
position of development of adventitious roots and at locations sufficient to drive auxin
accumulation.
To identify the mechanism for excision induced flavonoid accumulation, we used
qRT-PCR to examine the transcript levels of the gene encoding the first enzyme of
flavonoid synthesis, chalcone synthase (CHS). There was a 2.5-fold increase in CHS
message accumulation in hypocotyls relative to actin, an internal standard, at 6 hrs after
excision, as shown in Figure III-4C. This increase in CHS accumulation at 6 hrs preceded
flavonoid accumulation with excision shown at 18 hrs after root excision. Additionally,
fluorescence of a pCHS::CHS:GFP construct expressed in the tt4-11 background (Lewis
et al., in review), was found to be enhanced at 18 hrs after root excision compared to
intact seedling, as shown in Figure III-4D and E. This further confirms that accumulation
of flavonoids observed using DPBA staining is not due to increased uptake of the stain
105
Hypocotyl CHS transcript
levels, relative to time 0
C
3.5
3.0
2.5
0.0
*
2.0
1.5
1.0
0.5
0 hrs
6 hrs
Induction of adventitious
roots with excision
A
D
E
B
F
12
10
0
106
*
6
WT
Intact
Excised
8
*#
4
2
tt4-2
Figure III-4: Flavonoids are induced with excision and negatively regulates adventitious
root formation.
(A) Tile scan images of DPBA stained intact and root excised hypocotyls, taken using
confocal laser scanning microscope. Arrow head shows predicted position of auxin
accumulation and adventitious root formation. Scale bar is 200µm.
(B) Images of DPBA stained intact and root-excised hypocotyls captured using confocal
laser scanning microscope. Scale bar is 50 µm.
(C) Relative transcript levels of CHS in hypocotyls at the time of excision and 6 hrs later,
quantified using qRT-PCR. Values are compared to wild type by Student’s t-test. * p≤
0.01.
(D) Tile scan images or (E) high magnification image of intact and root excised
hypocotyls of pCHS::CHS:GFP transgenic seedlings captured by a confocal laser
scanning microscope. Channel settings for GFP and chlorophyll were used to separate the
two signals. Scale bars are 250µm (D) and 50 µm (E)
(F) Fold induction of adventitious root formation (n=22-25) in tt4-2 and wild type root
excised seedlings compared to intact seedlings of respective genotype. Average ± SE are
given.
* Indicates significant differences within genotypes as determined by Student’s t-test, p≤
0.01.
# Indicates significant differences between genotypes as determined by Student’s t-test .
p≤ 0.01.
107
through cut ends of the stem, as staining immediately after excision is identical to
staining of intact seedlings (data not shown). The difference between DPBA and CHS
expression is in their localization pattern. While CHS is induced along the whole
hypocotyl, DPBA accumulates at the site of excision, possibly because other enzymes in
the flavonoid pathway have greater spatial localization. Alternatively, intermediates of
this pathway may be mobile, as reported previously (Buer et al., 2007).This suggests
flavonoid accumulation is increased upon excision through the increased synthesis of
enzyme in the flavonoid biosynthetic pathway.
Since flavonoids have been shown to regulate auxin transport and dependent
physiological processes including lateral root formation (Brown et al., 2001; Buer et al.,
2006) and flavonoid accumulation was induced upon excision, we asked if the flavonoid
deficient mutant tt4 had altered adventitious root formation with root excision. 5 day old
tt4-2 seedlings were root excised and were transferred to high light conditions and fold
induction of adventitious roots that emerged seven days later were compared to intact
seedlings within genotype, as shown in Figure III-4F. tt4-2 mutants showed significant 6fold induction of adventitious roots (p< 0.005) upon excision as compared to intact
seedlings. This induction is less than the 10-fold induction seen in wild type. This
suggests that localized flavonoid synthesis is part of the mechanism by which excision
enhances adventitious root formation.
Additionally, we asked if tt4-2 mutants have altered hypocotyl auxin transport
with root excision, when grown under these conditions. Basipetal IAA transport was
measured in hypocotyls of intact and root excised wild type and tt4-2, 48 hrs after
excision. The percentage increase in transport due to excision was compared to intact
108
C
200
Intact
Excised
*
150
#
100
Free IAA levels, ng/gFW
B
50
0
WT
16
#
14
12
10
8
6
4
2
0
Intact
48 hrs
Excised
48 hrs
2.0
D
Col
tt4-2
0 hrs
6 hrs
*
1.5
1.0
0.5
0.0
tt4-2
18
CHS transcript levels
relative to wild type
2.5
250
WT
eto1-1
120
Number of adventitious
roots % of control
% of hypocotyl IAA
transport relative to intact
A
Control
25µM ACC
100
80
*
60
*#
40
20
0
WT
tt4-2
Figure III-5: Ethylene induces flavonoids in hypocotyls and effect of ethylene on
adventitious root formation is partially dependent on flavonoids.
(A) Basipetal hypocotyl IAA transport (n=26-29) in tt4-2 and wild type root excised
seedlings compared to intact seedlings of respective genotype. Average ± SE are given.
* Indicates significant differences within genotypes as determined by Student’s t-test, p≤
0.01.
# Indicates significant differences between genotypes as determined by Student’s t-test .
p≤ 0.01.
109
(B) Free IAA levels quantified using GC-Mass Spec in wild type and tt4-2 seedlings at
the time of excision, and 48 hrs in intact and excised hypocotyls. Average ± SE are given.
Values are compared to untreated (#) by Student’s t-test. p≤ 0.05.
(C) Relative transcript levels of CHS in hypocotyls of wild type and eto1-1 at the time of
excision and 6 hrs later, quantified using qRT-PCR. Values are compared to wild type by
Student’s t-test. * p≤ 0.05.
(D) Adventitious root formation in flavonoid deficient mutant tt4-2 with or without 25
µM ACC treatment, quantified 7 days after root excision. Average ± SE of 31-32
seedlings are given. Values are compared to untreated controls by Student’s t test.
* Indicates significant differences within genotypes as determined by Student’s t-test, p≤
0.05.
# Indicates significant differences between genotypes as determined Student’s t-test p≤
0.005.
110
seedlings within genotype as shown in Figure III-5A. Even though there was a
significantly greater level of basipetal IAA transport in intact hypocotyls of tt4-2
compared to wild type (data not shown), the root excised hypocotyls of tt4-2 did not
exhibit the same magnitude of increase in IAA transport after excision as observed in
wild type (p< 0.005). This result is consistent with the weaker effect of root excision on
adventitious root formation found in tt4-2, as compared to wild-type. These results
suggest a model by which localized flavonoid accumulation blocks auxin efflux from
hypocotyls driving adventitious root formation above the point of excision.
To test if flavonoids alter auxin accumulation in hypocotyls, we measured free
IAA levels in tt4-2 in intact and excised hypocotyls 48 hrs after excision, as shown in
Figure III-5B. There was no difference in the levels of free IAA in tt4-2 compared to wild
type, suggesting that flavonoids may not affect the overall free IAA levels. Although
there was a significant increase in free IAA levels in root excised hypocotyls of tt4-2
compared to intact tt4-2 (p< 0.05), these results do not indicate that flavonoids lead to
global changes in free IAA in hypocotyls, but rather locally inhibit IAA transport leading
to local sites of auxin accumulation.
The ethylene alters flavonoid accumulation after excision
Ethylene increases flavonoid synthesis through induction of transcription of genes
encoding flavonoid enzymes (Lewis et al., in review). Since we saw that ethylene and
flavonoids are induced with excision, we asked if flavonoid accumulation is ethylene
dependent. We examined CHS transcript accumulation in the eto1-1 mutant using qRTPCR. The accumulation of CHS relative to actin was compared in excised seedlings, 6
111
hrs after excision to excised seedlings at 0 time point, as shown in Figure III-5C. eto1-1
had increased CHS accumulation, indicating that increased ethylene production may
increase flavonoid biosynthetic activity.
Ethylene and flavonoids interact in modulating root growth and gravitropism
(Buer et al., 2006). Therefore we asked if flavonoids are necessary for ethylene
inhibition of adventitious roots, by examining the effect of ACC treatment on
adventitious root formation in flavonoid deficient tt4-2 mutants, as shown in Figure III5D. Although ACC treatment reduced slightly, but significantly, the formation of
adventitious roots in root excised tt4-2 hypocotyls (p< 0.05), the magnitude of reduction
was less compared to the ACC-induced reduction in wild type hypocotyls (p< 0.005).
This suggests that tt4-2 is less sensitive to the inhibitory effect of ACC on adventitious
root formation and that ACC may act in part through flavonoid synthesis.
Ethylene decreases ABCB19 protein accumulation
Our previous research has shown that excision increases PIN1 transcription, and
pin1-1 mutants have reduced number of adventitious roots, consistent with PIN1 having a
role in mediating auxin transport required for adventitious root formation (Sukumar and
Muday, in review). We asked if this enhancement of PIN1 transcription is altered in
ethylene mutants to see if that is one cause of altered auxin transport and adventitious
root formation. Transcript levels of PIN1 relative to an internal standard actin, were
measured in eto1-1 seedlings, 6 hrs after excision and compared to wild type, as shown in
supplemental Figure III-S2. There was no difference in the relative transcript levels of
PIN1 between eto1-1 and col. This suggests that ethylene does not affect auxin transport
112
Relative PIN1 transcript levels
S2
2.5
2.0
0 hrs
6 hrs
1.5
1.0
0.5
0.0
Col
eto1-1
Supplemental Figure III-2: Relative transcript levels of CHS in Col and eto1-1
seedlings measured using qRT-PCR
113
through altering transcription of PIN1.
abcb19 mutants have reduced adventitious root formation and
pABCB19::ABCB19:GFP fusion protein accumulation has been shown to increase with
root excision (Sukumar and Muday, in review). We asked if abcb19 mutants are
responsive to ethylene induced reduction of adventitious root formation, to test if
ethylene might affect auxin transport or accumulation through ABCB19. Adventitious
roots formed 7 days after excision were quantified in abcb19 mutants treated with and
without ACC and were compared to wild type, as shown in Figure III-6A. abcb19
mutants were insensitive to ethylene as there was no further reduction in number of
adventitious roots formed with ACC treatment. This suggests that the effect of ACC on
root formation is ABCB19-dependent.
Additionally we tested if ethylene alters pABCB19::ABCB19:GFP protein
accumulation, as our previous experiments have shown that fluorescence of an
ABCB19:GFP fusion protein is enhanced upon excision (Sukumar and Muday, in review).
We examined the effect of ACC treatment on pABCB19::ABCB19:GFP fluorescence
using confocal microscopy, as shown in Figure III-6B. ACC treatment resulted in
significant 30% reduction in pABCB19::ABCB19:GFP fluorescence, 3 days after root
excision (p< 0.05). Furthermore, there was no change in the fluorescence level of
transcriptional construct pABCB19::GFP with and without ACC treatment, suggesting
that ethylene might not affect transcription of ABCB19 consistent with previous
experiments that excision effects on ABCB19 are post transcriptional (data not shown)
(Sukumar and Muday, in review). These results suggest that ethylene reduces ABCB19
protein stability, indicating that ethylene reduction of auxin transport might act through
114
Number of adventitious roots
A
7
Control
25µM ACC
6
5
*
4
#
3
2
1
0
Col
B
Induction of adventitious
roots with excision
C
16
14
12
10
8
6
4
2
0
abcb19
*
Intact
Excised
*#
WT
abcb19
115
Figure III-6: Ethylene regulation of auxin transport proteins mediating auxin transport
required for adventitious root formation.
(A) Adventitious roots formed in Col and abcb19 seedlings treated with 25µM ACC,
quantified 7 days after root excision. Average ± SE of 31-45 seedlings are given. Values
are compared using Student’s t test.
* Indicates significant differences within genotypes as determined by Student’s t-test, p≤
0.005.
# Indicates significant differences between genotypes as determined Student’s t-test p≤
0.005.
(B) Images of pABCB19::ABCB19:GFP with or without 25µM ACC treatment, taken
using confocal microscope after lambda scanning and linear unmixing. Scale bar is 50
µm. Numbers on the image correspond to Average ± SE of relative GFP fluorescence.
(C) Fold induction of adventitious root formation (n=41-60) in abcb19 and wild type
compared to intact seedlings of respective genotype. Average ± SE are given.
* Indicates significant differences within genotypes as determined by Student’s t-test, p≤
0.001.
# Indicates significant differences between genotypes as determined Student’s t-test p≤
0.001.
116
reducing ABCB19 accumulation.
Furthermore, similar to tt4-2 mutants, we find that abcb19 mutants exhibit
reduced induction of adventitious root through root excision, as shown in Figure III-6C.
While wild type had a 12-fold increase in adventitious root formation, abcb19 had
significantly lower 2-fold induction with root excision (p< 0.01). This effect of the
abcb19 mutation is greater in magnitude than in the effect of tt4-2 on root excision
induced adventitious roots. These results indicate that change in ABCB19 protein and
flavonoid accumulation may account for the ethylene effects on auxin transport and
adventitious root formation.
117
Discussion
Although ethylene regulates many aspects of plant development, recent
experiments have demonstrated a role for this hormone in controlling root branching. In
particular, genetic approaches have been used to show that ethylene negatively regulates
lateral root development in Arabidopsis and tomato (Negi et al., 2010; Negi et al., 2008).
Few studies have utilized the tomato ethylene signaling mutant NR to determine that
intrinsic ethylene positively regulates adventitious root formation in tomato (Clark et al.,
1999; Kim et al., 2008). We have identified an opposite and inhibitory role of ethylene in
adventitious root formation in Arabidopsis and have used the genetic tools available in
this species to identify the mechanism by which ethylene modulates this process.
We examined the role of ethylene in regulating adventitious root formation in
Arabidopsis, by using low light grown seedlings with elongated hypocotyls, and inducing
adventitious root formation through root excision, a procedure previously shown to
enhance root formation 10-fold over intact hypocotyls (Sukumar and Muday, in review).
ACC treatment and the eto1-1 mutation reduced the formation of adventitious roots,
while the ethylene insensitive mutants, ein2-5 and etr1-1 had enhanced formation of
adventitious roots. All these changes affected the number of adventitious roots formed
but did not alter the longitudinal position of root formation. Consistent with ethylene not
having an effect on position of formation of adventitious roots, canthardin induced
delocalization of adventitious roots were found to be independent of alteration in ethylene
signaling and synthesis. These results suggest that ethylene negatively regulates the
formation of adventitious roots in Arabidopsis.
118
Ethylene consistently negatively regulates lateral root development in tomato and
Arabidopsis (Negi et al., 2008; Ivanchenko et al., 2008; Negi et al., 2010), but has
variable effect on adventitious root formation in between species (Roy et al., 1972;
Coleman et al., 1980; Nordstrom and Eliasson, 1984; reviwed in De-Klerk et al., 1999;
Clark et al., 1999; Kim et al., 2008). In tomato, ACC treatment enhances adventitious
root formation, while an ethylene insensitive NR mutation reduces the formation of
adventitious roots (Negi et al., 2010), opposite to the effect of ethylene in Arabidopsis.
The positive effect of ethylene on adventitious root development has also been found in
other species of plants such as Rumex, apple, and Vigna (reviewed in De-Klerk et al.,
1999; Riov and Yang, 1989; Visser et al., 1996). The genetic basis of these species
differences in effect of ethylene may be tied to differences in plant shoot architecture or
other aspects of their growth and developmental programs or environmental responses.
Previous research has revealed a positive role for auxin during the development of
adventitious roots in Arabidopsis, as the ago (argonaute) and sur (superroot) mutants
have altered adventitious root formation caused by altered auxin signaling and synthesis
(Sorin et al., 2005; Gutierrez et al., 2009). In particular, root excision enhances auxin
transport and local auxin accumulation which drives adventitious root formation
(Sukumar and Muday, in review). Previous experiments indicate that ethylene regulates
auxin transport and signaling (Rahman et al., 2002; Buer et al., 2006; Muday et al., 2006;
Negi et al., 2008). We examined the effect of ethylene on auxin transport and local auxin
accumulation and found that both were reduced by ethylene. Ethylene insensitive
mutants have enhanced auxin transport and local auxin accumulation above the site of
excision, while ethylene overproduction in the eto1-1 mutant resulted in reduced auxin
119
transport. These results suggest that ethylene alters adventitious root in Arabidopsis
formation through modulation of auxin transport and accumulation.
Involvement of auxin-ethylene crosstalk in adventitious root formation has been
explored in agriculturally important species such as tomato, with results that differ from
Arabidopsis in several ways. In tomato, the ethylene insensitive mutation, NR, and silver
nitrate treatments that confer ethylene insensitivity result in enhanced transport, while
ACC treatments result in reduction of auxin transport in hypocotyls (Negi et al., 2010),
similar to Arabidopsis. This is consistent with the negative effect of ACC on auxin
transport, found in pea stems (Suttle, 1988). No overall effect on auxin accumulation was
found in tomato hypocotyls with ACC treatment, similar to Arabidopsis. Moreover
ethylene insensitivity reduced the ability of plants to respond to exogenous IAA, with
these mutants never forming as many adventitious roots as wild type. However, ethylene
modulated increases in auxin sensitivity were found to regulate adventitious root
formation in Rumex under flooded conditions (Visser et al., 1996). This effect of
ethylene was reduced if the plants were treated with NPA, an auxin transport inhibitor,
suggesting a positive relation between ethylene and auxin transport in this species (Visser
et al., 1996). Conversely, auxin induced ethylene synthesis was found to enhance
adventitious root formation in Vigna (Riov and Yang, 1989). These results indicate that
auxin-ethylene cross talk follows a complex pattern with mutual regulation and in a
species specific manner.
We explored the mechanisms by which ethylene might regulate auxin transport.
The ABCB19 auxin efflux carrier was shown to be required for both the inhibition of
adventitious root formation by ACC and the stimulation of root formation by shoot
120
excision. An pABCB19::ABCB19:GFP fusion protein was found to accumulate at
reduced levels after ACC treatment. This suggests that one possible mechanism by which
ethylene might alter auxin transport and subsequent local auxin accumulation required for
adventitious root formation is through modulating accumulation of the auxin transport
protein ABCB19. Additionally, root excision was found to enhance localized
accumulation of flavonoids at and above the site of excision, at positions of the local
accumulation of auxin and the formation of adventitious roots. This indicates that
flavonoid accumulation at these positions might block auxin movement, resulting in
accumulation of auxin. The absence of flavonoids in tt4-2 was associated with reduced
sensitivity to excision enhanced adventitious roots and auxin transport. The adventitious
root formation in tt4-2 was found to be partially ethylene insensitive. In contrast, eto1-1,
had enhanced expression of the flavonoid biosynthetic enzyme, CHS, and reduced
formation of adventitious roots, suggesting that global and local flavonoid accumulation
along the hypocotyls may have different effects. Consistent with this, tt4-2 hypocotyls
have enhanced adventitious root formation, possibly due to its enhanced auxin transport,
compared to wild type seedlings. This suggests flavonoids can differentially affect the
development of adventitious roots, and ethylene might be involved in the regulating
flavonoid accumulation.
An interesting possibility is that flavonoids act on ABCB19. Consistent with this
idea that flavonoids might interact with ABCB19, several studies have examined the
interaction of auxin efflux proteins with flavonoids. tt4 mutants have defective
localization of auxin transport protein PIN1 (Peer et al., 2004). Additionally, the faster
gravity response in abcb4 mutant was found to be epistatic to the delayed gravity
121
response in the tt4 mutant, suggesting that flavonoids might act on ABCB4 (Lewis et al.,
2007). In HeLa cell culture expressing AtPGP1 (ABCB1), quercetin, one of the active
flavonoids known to regulate auxin transport, was found to reduce IAA efflux (Geisler et
al., 2005). These results provide evidence that flavonoids can interact with auxin
transport proteins, especially on ABCBs. We have found that abcb19 mutants have
insensitivity to excision induced adventitious root formation similar to tt4-2. Additionally,
adventitious root formation in the abcb19 mutant is insensitive to ACC. This indicates a
possible mechanism by which ethylene regulated flavonoids interact with ABCB19, in
turn modulating auxin transport necessary for adventitious root formation.
Together, our results implicate ethylene-auxin crosstalk in regulating adventitious
root formation in Arabidopsis. Ethylene negatively regulates auxin transport, and local
auxin accumulation, both of which mediate formation of adventitious roots. The ability of
IAA to induce adventitious roots was found to be ethylene sensitive, with ACC
treatments reducing, while ethylene insensitivity enhancing IAA induction of
adventitious roots. Moreover, ethylene reduced ABCB19 accumulation, and increased
flavonoid synthesis, uncovering two mechanisms by which ethylene negatively regulates
auxin transport in hypocotyls. Together these results identify hormonal cross talk which
regulates adventitious root formation with ethylene inhibiting auxin transport and thereby
reducing the formation of adventitious roots.
122
Methods
Plant materials and chemicals
Columbia, and Wassilewskija ecotypes were used in this study. Seeds of abcb19,
pABCB19::GFP, and pABCB19::ABCB19:GFP were kindly provided by Guosheng Wu
and Edgar Spalding (Wu et al., 2007). ein2-5 DR5:GUS, and eto1-1 were provided by
Jose Alonso (Stepanova et al., 2007). ctr1-1 was provided by Joe Kieber (Kieber et al.,
1993). pCHS::CHS:GFP was provided by Brenda Winkel (Lewis et al., in review). All
the other mutants were received from the ABRC stock center.
IAA was purchased from MP Biochemicals (Solon, Ohio). [3H]IAA (24 and 20 Ci
mmol–1) was purchased from Amersham or American Radiolabeled Chemicals (St Louis,
MO). NPA was purchased from Chemical Services (West Chester, PA). 5 Bromo-4
chloro-3 indoyl-β-D-Glu UA cyclohexylamine salt was purchased from Gold
biotechnology (St Louis, MO). RNeasy kit for isolation of RNA was purchased from
Qiagen (Valencia, CA). Components of RNAse treatment, and cDNA synthesis were
purchased from Invitrogen (Carlsbad, CA). Reagents for DNAse treatment was purchased
from Promega (Madison, Wisconsin). SYBRgreen reagent was purchased from Applied
Biosystems (Foster City, CA). All other chemicals were purchased from Sigma (St Louis,
MO).
Plant growth conditions and quantification of adventitious roots
Seeds were sterilized by soaking in 95% ethanol (v/v) and 20% bleach (v/v) with
10% Triton X-100(v/v) for 5 min each and then washed five times with sterilized water.
Seeds were then plated in sterile agar medium containing 0.8% (w/v) Type M agar (A-
123
4800, Sigma), 1× MS nutrients (macro and micro salts), vitamins (1 µg⋅mL−1 thiamine, 1
µg⋅mL−1 pyridoxine HCl, and 0.5 µg⋅mL−1 nicotinic acid), 1.5% (w/v) sucrose, 0.05%
(w/v) MES, with pH adjusted to 5.8 with 1N KOH before autoclaving. Plates were placed
in racks in a vertical orientation under light intensity of 3-5µmol m–2 s–1 for 5 days to
induce hypocotyl elongation.
Five day old low light grown seedlings were used in the experiments with or
without excision using Neuro clipper scissors (Fine Science Tools) at a position 5-7.5
mm from shoot apex excision. They were allowed to grow for 7 more days under a light
intensity of 85-100 µmol m–2 s–1. Adventitious roots were quantified on the 7th day unless
otherwise indicated using a dissecting microscope.
Applications of IAA, IBA, ACC, and canthardin
Stocks of IAA and IBA were made in ethanol while canthardin was made in
DMSO at 10 mM. ACC was dissolved in water to make a 10 mM stock. For global
treatment, chemicals were added to the agar growth medium cooled to 50o C at indicated
concentrations. All experiments involving IAA and IBA treatments were placed under
fluorescent lights with yellow filters to prevent white light induced degradation of IAA
(Stasinopoulos and Hangarter, 1989). Observations on position and number of emerged
adventitious roots were performed after 7 days using a dissecting microscope.
β –Glucuronidase staining
DR5:GUS transgenic seedlings were incubated in 2 mM GUS substrate (100 mM
sodium phosphate buffer, 0.5% Triton X, 2 mM X-gluc salt, 0.5 mM ferricyanide and 0.5
124
mM ferrocyanide) at 37o C for overnight. Samples were then washed with 100 mM
sodium phosphate buffer, pH 7 and stored in 95% ethanol. The samples were fixed and
cleared as mentioned below, and analyzed for localization of GUS staining using an EpiFluorescent Leica MZ16 FA stereomicroscope.
Fixing and clearing
Seedlings were fixed in a solution containing 10% (v/v) formaldehyde, 5% (v/v)
acetic acid and 50% (v/v) ethanol, overnight at 4 0C. Then clearing was performed using
chloral hydrate:glycerol:water solution (8:1:2, w:v:v), at room temperature (Fukaki et al.,
1998). Cleared seedlings were mounted in 95% ethanol and visualized using an EpiFluorescent Leica MZ16 FA stereomicroscope.
DPBA staining
Root excised or intact seedlings were incubated for 7 min in a solution with
0.25% DPBA (w/v) and 0.005% TritonX-100 (v/v). The seedlings were then washed with
deionized water for an additional 7 min, were mounted in deionized water and analyzed
using Zeiss LSM710 Meta fluorescence laser scanning confocal microscope using two
channels; 460-504 nm (to capture Kaempferol fluorescence), 577-619 nm (to capture
quercetin fluorescence) with laser at 458 nm (Lewis et al., in review). Tiled images were
taken with three vertical and seven horizontal sections using the above mentioned
channel settings. All pictures within an experiment were taken under similar settings.
pABCB19::ABCB19:GFP imaging and quantification
125
GFP fluorescence was observed using Zeiss LSM710 Meta fluorescence laser
scanning confocal microscope using lambda scanning at 494-649nm, using 488nm laser,
with samples mounted in deionized water. Chloroplast, and GFP signals were separated
using linear unmixing using reference spectra. Quantification of GFP signals were
performed using linear profiles through the longitudinal sides of the cells using the Zeiss
Zen software. All pictures within an experiment were taken under similar settings, unless
indicated otherwise.
pCHS::CHS:GFP imaging
Low light grown transgenic seedlings were transferred to high light conditions
with or without excision for 18 hrs. GFP fluorescence was observed using Zeiss LSM710
laser scanning confocal microscope using channel setting with 488 nm laser, with
samples mounted in deionized water. Two channels, 493-556nm and 637-721 nm, were
used to separate GFP, and chloroplast signals, respectively. All pictures within an
experiment were taken under identical laser, gain, and pinhole settings.
Auxin transport and free IAA measurements in hypocotyl
Auxin transport measurements in the hypocotyls were performed by modifying a
previously published method (reviewed in Lewis and Muday, 2009). 5 day old low light
grown seedlings; either intact or excised, were transferred to control plates and their
shoot apex were removed. An agar cylinder or agar droplets with tritiated IAA with
approximate concentration of 100 nM was applied at the shoot end and incubated in the
dark for 3 hrs. 3mm sections were removed from the basal end from the excised
126
hypocotyls, after 3 hrs and were used for quantification using a Beckman LS 6500
scintillation counter.
For quantification of free IAA levels, 5 day old low light seedlings were
transferred to high light conditions with or without excision, and hypocotyl tissues were
harvested at indicated time points and frozen in liquid nitrogen. About 50-80 mg of
frozen tissues were homogenized using 150µl of homogenization buffer (65%
isopropanol, 35% 0.2 M imidazole, pH 7), incubated with internal standard (13C6)- IAA,
followed by centrifugation at 10,000 g for 8 min. Free IAA was extracted by running
through two automated successive columns followed by methylation, drying and
redissolving in ethyl acetate (Barkwai et al, 2008). Quantification was done using GCSIM-MS through isotope dilution analysis and values are reported relative to fresh weight
(ng/g).
RNA extraction and Quantitative Real time PCR measurements
Low light grown seedlings were transferred to high light conditions for 6hrs.
Hypocotyl tissues (for Figure 4C) or whole seedlings (for Figure 5D) were frozen in
liquid nitrogen. As controls, intact seedlings were excised and were frozen immediately.
Total RNA was isolated using Qiagen plant RNeasy kit, after homogenization of tissue
samples with a Power-drill equipped with a disposable mortar. DNAase treatments were
performed and RNA samples were equilibrated. cDNA reactions were performed
followed by RNAse treatment. cDNA samples were run in 96 well plate in a real time
PCR machine (Applied Biosystems 7600-fast thermal cycler) using target specific
primers, deionized water, and SYBR green reagent. Transcript levels relative to actin
127
were calculated using a standard curve. The primers used were CHS-Forward:
CGTGTTGAGCGAGTATGGAAAC, Reverse:
TGACTTCCTCCTCCTCATCTCGTCTAGT, ABCB19- Forward:
CAGGAAATGGTTGGTACTCGAGAT, Reverse: GAATGGCTCAAACGGGTT.
PIN1-Forward: ATCACCTGGTCCCTCATTTC, Reverse:
CCATGAACAACCCAAGACTG. Actin-Forward:
TGAGAGATTCAGATGCCCAGAA, Reverse: GCAGCTTCCATTCCCACAA.
Acknowledgements
We appreciate Sangeeta Negi and Hanya Chrispeels for their thoughtful comments. We
thank Jose Alonso, Joe Kieber, Brenda Winkel, and Edgar Spalding for sharing mutant
and transgenic Arabidopsis seeds. We appreciate the microscopy assistance of Anita
McCauley. We appreciate the assistance of Jerry Cohen and Xing Liu with free IAA
measurements.
128
Literature cited
Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a
bifunctional transducer of ethylene and stress responses in Arabidopsis. Science
284: 2148-2152
Argueso CT, Hansen M, Kieber JJ (2007) Regulation of ethylene biosynthesis. Journal
of Plant Growth Regulation 26: 92-105
Bleecker A, Estelle M, Magidin M, Somerville C, Kende H (1988) Insensitivity to
ethylene conferred by a dominant mutation in Arabidopsis thaliana. Science 241:
1086-1089
Bleecker AB, Estelle MA, Somerville C, Kende H (1988) Insensitivity to Ethylene
Conferred by a Dominant Mutation in Arabidopsis-Thaliana. Science 241: 10861089
Bleecker AB, Kende H (2000) Ethylene: A gaseous signal molecule in plants. Annual
Review of Cell and Developmental Biology 16: 1-+
Brown D, Rashotte A, Murphy A, Tague B, Peer W, Taiz L, Muday G (2001)
Flavonoids act as negative regulators of auxin transport in vivo in Arabidopsis
thaliana. Plant Physiol 126: 524-535
Buer CS, Muday GK (2004) The transparent testa4 mutation prevents flavonoid
synthesis and alters auxin transport and the response of Arabidopsis roots to
gravity and light. Plant Cell 16: 1191-1205
Buer CS, Muday GK, Djordjevic MA (2007) Flavonoids are differentially taken up and
transported long distances in Arabidopsis. Plant Physiology 145: 478-490
129
Buer CS, Sukumar P, Muday GK (2006) Ethylene modulates flavonoid accumulation
and gravitropic responses in roots of Arabidopsis. Plant Physiology 140: 13841396
Chae HS, Faure F, Kieber JJ (2003) The eto1, eto2, and eto3 mutations and cytokinin
treatment increase ethylene biosynthesis in Arabidopsis by increasing the stability
of ACS protein. Plant Cell 15: 545-559
Chao QM, Rothenberg M, Solano R, Roman G, Terzaghi W, Ecker JR (1997)
Activation of the ethylene gas response pathway in Arabidopsis by the nuclear
protein ETHYLENE-INSENSITIVE3 and related proteins. Cell 89: 1133-1144
Clark DG, Gubrium EK, Barrett JE, Nell TA, Klee HJ (1999) Root formation in
ethylene-insensitive plants. Plant Physiol 121: 53-60
Coleman W, Huxter T, Reid D, Thrope T (1980) Ethylene as an endogenous inhibitor
of root regeneration in tomato leaf disc cultures in vitro. Physiol Plant 48: 519525
Collett CE, Harberd NP, Leyser O (2000) Hormonal interactions in the control of
Arabidopsis hypocotyl elongation. Plant Physiology 124: 553-561
De-Klerk G, Krieken W, DeJong J (1999) The formation of adventitious roots: New
concepts, new possibilities. In Vitro Cell Dev Biol-Plant 35: 189-199
Fukaki H, Wysocka-Diller J, Kato T, Fujisawa H, Benfey PN, Tasaka M (1998)
Genetic evidence that the endodermis is essential for shoot gravitropism in
Arabidopsis thaliana. Plant J 14: 425-430
Geisler M, Blakeslee JJ, Bouchard R, Lee OR, Vincenzetti V, Bandyopadhyay A,
Titapiwatanakun B, Peer WA, Bailly A, Richards EL, Ejenda KFK, Smith
130
AP, Baroux C, Grossniklaus U, Muller A, Hrycyna CA, Dudler R, Murphy
AS, Martinoia E (2005) Cellular efflux of auxin catalyzed by the Arabidopsis
MDR/PGP transporter AtPGP1. Plant Journal 44: 179-194
Gutierrez L, Bussell JD, Pacurar DI, Schwambach J, Pacurar M, Bellini C (2009)
Phenotypic Plasticity of Adventitious Rooting in Arabidopsis Is Controlled by
Complex Regulation of AUXIN RESPONSE FACTOR Transcripts and
MicroRNA Abundance. Plant Cell 21: 3119-3132
Ivanchenko MG, Muday GK, Dubrovsky JG (2008) Ethylene-auxin interactions
regulate lateral root initiation and emergence in Arabidopsis thaliana. Plant J 55:
335-347
Kieber JJ (1997) The ethylene signal transduction pathway in Arabidopsis. Journal of
Experimental Botany 48: 211-218
Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR (1993) CTR1, a
negative regulator of the ethylene response pathway in Arabidopsis, encodes a
member of the Raf family of protein kinases. Cell 72: 427-441
Kim HJ, Lynch JP, Brown KM (2008) Ethylene insensitivity impedes a subset of
responses to phosphorus deficiency in tomato and petunia. Plant Cell Environ 31:
1744-1755
Knee E, Hangarter R, Knee M (2000) Interactions of light and ethylene in hypocotyl
hook maintenance in Arabidopsis thaliana seedlings. Physiol. Plant.: 208-215
Lewis DR, Miller ND, Splitt BL, Wu GS, Spalding EP (2007) Separating the roles of
acropetal and basipetal auxin transport on gravitropism with mutations in two
131
Arabidopsis Multidrug Resistance-Like ABC transporter genes. Plant Cell 19:
1838-1850
Lewis DR, Muday GK (2009) Measurement of auxin transport in Arabidopsis thaliana.
Nat Protoc 4: 437-451
Lewis DR, Ramirez MV, Miller ND, Winkel BSJ, Muday GK (in review) Auxin and
ethylene induce distinct flavonol accumulation patterns through independent
transcriptional networks Plant Cell
Li S, Xue L, Xu S, Feng H, An L (2009) Mediators, Genes and signaling in
Adventitious rooting. Bot.Rev 75: 230-247
Muday GK, Brady SR, Argueso C, Deruere J, Kieber JJ, DeLong A (2006) RCN1regulated phosphatase activity and EIN2 modulate hypocotyl gravitropism by a
mechanism that does not require ethylene signaling. Plant Physiol 141: 16171629
Negi S, Ivanchenko MG, Muday GK (2008) Ethylene regulates lateral root formation
and auxin transport in Arabidopsis thaliana. Plant J 55: 175-187
Negi S, Sukumar P, Liu X, Cohen JD, Muday GK (2010) Genetic dissection of the
role of ethylene in regulating auxin-dependent lateral and adventitious root
formation in tomato. Plant J 61: 3-15
Nordstrom A-C, Eliasson L (1984) Regulation of root formation by auxin-ethylene
interaction in pea stem cuttings. Physiol Plant 61: 298-302
Peer WA, Bandyopadhyay A, Blakeslee JJ, Makam SI, Chen RJ, Masson PH,
Murphy AS (2004) Variation in expression and protein localization of the PIN
132
family of auxin efflux facilitator proteins in flavonoid mutants with altered auxin
transport in Arabidopsis thaliana. Plant Cell 16: 1898-1911
Potuschak T, Lechner E, Parmentier Y, Yanagisawa S, Grava S, Koncz C, Genschik
P (2003) EIN3-dependent regulation of plant ethylene hormone signaling by two
Arabidopsis F box proteins: EBF1 and EBF2. Cell 115: 679-689
Poupart J, Rashotte AM, Muday GK, Waddell CS (2005) The rib1 mutant of
Arabidopsis has alterations in indole-3-butyric acid transport, hypocotyl
elongation, and root architecture. Plant Physiology 139: 1460-1471
Rahman A, Amakawa T, Goto N, Tsurumi S (2001) Auxin is a positive regulator for
ethylene-mediated response in the growth of Arabidopsis roots. Plant Cell Physiol
42: 301-307
Rahman A, Hosokawa S, Oono Y, Amakawa T, Goto N, Tsurumi S (2002) Auxin and
ethylene response interactions during Arabidopsis root hair development dissected
by auxin influx modulators. Plant Physiol 130: 1908-1917
Rashotte AM, Poupart J, Waddell CS, Muday GK (2005) Transport of the two natural
auxins, indole-3-butyric acid and indole-3-acetic acid, in Arabidopsis (vol 133, pg
761, 2005). Plant Physiology 139: 559-559
Riov J, Yang S (1989) Ethylene and Auxin-ethylene interaction in adventiitous root
formation in Mung bean (Vigna radiata) cuttings. Journal of Plant Growth
Regulation 8: 131-141
Roy B, Basu R, Bose T (1972) Interaction of auxins with growth-retarding, -inhibiting
and ethylene-producing chemicals in rooting of cuttings. Plant Cell Physiol 13:
1123-1127
133
Ruzicka K, Ljung K, Vanneste S, Podhorska R, Beeckman T, Friml J, Benkova E
(2007) Ethylene regulates root growth through effects on auxin biosynthesis and
transport-dependent auxin distribution. Plant Cell 19: 2197-2212
Smalle J, Haegman M, Kurepa J, VanMontagu M, VanderStraeten D (1997)
Ethylene can stimulate Arabidopsis hypocotyl elongation in the light. Proceedings
of the National Academy of Sciences of the United States of America 94: 27562761
Sorin C, Bussell JD, Camus I, Ljung K, Kowalczyk M, Geiss G, McKhann H,
Garcion C, Vaucheret H, Sandberg G, Bellini C (2005) Auxin and light control
of adventitious rooting in Arabidopsis require ARGONAUTE1. Plant Cell 17:
1343-1359
Stasinopoulos TC, Hangarter RP (1989) Preventing photochemistry in culture media
by long-pass light filters alters growth of cultured tissues. Plant Physiol 93: 13651369
Stepanova AN, Hoyt JM, Hamilton AA, Alonso JM (2005) A link between ethylene
and auxin uncovered by the characterization of two root-specific ethyleneinsensitive mutants in Arabidopsis. Plant Cell 17: 2230-2242
Stepanova AN, Yun J, Likhacheva AV, Alonso JM (2007) Multilevel interactions
between ethylene and auxin in Arabidopsis roots. Plant Cell 19: 2169-2185
Strader LC, Bartel B (2009) The Arabidopsis PLEIOTROPIC DRUG
RESISTANCE8/ABCG36 ATP Binding Cassette Transporter Modulates
Sensitivity to the Auxin Precursor Indole-3-Butyric Acid. Plant Cell 21: 19922007
134
Sukumar P, Muday GK (in review) Polar auxin transport mediated by ABCB19 and
PIN1 regulate adventitious root formation in Arabidopsis. Plant Physiol
Suttle JC (1988) Effect of ethylene treatment on polar IAA transport, net IAA uptake
and specific binding of N-1-naphthylphthalamic acid in tissues and microsomes
isolated from etiolated pea epicotyls. Plant Physiol. 88: 795-799
Swarup R, Perry P, Hagenbeek D, Van Der Straeten D, Beemster GT, Sandberg G,
Bhalerao R, Ljung K, Bennett MJ (2007) Ethylene upregulates auxin
biosynthesis in Arabidopsis seedlings to enhance inhibition of root cell elongation.
Plant Cell 19: 2186-2196
Visser E, Cohen JD, Barendse G, Blom C, Voesenek L (1996) An Ethylene-Mediated
Increase in Sensitivity to Auxin Induces Adventitious Root Formation in Flooded
Rumex palustris Sm. Plant Physiol 112: 1687-1692
Woodward AW, Bartel B (2005) Auxin: Regulation, action, and interaction. Annals of
Botany 95: 707-735
Wu G, Lewis DR, Spalding EP (2007) Mutations in Arabidopsis multidrug resistancelike ABC transporters separate the roles of acropetal and basipetal auxin transport
in lateral root development. Plant Cell 19: 1826-1837
135
CHAPTER IV
GENETIC DISSECTION OF THE ROLE OF ETHYLENE IN REGULATING AUXINDEPENDENT LATERAL AND ADVENTITIOUS ROOT FORMATION IN TOMATO
Negi S., Sukumar P., Liu X., Cohen J.D., Muday G.K.
The following manuscript was published in Plant Journal, volume 61, pages 3-15, 2010
and is reprinted with permission (license number 2391251257171). Stylistic variations
are due to the requirements of the journal. Negi S., and Sukumar P. have co-first
authorship and Muday G.K. is the corresponding author.
136
Abstract
In this study we investigated the role of ethylene in lateral and adventitious root
formation in tomato (Solanum lycopersicum) using mutants isolated for altered ethylene
signaling and fruit ripening. Mutations that block ethylene responses and delay ripening:
Nr (Never ripe), gr (green ripe), nor (non ripening), and rin (ripening inhibitor) have
enhanced lateral root formation. In contrast, the epi (epinastic) mutant, which has
elevated ethylene and constitutive ethylene signaling in some tissues, or treatment with
the ethylene precursor (ACC), reduces lateral root formation. ACC treatment inhibits
initiation and elongation of lateral roots, except in the Nr genotype. Root basipetal and
acropetal IAA transport increase with ACC treatments or in the epi mutant, while in the
Nr mutant there is less auxin transport than wild type and transport is insensitive to ACC.
In contrast, the process of adventitious root formation shows the opposite response to
ethylene, with ACC treatment and the epi mutation increasing adventitious root formation
and the Nr mutation reducing the numbers of adventitious roots. In hypocotyls, ACC
treatment negatively regulated IAA transport while the Nr mutant showed increased IAA
transport in hypocotyls. Ethylene significantly reduces free IAA content in roots, but
only subtly changes free IAA content in tomato hypocotyls. These results indicate a
negative role of ethylene in lateral root formation and a positive role in adventitious root
formation with modulation of auxin transport as a central point of ethylene-auxin
crosstalk.
137
Introduction
Development of lateral and adventitious roots are highly plastic processes, which are
sensitive to nutrients, moisture, and other environmental parameters, with plant hormones
acting as one important signaling mechanism to control these processes (Malamy and
Ryan, 2001; Li et al., 2009). Primary roots form in the embryo and emerge from seeds
during germination. As roots mature, quiescent cells within their pericycle layer begin
dividing and form lateral root primordia via a precise series of divisions, which are best
characterized in Arabidopsis (Malamy and Benfey, 1997). Ultimately, the lateral root
elongates and undergoes further reiterative branching. Additionally, when shoot tissues of
many plant species contact the soil, they can undergo an intriguing, but poorly
characterized process, by which shoot tissues differentiate to form adventitious roots.
Plant propagation relies heavily on the ability of shoot cuttings to effectively generate
adventitious roots, yet there is dramatic variation between species in the propensity to
form adventitious roots (De Klerk et al., 1999) and little molecular information on this
important developmental process.
Auxin positively regulates both lateral and adventitious root formation in most plant
species. Elevated endogenous or exogenous concentrations of auxin increase
adventitious and lateral root formation (Torrey, 1976; Sitbon et al., 1992; Boerjan et al.,
1995), while reductions in auxin signaling or transport, due to either mutations or
inhibitors, reduce both lateral and adventitious root initiation and elongation (Reed et al.,
1998; Casimiro et al., 2001; Laskowski et al., 2008). Auxin and lateral root development
have been extensively studied in Arabidopsis (Malamy, 2009), with only a few papers
examining the mechanism for auxin’s induction of adventitious root formation in this
138
model species (Ludwig-Muller et al., 2005; Sorin et al., 2005; Sorin et al., 2006; Li et al.,
2009). A limited number of studies have examined root development in tomato (Muday
and Haworth, 1994; Clark et al., 1999; Tyburski and Tretyn, 2004; Ivanchenko et al.,
2006). In tomato, auxin increases lateral (Muday and Haworth, 1994; Muday et al., 1995;
Ivanchenko et al., 2006) and adventitious root growth (Clark et al., 1999; Tyburski and
Tretyn, 2004), while auxin-transport inhibitors reduce formation of both root types
(Muday and Haworth, 1994; Tyburski and Tretyn, 2004). In the auxin-insensitive
diageotropic (dgt) mutant, lateral root development is completely inhibited (Muday et al.,
1995; Ivanchenko et al., 2006). Together, these reports suggest that auxin and auxin
transport may modulate root development in similar ways in both tomato and Arabidopsis.
Recent studies in Arabidopsis have also identified a role for the gaseous plant
hormone ethylene in lateral root formation, utilizing the diversity of mutants with altered
ethylene signaling or synthesis (Negi et al., 2008, Ivanchenko et al., 2008). The ctr1
mutant, with enhanced ethylene signaling (Kieber et al., 1993; Huang et al., 2003), and
the eto1 mutant, with enhanced ethylene synthesis (Guzman and Ecker, 1990; Kieber et
al., 1993), exhibited significant reductions in lateral root numbers, compared to wild type.
Additionally, treatment with ethylene or the ethylene precursor, 1-aminocyclopropane
carboxylic acid (ACC) reduced lateral root formation (Negi et al., 2008). In contrast the
ethylene insensitive mutants etr1, which has a dominant negative receptor mutation (Hua
et al., 1998; Sakai et al., 1998) and ein2, which has a defect in an ethylene signaling
protein (Kendrick and Chang, 2008), showed enhanced lateral root formation which were
insensitive to ACC treatment (Negi et al., 2008). These ethylene effects are on the earliest
stages of lateral root initiation (Ivanchenko et al., 2008) and alter auxin transport,
139
suggesting that cross talk with auxin is a critical component of the activity of ethylene in
lateral root development (Negi et al., 2008).
In tomato, genetic approaches have identified a number of mutants which have
defects in ethylene signaling and fruit ripening (Klee, 2004; Barry and Giovannoni, 2007;
Kendrick and Chang, 2008). The Never-ripe (Nr) gene was cloned using a candidate
gene approach, as NR exhibits sequence similarity to the Arabidopsis ETR1 gene (Yen et
al., 1995; Wilkinson et al., 1995) and is part of the LeETR1-6 gene family (Klee, 2004;
Barry and Giovannoni, 2007; Kendrick and Chang, 2008). Another ethylene signaling
mutant with a ripening phenotype is green ripe (gr), a dominant gain-of-function mutant,
which exerts its effect by ectopic expression of the GR gene, an ortholog of the
Arabidopsis RTE1 gene (Barry and Giovannoni, 2006; Resnick et al., 2006; Kendrick and
Chang, 2008). Additional tomato fruit ripening mutants include ripening-inhibitor (rin),
and non- ripening (nor) (Barry and Giovannoni, 2006). The identity of the NOR gene has
not yet been published, but it has been suggested to function upstream of the ethylene
signaling pathway (Lincoln and Fischer, 1988; Yokotani et al., 2004). The RIN locus
encodes a MADS-Box transcription factor (Vrebalov et al., 2002) that regulates
expression of genes including LeACS2, which encodes ACC synthase (Ito et al., 2008),
suggesting that the rin mutation alters ethylene synthesis, but may also affect other
aspects of ripening. The epi (epinastic) mutant was isolated on the basis of severe leaf
epinasty and exhibits an enhanced triple response in the absence of ethylene and has
elevated ethylene levels in some tissues (Fujino et al., 1988; Barry et al., 2001).
Although the molecular defect in the epi mutant is not known, it does not share a map
position with the tomato CTR1 ortholog (Barry et al., 2001). epi does not demonstrate a
140
global constitutive ethylene response, but shows altered phenotypes in a subset of
ethylene responsive tissues (Barry et al., 2001).
The role of ethylene in adventitious root formation has been examined in a
variety of plant species, but the results have been contradictory (Robbins et al., 1983;
Geneve and Heuser, 1983). In tomato there have been reports of a positive effect of
ethylene on adventitious root formation (Hitchcock and Zimmerman, 1940; Roy et al.,
1972; Phatak et al., 1981) and negative effects (Coleman et al., 1980). These
contradictory findings may be due to variation in the different tissues, growth conditions,
and methods of quantifying adventitious root formation.
In this study we explored the role of ethylene in lateral and adventitious root
formation in tomato. Few studies have employed a genetic approach to examine the role
of these tomato ethylene signaling mutants in processes beyond fruit ripening and triple
response. Exceptions include evidence that the Green ripe mutant showed reduced
ethylene sensitivity in root elongation (Barry and Giovannoni, 2006), while cuttings of
mature stems of the Nr mutant grown in soil have altered adventitious root formation
(Clark et al., 1999; Kim et al., 2008). The gene expression patterns of tomato ethylene
receptors at distinct developmental stages have been reported (Lashbrook et al., 1998;
Ciardi et al., 2001; Tieman and Klee, 1999), suggesting that ethylene signaling occurs in
a diversity of tissues. We utilized a series of mutants with altered ethylene signaling and
fruit ripening combined with treatments with the ethylene precursor, ACC, to raise
ethylene levels. Lateral root formation is negatively regulated by ethylene, while
adventitious root formation is positively regulated. We also examined the effect of
ethylene on free IAA levels in these plants and examined the effect of ethylene on auxin
141
transport in the primary root and hypocotyl. These results provide insight into the
mechanistic basis of ethylene regulated root formation and the cross talk between auxin
and ethylene in control of adventitious and lateral root formation. This study broadens the
current understanding of the genetic controls of ethylene signaling that regulate root
architecture and extends our understanding of this process beyond Arabidopsis into a
second agriculturally important species.
142
Results
Ethylene insensitive mutants exhibit enhanced lateral root formation
We examined mutants defective in ethylene signaling and fruit ripening to ask if
ethylene modulates root formation in tomato. Root elongation and lateral root formation
in the Never ripe mutant (Nr) in two different backgrounds was compared to parental
wild-type lines: Pearson (P) and Ailsa Craig (AC). Seedlings were grown along the
surface of agar media for 8 days after sowing (Figure IV-1a-c). Both Nr mutants formed
more lateral roots than the appropriate wild type with statistically significant 1.4-fold
enhanced numbers (P<0.005). We quantified root biomass of seedlings grown in soil for
15 days and Nr showed 2.6-fold enhanced root biomass compared to Pearson (P<0.0005)
(Figure IV-1e-f).
The root phenotype of other fruit ripening mutants; gr, nor, and rin, are also
shown in Figure 1a. All three mutants exhibit a 1.4-fold statistically significant increase
in number of lateral roots (Figure IV-1d; P<0.005). This enhanced root branching of
these mutants is not tied to increases in hypocotyl or leaf growth, as is evident in Figure
1a. The altered lateral root developmental patterns of Nr, gr, rin and nor all suggest that
these gene products function in roots or that they control the long distance transmission
of signals, such as ethylene, to the roots. The known activities of Nr, gr, and rin in
regulating ethylene signaling or synthesis, suggest a negative role of ethylene in lateral
root formation.
Elevated ethylene levels inhibit lateral root formation
143
(a)
P
Nr (P)
(b)
P
Nr (P) AC Nr(AC) VFN8 VFN8
1 µM
AC Nr(AC) VFN8 epi
1 µM
1 µM
(d)
20
*
*
*
*
20
15
nor
0.5 µM
25
*
gr
30
Number of lateral roots
Number of lateral roots
(c)
25
1 µM
1 µM
rin
*
15
*
10
5
0
P Nr
AC Nr
VFN8epi
(f)
Root Biomass (mg)
(e)
10
Pearson
Nr
5
0
AC Nr nor gr rin
80
*
70
60
50
40
30
20
10
0
Pearson
Nr
Figure IV-1: Lateral root formation in tomato is influenced by mutations that alter
ethylene signaling and synthesis.
Roots were grown for 8 days on nutrient agar.
(a) Root phenotypes of seedlings on control or (b) 0.5 or 1µM ACC, as indicated, are
shown.
144
(c) The average number of lateral roots and SE from 15 seedlings is reported.
(d) The average number of emerged lateral roots in each genotype and SE of 15 seedlings
is reported.
(e) Seedlings grown for 15 days in soil are shown. Size bar =1cm
(f) The average and SE of biomass for 10 seedlings are reported.
* Statistically significant differences between genotypes were determined by Student’s ttest, with P<0.005 as indicated.
145
We examined root formation in the epi (epinastic) mutant, which has enhanced
ethylene synthesis and signaling (Fujino et al., 1988) and some ethylene independent
phenotypes (Barry et al., 2001), and in wild-type and Nr seedlings treated with ACC, a
precursor of ethylene (Figure IV-1a-c). The epi mutant showed a statistically significant
two-fold reduction in lateral root formation compared to its wild-type parental line VFN8
(Figure IV-1a,c). ACC treatment of wild-type roots phenocopies the epi mutant, resulting
in reduced primary root elongation and reduced number of emerged lateral roots (Figure
IV-1b). This inhibitory effect of ACC on lateral root formation was lost in the Nr mutant,
although root elongation is still reduced in Nr at higher doses of ACC (Figure IV-1b).
We quantified the effect of ACC on lateral root numbers in wild type and Nr
(Figure IV-2a). Pearson demonstrated a dose dependent decrease in lateral root formation
with a two-fold reduction in numbers of roots at 10 µM ACC and this effect was lost in
the Nr mutant. At the highest dose of ACC, there is a 2.5-fold difference in lateral roots
between Pearson and Nr. In contrast, Nr was not resistant to the effect of ACC on
primary root elongation (Figure IV-2b). We also examined the effect of ethylene gas on
wild-type and Nr seedlings and found that at doses between 0.5 and 10 µL/L, there was
an inhibition of lateral root formation in Pearson and AC, but no inhibition in Nr (data
not shown).
The Nr mutant in the AC background was slightly sensitive to the effect of ACC
on lateral root formation. At 10 µM ACC only 80% of the untreated number of roots
were formed (21 versus 26 lateral roots, for ACC treated and control roots, respectively;
P<0.0005). This small effect of ACC in Nr in the AC background is consistent with its
description in the literature as Nr exhibiting a weaker phenotype in the AC background
146
(a)
(b)
Primary root length (cm)
Number of lateral roots
16
14
12
10
8
6
4
Pearson
Nr
0
-7.5
-∞
Number at each stage
(c)
Number of lateral roots
(e)
-6.5
-5.5
-4.5
Log [ACC, M]
18
16
14
12
10
8
6
4
2
0
9
8
7
*
Primordia
Emerged
Total
(d)
*
#
#
*
Pearson
#
ACC
Mature region
Elongating region
Nr
*
*
-4.5
Untreated
ACC
100
*
-5.5
Log [ACC, M]
120
% of untreated control
2
18
16
14
12
10
8
6
Pearson
4
Nr
2
0
-∞
-7.5
-6.5
80
*
#
60
#
#
40
20
0
(f)
Total lateral
Total
root length root length
Pearson Nr(P)
AC
Average
lateral root
length
Nr(AC) VFN8
epi
6
5
4
3
*
#
2
1
0
Pearson Pearson Nr
+ACC
Nr
+ACC
Figure IV-2: ACC reduces root initiation in Pearson, but not in the Nr mutant.
(a) The effects of ACC on the number of lateral roots were determined, with the average
and SE of 15 seedlings, from 3 separate trials reported.
(b) The effect of a ACC concentrations on the elongation of the primary root was
determined, with the average and SE of 15 seedlings, from 3 separate trials reported.
147
(c) The average number and SE of lateral root primordia, emerged lateral roots, and
combined totals were determined for 6 day old cleared roots one day after transfer to
control media or media containing 1 µM ACC. (n=10 seedlings, from 3 trials) .
(d) Lateral root elongation in Pearson seedlings treated with 1 µM ACC was quantified in
several ways. The length of all lateral and primary root were summed (Total root
length), the length of only lateral roots was summed (total lateral root length), and the
average of the root length is reported for 7 days old roots is presented. The average
and SE of 5 seedlings are presented.
(e) The number of lateral roots that formed on primary root in the mature region
elongating region are shown for seedlings 7 days after transfer to control or ACC
containing media. The average and SE of 10 seedlings, from 3 separate trials are
reported.
(f) The triple response of two Nr alleles and the epi mutant are compared to appropriate
wild-type grown in the dark on control media or media containing ACC for 4 days
after radicle emergence. The seedlings were treated with 0, 1, 5, and 10 µM ACC
from left to right.
* Statistically significant differences relative at each stage of lateral root formation as
indicated in panel c and between untreated and treated Pearson in panel d were
determined by a Student’s t-test, with P<0.005 as indicated.
# Statistically significant differences relative between genotypes in panel d were
determined by a Student’s t-test, with P<0.05 as indicated.
148
(Lanahan et al. 1994). We therefore compared the triple response in the Nr mutant in
both backgrounds to define this difference (Figure IV-2f). At the highest dose Nr
(Pearson) shows no apparent growth inhibition, while Nr (AC) shows partial responses.
Together, these results are consistent with ethylene negatively regulating lateral root
formation in tomato.
Ethylene inhibits lateral root initiation and elongation
We asked whether ethylene exerts its negative role at the stages of lateral root
initiation and/or elongation. Wild-type and Nr roots treated with and without ACC were
cleared to allow visualization and quantification of early stages of root formation (Figure
IV-2c). With ACC treatment there was a significant 1.4-fold reduction in number of
initiated and elongated lateral roots (P<0.05). Cleared Nr mutant roots had significantly
more primordia and emerged lateral roots than wild type, with 2.6-fold and 1.4-fold
increases, respectively. These results indicate that the most profound effects of ACC
treatment are at the early stages of lateral root initiation.
To investigate the magnitude of the ethylene effect on lateral root elongation, we
calculated the total lateral root length in ACC treated seedling by summing the length of
all the lateral roots in each treatment (Figure IV-2d). This parameter has been called a
“tot value” and has been used previously to quantify overall lateral root formation
(Macgregor et al., 2008). The average lengths of lateral roots in ACC treated and control
seedlings are shown in Figure IV-2d. ACC significantly reduced both the number of
lateral roots and the elongation of lateral roots in total and on average for each lateral root.
The effect on lateral roots is more profound than on primary roots.
149
In Arabidopsis, ACC affects lateral root formation in a position specific manner
with decreases in lateral root formation evident only on the primary root formed after
transfer to ACC containing media (Negi et al., 2008; Ivanchenko et al., 2008). We asked
if the ACC effect was also position specific in tomato by examining the effect of ACC on
the mature region (formed before transfer to ACC) and in the elongating region (formed
after transfer to ACC containing media). In Pearson, the number of lateral roots was
significantly reduced in both regions, but with a greater 3-fold reduction in the elongating
region. In Nr, the ACC effect was lost and there were significantly greater number of
lateral roots in the elongating region (Figure IV-2e). These results are consistent with
similar developmental sensitivity to ACC in Arabidopsis and tomato.
Ethylene positively regulates adventitious root formation
Although the negative effect of ACC treatment on lateral root formation in tomato
parallels the effect seen previously in Arabidopsis (Negi et al., 2008; Ivanchenko et al.,
2008), the inhibitory effect of ethylene contrasts with previous reports on adventitious
root formation from hypocotyl tissues in tomato (Clark et al., 1999; Kim et al., 2008),
which was examined in mature plants grown in soil. We therefore asked whether
adventitious roots of tomato showed similar ethylene response to lateral roots examined
in young seedlings grown under similar conditions. After germination, seeds were grown
in low light (5-10 µmol m–2 s–1) for 3 days to elongate the hypocotyl and then transferred
to high light (100 μmol m–2 s–1) for 7 days to observe adventitious root formation (Figure
IV-3a-b). The Nr mutant showed a statistically significant 40% reduction in number of
adventitious roots (P<0.005), consistent with two previous reports that examined older
150
Pearson
Pearson +ACC
Nr
Nr +ACC
(c)1 1
(b)
Number of adventitious roots,
% of WT
250
*
200
150
100
*
50
0
Pearson Nr
VFN8 epi
Number of adventitious roots
(a)
10
9
8
7
6
5
4
3
2
1
VFN8
epi
Pearson
Nr
#
#
*
0 µM
*
*
0.1 µM
1 µM
10 µM
ACC Concentration
Figure IV-3: Ethylene enhances adventitious root formation in tomato hypocotyls.
The number of adventitious roots formed 7 days after transfer of seedlings to control
plates or plates with ACC. The average and SE for adventitious roots is shown.
(a) Adventitious root formation in control and 10µM ACC treated Pearson and Nr is
shown. Size bar =1cm
(b) The number of adventitious root was quantified in WT and mutants grown on control
media with n= 8-11, from 2 separate trials for Pearson and Nr and n= 22-25, from 3
separate trials for VFN8 and epi.
(c) The effects of a range of ACC concentrations on the number of adventitious roots
with the average and SE of 19-28 seedlings, from 4 separate trials reported.
* Statistically significant differences between untreated genotypes determined by
Student’s t-test are indicated (P<0.005).
151
# Statistically significant differences within genotype in response to ACC treatment
determined by Student’s t-test are indicated (P< 0.005).
152
tissues grown under very different conditions (Kim et al., 2008; Clark et al., 1999). The
epi mutant showed a statistically significant 1.8-fold increase in adventitious root
formation (P<0.005). Pearson has greater numbers of adventitious roots than Nr at all
ACC doses (Figure IV-3c; P<0.005 at 1 and 10 µM). The ACC treatment of wild type
enhanced the adventitious root formation in a dose dependent manner, with significant
1.4-and 1.8-fold increases at 1 and 10 µM ACC, respectively, while Nr was insensitive to
this effect. This suggests an opposite role for ethylene in regulation of formation of
lateral and adventitious roots.
Ethylene positively regulates auxin transport in tomato roots
We asked whether ethylene might alter root formation through modulation of
auxin transport. Acropetal IAA transport was measured in Pearson and Nr tomato roots in
the presence and absence of ACC (Figure IV-4a). Acropetal transport was quantified by
the level of tritiated IAA moving from the site of application at the root shoot junction to
the root tip and is significantly reduced in Nr (P<0.05). In contrast, ACC treatment
resulted in a 2-fold enhancement in number of elongated adventitious roots in Pearson,
but not in Nr. The epi mutant exhibited a 2.5-fold increase in acropetal auxin transport
relative to its wild type (Figure IV-4b). ACC treatment also significantly enhanced the
acropetal transport of auxin in wild-type seedlings by 2-fold (Figure IV-4a; P<0.005).
Similarly, ACC treatment and the epi mutation significantly increase basipetal auxin
transport by 2- and 3.5-fold, respectively (Figure IV-4b-c; P<0.0005). The Nr mutant
showed less basipetal IAA transport than Pearson and the ACC effect was lost in Nr
153
(a)
Acropetal IAA transport (fmol)
2.0
1.6
Untreated
1µM ACC
1.4
1.2
1.0
*
0.8
0.6
0.4
0.2
0.0
(b)
IAA transport, % of wild type
*
1.8
450
Pearson
Nr
2
VFN8
epi
400
*
350
*
300
250
200
150
100
50
0
Basipetal IAA transport (fmol)
(c)
Acropetal
Basipetal
35
*
30
Untreated
1µM ACC
25
20
15
*
10
5
0
Pearson
1
Nr
Figure IV-4: In tomato roots acropetal and basipetal IAA transport are positively
regulated by ethylene.
IAA transport was measured 2 days after seedlings were transferred to control media or
media containing 1 µM ACC. The average and SE of 15 seedlings from 3 separate
experiments are reported in all panels.
(a) Acropetal IAA transport is reported.
154
(b) Basipetal IAA transport is reported.
(c) Acropetal and basipetal transport in VFN8 and epi are reported as the percent of wildtype.
# Statistically significant differences between genotypes was determined by Student’s ttest is indicated (P<0.05).
* Statistically significant differences between untreated and treated was determined by
Student’s t-test is indicated (P<0.05).
155
(Figure IV-4b). These results indicate that ethylene has a stimulatory effect on both
acropetal and basipetal IAA transport in tomato roots.
Ethylene alters auxin transport in hypocotyls
We also examined the effect of ethylene on auxin transport in tomato hypocotyls.
We applied 10µl agar droplets containing [3H]IAA at the shoot apical end, after removal
of shoot apex. Five hours later, 5mm sections were excised from each hypocotyl at a
distance of 2-2.5 cm from the point of application, and the amount of tritiated IAA was
quantified. Nr showed enhanced IAA transport in hypocotyls, with a significant 3-fold
increase compared to Pearson (Figure IV-5a; P<0.005). In contrast, auxin transport was
reduced in tomato hypocotyls treated with ACC, while treatment with silver nitrate,
which blocks ethylene signaling, increased auxin transport (Figure IV-5b). This suggests
that ethylene negatively regulates auxin transport in hypocotyls in contrast to root tissues,
where the capacity to transport auxin is increased. Surprisingly, the epi mutant also
showed an increase in hypocotyl IAA transport with a 2.7-fold significant increase in
transport (Figure IV-5b) (P<0.005).
Ethylene alters free IAA content in tomato roots and hypocotyls
We further investigated the effect of ethylene on free auxin content in roots. The
free IAA levels in seedlings on control or 1µM ACC containing media for 48 hrs and root
tissues were quantified (Figure IV-6a-b). Free IAA was extracted and measured using a
gas chromatograph-mass spectrometer operated in the selected ion monitoring mode
(GC-SIM-MS) by isotope dilution analysis using [13C6]IAA as the internal standard
156
(a)
8
Hypocotyl IAA transport
( fmole)
7
(b)
0
#
Control
10µM ACC
10µM AgNO3
*
6
5
4
3
#
2
1
Pearson
Nr
Hypocotyl IAA transport,
% of wild type
350
*
300
250
200
150
100
50
0
VFN8
epi
Figure IV-5: Ethylene alters basipetal auxin transport in tomato hypocotyls. The
average ± standard error is reported.
(a) Basipetal IAA transport in Pearson and Never-ripe with and without ACC and
AgNO3 treatment is compared for 8-14 samples from 3 trials.
(b) Basipetal IAA transport in VFN8 and epi are compared in 7-18 samples from 3 trials.
157
* Statistically significant differences between untreated genotypes in panel a and b were
determined by Student’s t-test are indicated (P<0.005).
# Statistically significant differences in Pearson in response to ACC and AgNO3
treatment were determined by Student’s t-test are indicated (P< 0.005).
158
(Barkawi et al., 2008). In Nr, free IAA levels were higher than Pearson and consistent
with these results, ACC treated Pearson roots showed significantly lower concentration
(P<0.05) of free IAA than untreated roots (Figure IV-6 a,b). There is a similar effect of
ACC in all backgrounds (Pearson, AC, and VFN8) with statistically significant 1.5-fold
decrease in free IAA, as shown in Figure IV-6a (P<0.05).
To test if ethylene regulates free IAA accumulation in hypocotyls, we measured
free IAA levels in Nr and epi, as well as wild type treated with ACC. Low light grown
seedlings were transferred to high light conditions for 48 hrs and hypocotyl tissues were
harvested and immediately frozen. Free IAA was extracted and quantified using GCSIM-MS. Nr showed a slight, but not significant, (20%) reduction in free IAA (Figure
IV-7a). epi also showed a 40% reduction in free IAA levels compared to wild type, but
this reduction was also not significant. Additionally, we quantified free IAA levels in
wild-type hypocotyls treated with 1 and 10 µM of ACC for 48 hrs (FigureIV-7b).
Surprisingly, no changes in free IAA levels were observed in treated hypocotyls. This
may be attributed to a lack of effect of ACC on auxin accumulation. Alternatively, the
treatment with ACC might not have been sufficient duration to elicit a response or may
have been transient, although similar treatments were found to alter IAA transport. Yet,
the global effects of ACC treatment on free IAA in hypocotyls are minimal suggesting
that ethylene only subtly changes free IAA, but has a more profound effect on IAA
transport.
Nr is insensitive to IAA induced lateral root formation but exhibits reduced response in
adventitious root formation
159
(a)
Free IAA, (ng/gFW)
16
14
12
10
8
Free IAA, (ng/gFW)
*
*
*
6
4
2
0
(b)
Untreated
1µM ACC
Pearson
AC
VFN8
40
35
30
25
20
15
10
5
0
Pearson
Nr
Figure IV-6: In tomato roots free IAA content is reduced two days after 1 µM ACC
treatment.
(a) Free IAA content in three different genotypes quantified after treatment with 1 µM
ACC.
(b) Free IAA content in Pearson and Nr mutant. The average and SE of 3 replicates are
reported.
* Statistically significant differences relative to untreated wild-type were determined by
Student’s t-test are indicated (P<0.05).
160
Free IAA, (ng/g FW)
(a) 9
8
7
6
5
4
3
2
1
0
(b)
VFN8
epi
Free IAA, (ng/g FW)
10
9
8
7
6
5
4
3
2
1
0
Pearson Nr
Control
1µM ACC
10µM ACC
Figure IV-7: Effect of ethylene on free IAA content in tomato hypocotyls are shown.
(a) Free IAA in ethylene mutants Never- ripe and epi are compared to respective wildtypes.
(b) Free IAA in tomato hypocotyls treated with ACC for 48 hours.
(a and b) The average and SE of 3 replicates is reported.
161
We examined the role of auxin during lateral and adventitious root formation and
asked whether there is cross-talk between auxin and ethylene signaling pathways.
Pearson and Nr seedlings were grown on control media for one day and then transferred
to plates containing control media or media containing IAA and after 7 days lateral root
number was quantified. Pearson roots showed significant induction in lateral root
formation (P<0.05) with 1.4-fold increase in lateral root number at 10 µM IAA and Nr
remained insensitive to this response (Figure IV-8a). These results contrast with
Arabidopsis where ethylene insensitive mutants showed similar induction as wild type in
lateral root number when treated with IAA (Negi et al., 2008). These results suggest
species specific cross-talk between auxin and ethylene in regulation of lateral root
formation.
To examine the IAA effect on adventitious root formation, low light grown
Pearson and Nr seedlings were transferred to control agar or agar containing IAA, and
seedlings were placed under high light conditions with a yellow filter to prevent light
induced auxin degradation. Adventitious roots formed 7 days later were quantified from
6-21 seedlings (Figure IV-8). IAA enhanced the formation of adventitious roots in
Pearson hypocotyls in a dose dependent manner, with a 1.7-fold induction at 10 µM IAA.
These adventitious roots emerged from the lower half of the hypocotyls as well as at the
root shoot junction, similar to the pattern observed with ACC treatment. Nr showed
similar induction as Pearson when treated with IAA. This suggests that both ethylene and
auxin positively regulates adventitious root formation with auxin sensitivity not requiring
ethylene signaling.
162
Number of lateral roots ,% of control
(a)
160
140
120
100
80
60
40
20
Pearson
Nr
0
--88
-7
(b)
-5
log [IAA, M]
12
Number of adventitiousroots
-6
10
Pearson
Nr
b
c
c
8
6
4
a
2
0
Control
0.1µM IAA 1µM IAA 10µM IAA
Figure IV-8: Nr has altered responses to auxin in both lateral and adventitious root
formation.
(a) The effects of a range of IAA concentrations on the number of lateral roots were
determined. The average and SE of 15 seedlings were normalized to the untreated
controls for each genotype (with Pearson having 13 and Nr having 16 adventitious
roots).
163
(b) The effects of a range of IAA concentrations on the number of adventitious roots
were determined, with the average and SE of 6-21 seedlings reported here.
Significant differences were determined by Student’s t-test and, a; significant
differences between untreated genotypes, b; with IAA treatment in Pearson and c;
with IAA treatment in Nr are indicated (P<0.05).
164
Discussion
We examined the role of ethylene in modulation of lateral root formation and
adventitious root formation in tomato, utilizing an array of mutants with defects in
ethylene signaling and fruit ripening, including Never ripe (Nr), green ripe (gr), ripening
inhibitor (rin) and non ripening (nor), and epinastic (epi). Nr in both Pearson and AC
backgrounds formed significantly more lateral roots when grown on agar media, as did gr,
rin, and nor. Additionally, quantification of root biomass of 15-day-old soil grown
seedlings of both Pearson and Nr showed that Nr has almost 3-fold more root biomass
than Pearson. This observation suggests that enhanced root formation in Nr continues
beyond the seedling stage and may be amplified when roots are grown in soil, which
limits ethylene diffusion more than growth along the surface of unsealed Petri dishes.
Consistent with a negative role of ethylene in lateral root formation, treatment of wild
type with the ethylene precursor, ACC, or in the epi mutant, which has been reported to
have elevated ethylene levels (Fujino et al., 1988; Barry et al., 2001), reduces the number
of initiated and elongated lateral roots, while the Nr mutant was insensitive to the
inhibition of lateral root formation by ACC. These experiments confirm the negative role
of ethylene during lateral root formation in young tomato seedlings.
In contrast, adventitious root formation exhibited an opposite ethylene
dependence. Nr had reduced number of adventitious roots, while ACC treated wild type
and the epi mutant had an enhanced number of adventitious roots. Treatment with ACC
resulted in expansion of the zone of adventitious root formation, from proliferation only
at the base of the hypocotyl, to a region extending 1-2 cm along the basal part of the
hypocotyl. Examination of adventitious root formation on vegetative stem cuttings of
165
Pearson and Nr found similar differences, with Nr forming reduced numbers compared to
the wild type (Clark et al., 1999). Moreover, Nr has been reported to have reduced
number of adventitious roots in intact plants grown under low phosphorous conditions, as
compared to Pearson (Kim et al., 2008). This positive effect of ethylene on adventitious
roots has also been observed in other species of plants such as in intact plants of Rumex
palustris under conditions of flooding or ethylene application (Visser et al., 1996). These
results suggest a differential role of ethylene in root formation with a negative regulation
during lateral root formation and a positive regulation during adventitious root formation.
Ethylene-auxin cross talk can occur at many different levels including the
modulation of auxin sensitivity, accumulation, and transport. We tested whether ethylene
regulates auxin sensitivity during lateral and adventitious root formation in tomato by
performing dose response curves with exogenous IAA and quantifying differences in the
Nr mutant. Auxin induced promotion of lateral root formation is lost in Nr. Induction of
lateral roots by IAA in wild type was dependent upon developmental stage of treatment,
with more induction seen if longer primary roots were present at the time of transfer to
media with auxin, and no stimulation in numbers of lateral roots formed when seedlings
are transferred to IAA immediately after germination (Muday and Haworth, 1994). In
parallel, adventitious roots were induced by auxin treatment in both wild type and Nr, but
with Nr never reaching wild-type number of adventitious roots even at 10µM IAA,
consistent with a previous report (Clark et al., 1999). Thus, even though auxin may affect
lateral and adventitious root formation, the ethylene insensitivity alters IAA response
differentially in hypocotyls and roots.
166
Additionally, we tested whether auxin transport is modulated via ethylene.
Previous reports have found that ethylene inhibits polar auxin transport in shoot tissues
(Morgan and Gausman, 1966; Suttle, 1988) and Medicago roots during nodulation
(Prayitno et al., 2006). Basipetal auxin transport was measured in tomato ethylene
insensitive mutants in stem tissues under conditions when adventitious root formation
occurs. ACC treatment decreased the movement of IAA, consistent with previous reports,
while IAA transport was increased in Nr hypocotyls or wild-type hypocotyls treated with
silver nitrate, an ethylene signaling antagonist, in comparison to untreated wild type.
Furthermore, Nr mutants were insensitive to both ACC and silver nitrate treatments.
These two findings support a negative role of ethylene in the regulation of hypocotyl
auxin transport.
Surprisingly, the epi mutant was found to have increased basipetal hypocotyl IAA
transport similar to Nr and opposite to seedlings treated with ACC. As the epi mutation
is yet to be cloned, the relationship between this mutation and ethylene signaling remains
unclear. Studies that have examined ethylene synthesis have found that hypocotyls of epi
had similar level of ethylene as wild type even though the total ethylene content was
higher in epi (Fujino et al., 1988). Additionally, epi does not have characteristics of
altered ethylene response mutant in all tissues (Barry et al., 2001). Although vegetative
growth is altered, fruit ripening and senescence are similar to wild type in epi. Therefore
explanation for this contradiction between elevated ethylene and epi phenotype remains
unresolved.
In contrast to stem auxin transport, IAA transport was found to be decreased in Nr
roots, while ACC treatment and the epi mutation increased root IAA transport. This
167
suggests that ethylene has contrasting roles in roots and hypocotyls with a positive
regulation by ethylene in root, and negative modulation auxin transport in stem tissue.
We initially hypothesized that ACC might reduce root formation by negatively regulating
IAA transport. This positive effect of ACC treatment on root auxin transport contrasted
with this model, but confirms what we found in Arabidopsis (Negi et al. 2008). These
combined results in Arabidopsis and tomato lead us to speculate that perhaps enhanced
long distance polar IAA transport prevents localized accumulation of auxin needed to
drive lateral root formation.
We examined the effect of ACC treatment and mutants on free IAA levels in both
roots and hypocotyls. Several reports have indicated that elevated ethylene levels
enhance the accumulation and synthesis of IAA in Arabidopsis root tips (Stepanova et al.,
2007; Ruzicka et al., 2007; Swarup et al., 2007), so we predicted that free IAA might be
elevated in the ACC treated roots. In contrast to our expectation, significant reductions in
free IAA levels were observed in root tissue in the presence of ACC, while in roots of the
Nr mutant, there were increased levels of free IAA. This suggests that ethylene may
negatively regulate free IAA levels in root tissue, when the whole tissue is examined,
rather than just the tip of Arabidopsis roots (Ruzicka et al., 2007). Additionally, Swarup
et al., (2007) found 3-fold increases in rate of IAA synthesis in intact seedlings treated
with 100µM ACC by specifically measuring the rate of IAA synthesis using D2O feeding
studies. The doses used in that study were 100 fold higher than we used, and at doses that
would completely block elongation. Therefore a lack of overall increase we see in free
IAA levels, which is a combination of IAA synthesis, conjugation, and transport in whole
root tissues, could be explained by differences in ACC dose, tissue segments, or growth
168
conditions. We find no evidence for global changes in free IAA levels in stem tissue in
Nr or epi, or in wild type treated with ACC. As these experiments were performed with
whole hypocotyls, there may be local changes in free IAA level that were not detectable
in this assay. Yet, these findings are consistent with more profound effects of ethylene on
auxin transport than free auxin levels in hypocotyls.
It is surprising that ACC treatment enhances long distance polar transport within
the root, but decreases free IAA levels. If more auxin is being transported from the shoot
into the root, then we would predict that there should be higher levels of free IAA. Our
transport assays do not directly measure shoot to root movement of IAA, since we apply
IAA below the root shoot junction. To ask if there are differences in IAA transport from
the shoot apex into the root, we applied the [3H]IAA at the top of hypocotyls and
measured radioactivity along the hypocotyl of wild-type seedlings (data not shown). This
assay found that the highest level of IAA was in the region directly above the root shoot
junction and that less IAA moved into the root. Therefore, there may be complex
regulation of auxin flow as it crosses from the shoot into the root. Additionally, free
levels may change as a result of changes in transport, but also synthesis and conjugation,
therefore we cannot rule out ACC dependent regulation of free IAA in roots that are
transport independent.
An important general question is why it might be advantageous to a plant to
enhance adventitious root formation and inhibit lateral root formation with rising
ethylene levels? This might be a compensatory mechanism of plants wherein lack of
underground root growth is balanced by increases in adventitious roots emerging from
the stem of the plants. This has been seen under conditions of submergence in other plant
169
species, where in the development of lateral roots is diminished but at the same time there
is increase in formation of adventitious roots (Visser et al., 1996). Moreover this process
has been shown to be regulated by ethylene through manipulating auxin transport or
synthesis (Visser et al., 1996; Grichko and Glick, 2001).
In conclusion, we find ethylene-auxin cross talk drives root formation in tomato
with tissue specific mechanisms during lateral and adventitious root formation. The
negative effect of ethylene on lateral root formation supports the previously reported
effects on lateral root formation in Arabidopsis. Additionally, we expanded these studies
and have looked at the effect of ethylene on adventitious root formation and have found a
positive influence of ethylene on adventitious root formation. This ethylene-auxin cross
talk includes negative regulation of free auxin accumulation and positive regulation of
auxin transport in roots, and negative regulation of auxin transport in shoots. These
differences in regulation give a better understanding of complex pathways of ethylene
auxin cross talk that regulate lateral and adventitious root development.
170
Methods
Chemicals
Triton X-100 was purchased from Fisher Scientific. Murashige and Skoog (MS)
salts were purchased from Caisson Labs. [5-3H]IAA was purchased from Amersham
(Buckinghamshire, UK; specific activity, 23 Ci mmol–1). All other chemicals were
acquired from Sigma (St. Louis, MO).
Plant material and growth conditions
Nr mutant in Pearson background was provided by Harry Klee (Aloni et al.,
1998), Nr, gr, rin, nor, (all in the AC background) and epi (in the VFN8 background)
mutant seeds were provided by Jim Giovannoni (Barry et al., 2001). All seeds were
sterilized by incubation for 1 min in 95% ethanol, then 30 min in freshly prepared 20%
(v/v) bleach plus 0.01% (v/v) Triton X-100, and then washed with sterile water. The
sterilized seeds were sown on sterilized blue filter papers and after radicle emergence
they were transferred to control plates: 0.8% (w/v) Type M agar (A-4800, Sigma), MS
nutrients (macro and micro salts: MSP0501, Caisson Labs, Inc.) (Murashige and Skoog,
1962), vitamins (1 µg mL–1 thiamine, 1 µg mL–1 pyridoxine HCl, and 0.5 µg mL–1
nicotinic acid), 0.05% (w/v) MES, with pH adjusted to 5.8. Seedlings were grown under
24 hours of fluorescent lights at 100 μmol m–2 s–1 at 23ºC or as noted. For experiments
with IAA, seedlings were grown under yellow filters to prevent IAA degradation
(Stasinopoulos and Hangarter, 1989). For root biomass quantification seedlings were
grown in Metro-Mix 200 for 15 days under constant light at 40-50 µmol m-2 s-1.
Lateral root and adventitious root quantification
171
Seeds were germinated and after radicle emergence, they were transferred to
control agar plates or plated with agar containing the indicated amounts of ACC or IAA.
The emerged lateral roots along the primary root, that were greater than 1 mm long were
counted after seven additional days of growth using a dissecting scope.
For quantification of adventitious roots, radicle emerged seedlings were
transferred to agar media in Petri dishes, and were placed vertically under 5-10 µmol m-2
s-1. After 3 days of growth they were transferred to 100 µmol m–2 s–1, either on control
agar plates or plates with agar having different concentrations of IAA or ACC. A slab of
approximately 1cm wide control agar was placed across the hypocotyls, to keep the
hypocotyls from growing away from the agar media. Adventitious roots emerging from
hypocotyl and root shoot junction were counted seven days later.
Detection of lateral root initiation events
Roots from 5 days old seedlings grown on either control media or treatments were
cut and fixed in ethanol:acetic acid (6:1[v/v] overnight. Fixed roots were washed in 100%
ethanol followed by washing in 70% ethanol, These roots were cleared in a mixture of
chloral hydrate:glycerol:water (8:1:2[w/v]) overnight (Al-Hammadi et al., 2003) and
after clearing these roots were observed under dissecting microscope for quantification of
lateral root primordia.
Auxin transport assays
Seeds were germinated and after radicle emergence transferred to control or 1 µM
ACC plates. After 48 hours, a 100 nM [3H]IAA agar cylinder was applied just below the
172
aligned RSJs and the seedlings were incubated in the dark in the inverted position to
prevent [3H]IAA from diffusing along the root, for 18 hours. The apical 5 mm of each
root tip was excised and the amount of radioactivity quantified. Individual segments
from each plant and position were placed in 2.5 mL scintillation liquid (Scintiverse (TM)
BD cocktail, Fisher chemicals) and radioactivity was measured for 2 min on a Beckman
scintillation counter (model LS 6500, Beckman, Fullerton, CA). Measurement of
radioactive basipetal auxin transport was performed using the method illustrated by
Lewis and Muday (2009) using same age seedlings as described above treated with 100
nM [3H]IAA agar cylinder applied adjacent to the root tip and the seedlings were
incubated in the dark. After 5 hours the apical 2mm of root was excised and discarded
and a 5mm segment basal to that was quantified for radioactive IAA.
Quantification of basipetal hypocotyl transport
Seedlings were grown under low light (5-10 µmol m–2 s–1) for 3 days and were
transferred to high light conditions (5-10 µmol m–2 s–1) on control or treatment plates for
48 hrs. The transport was measured by the application of 10mm wide agar droplets with
100 nM [3H]IAA at the shoot apical end after removal of cotyledons. After 5 hrs of
incubation in the dark, 5mm sections at a distance 2.5 cm away from the shoot apical end
was removed and radioactivity was determined using a scintillation counting.
Free IAA Measurements
For root samples, seeds were germinated and after radicle emergence transferred
to control or 1 µM ACC plates for 48 hours and roots were excised and frozen in liquid
173
nitrogen. For hypocotyl tissues, samples were grown in low light for 3 days and
transferred to high light conditions onto media with and without 1 or 10 µM ACC for 48
hours and hypocotyls were collected and frozen. For both, 50-80 mg of frozen tissue was
homogenized with a bead beater in 150µl homogenization buffer (35% of 0.2M
imidazole, 65% isopropanol, pH 7), containing 4ng of [13C6]IAA as an internal standard.
After 1 hour on ice, samples were subjected to centrifugation at 10,000xg for 8 min. The
homogenates were purified over two successive columns using an automated robotic
system, methylated, dried, and redissolved in ethyl acetate (Barkawi et al., 2008). The
samples were then analyzed using gas chromatograph-mass spectrometer operated in the
selected ion monitoring mode (GC-SIM-MS). The free IAA was quantified by isotope
dilution analysis using [13C6]IAA as the internal standard (Barkawi et al., 2008).
Acknowledgements
We appreciate the generosity of Harry Klee and Jim Giovonnoni in sharing seeds.
We gratefully acknowledge the Children’s Home of Winston Salem and Pete and Ann
Weigl for providing field space for growth of tomatoes and the assistance of Daniel
Lewis and Kevin Cooper in maintaining this field site. This work was supported by the
USDA National Research Initiative Competitive Grants Program (grant 2006-03406 to
GKM and grant 2004-02816 to JDM) and NSF grant MCB-0725149 to JDC, and the
Gordon and Margaret Bailey Endowment for Environmental Horticulture to JDC.
174
Literature cited
Al-Hammadi, A.S., Sreelakshmi, Y., Negi, S., Siddiqi, I. and Sharma, R. (2003) The
polycotyledon mutant of tomato shows enhanced polar auxin transport. Plant
Physiol, 133, 113-125.
Barkawi, L.S., Tam, Y.Y., Tillman, J.A., Pederson, B., Calio, J., Al-Amier, H.,
Emerick, M., Normanly, J. and Cohen, J.D. (2008) A high-throughput method
for the quantitative analysis of indole-3-acetic acid and other auxins from plant
tissue. Anal Biochem, 372, 177-188.
Barry, C.S., Fox, E.A., Yen, H., Lee, S., Ying, T., Grierson, D. and Giovannoni, J.J.
(2001) Analysis of the ethylene response in the epinastic mutant of tomato. Plant
Physiol, 127, 58-66.
Barry, C.S. and Giovannoni, J.J. (2006) Ripening in the tomato Green-ripe mutant is
inhibited by ectopic expression of a protein that disrupts ethylene signaling. Proc
Natl Acad Sci U S A, 103, 7923-7928.
Barry, C.S. and Giovannoni, J.J. (2007) Ethylene and fruit ripening. Journal of Plant
Growth Regulation, 26, 143-159.
Boerjan, W., Cervera, M.-T., Delarue, M., Beeckman, T., Dewitte, W., Bellini, C.,
Caboche, M., van Onckelen, H., Van Montagu, M. and Inze, D. (1995)
Superroot, a recessive mutation in Arabidopsis, confers auxin overproduction.
Plant Cell, 7, 1405-1419.
Casimiro, I., Marchant, A., Bhalerao, R.P., Beeckman, T., Dhooge, S., Swarup, R.,
Graham, N., Inzé, D., Sandberg, G., Casero, P.J. and Bennett, M. (2001)
175
Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell, 13, 843852.
Ciardi, J.A., Tieman, D.M., Jones, J.B. and Klee, H.J. (2001) Reduced expression of
the tomato ethylene receptor gene LeETR4 enhances the hypersensitive response
to Xanthomonas campestris pv. vesicatoria. Molecular Plant-Microbe
Interactions, 14, 487-495.
Clark, D.G., Gubrium, E.K., Barrett, J.E., Nell, T.A. and Klee, H.J. (1999) Root
formation in ethylene-insensitive plants. Plant Physiol, 121, 53-60.
Coleman, W., Huxter, T., Reid, D. and Thrope, T. (1980) Ethylene as an endogenous
inhibitor of root regeneration in tomato leaf disc cultures in vitro. Physiol Plant,
48, 519-525.
De Klerk, G.-J., Van Der Krieken, W. and De Jong, J. (1999) The formation of
adventitious roots: New concepts, new possibilities. In Vitro Cell Dev Biol-Plants,
35, 189-199.
Fujino, D.W., Burger, D.W., Yang, S.F. and Bradford, K.J. (1988) Characterization
of an Ethylene Overproducing Mutant of Tomato (Lycopersicon esculentum Mill.
Cultivar VFN8). Plant Physiol, 88, 774-779.
Geneve, R. and Heuser, C. (1983) The relationship between ethephon and auxin on
adventitious root intiation in cuttings of Vigna radiata (L.) R. Wilcz. J Am Soc
Hortic Sci, 108, 330-333.
Grichko, V. and Glick, B. (2001) Ethylene and flooding stress in plants. Plant Physiol
Biochem, 39, 1-9.
176
Guzman, P. and Ecker, J.R. (1990) Exploiting the Triple Response of Arabidopsis to
Identify Ethylene-Related Mutants. Plant Cell, 2, 513-523.
Hitchcock, A. and Zimmerman, P. (1940) Effects obtained with mixtures of rootinducing and other substances. Contrib Boyce Thompson Inst, 11, 155-159.
Hua, J., Sakai, H., Nourizadeh, S., Chen, Q.G., Bleecker, A.B., Ecker, J.R. and
Meyerowitz, E.M. (1998) EIN4 and ERS2 are members of the putative ethylene
receptor gene family in Arabidopsis. Plant Cell, 10, 1321-1332.
Huang, Y., Li, H., Hutchison, C.E., Laskey, J. and Kieber, J.J. (2003) Biochemical
and functional analysis of CTR1, a protein kinase that negatively regulates
ethylene signaling in Arabidopsis. Plant J, 33, 221-233.
Ito, Y., Kitagawa, M., Ihashi, N., Yabe, K., Kimbara, J., Yasuda, J., Ito, H.,
Inakuma, T., Hiroi, S. and Kasumi, T. (2008) DNA-binding specificity,
transcriptional activation potential, and the rin mutation effect for the tomato
fruit-ripening regulator RIN. Plant J, 55, 212-223.
Ivanchenko, M.G., Coffeen, W.C., Lomax, T.L. and Dubrovsky, J.G. (2006)
Mutations in the Diageotropica (dgt) gene uncouple patterned cell division during
lateral root initiation from proliferative cell division in the pericycle. Plant J, 46,
436-447.
Ivanchenko, M.G., Muday, G.K. and Dubrovsky, J.G. (2008) Ethylene-auxin
interactions regulate lateral root initiation and emergence in Arabidopsis thaliana.
Plant J.
Kendrick, M.D. and Chang, C. (2008) Ethylene signaling: new levels of complexity
and regulation. Curr Opin Plant Biol, 11, 479-485.
177
Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A. and Ecker, J.R. (1993)
CTR1, a negative regulator of the ethylene response pathway in Arabidopsis,
encodes a member of the Raf family of protein kinases. Cell, 72, 427-441.
Kim, H.J., Lynch, J.P. and Brown, K.M. (2008) Ethylene insensitivity impedes a
subset of responses to phosphorus deficiency in tomato and petunia. Plant Cell
Environ, 31, 1744-1755.
Klee, H.J. (2004) Ethylene signal transduction. Moving beyond Arabidopsis. Plant
Physiol, 135, 660-667.
Lashbrook, C.C., Tieman, D.M. and Klee, H.J. (1998) Differential regulation of the
tomato ETR gene family throughout plant development. Plant J, 15, 243-252.
Laskowski, M., Grieneisen, V.A., Hofhuis, H., Hove, C.A., Hogeweg, P., Maree, A.F.
and Scheres, B. (2008) Root system architecture from coupling cell shape to
auxin transport. PLoS Biol, 6, e307.
Li, S.W., Xue, L.G., Xu, S.J., Feng, H.Y. and An, L.Z. (2009) Mediators, Genes and
Signaling in Adventitious Rooting. Botanical Review, 75, 230-247.
Lincoln, J.E. and Fischer, R.L. (1988) Regulation of Gene Expression by Ethylene in
Wild-Type and rin Tomato (Lycopersicon esculentum) Fruit. Plant Physiol, 88,
370-374.
Ludwig-Muller, J., Vertocnik, A. and Town, C.D. (2005) Analysis of indole-3-butyric
acid-induced adventitious root formation on Arabidopsis stem segments. J Exp
Bot, 56, 2095-2105.
Lynch, J. (1995) Root Architecture and Plant Productivity. Plant Physiol, 109, 7-13.
178
Macgregor, D.R., Deak, K.I., Ingram, P.A. and Malamy, J.E. (2008) Root system
architecture in Arabidopsis grown in culture is regulated by sucrose uptake in the
aerial tissues. Plant Cell, 20, 2643-2660.
Malamy, J. and Benfey, P. (1997) Organization and cell differentiation in lateral roots
of Arabidopsis thaliana. Development, 124, 33-44.
Malamy, J. (2009) Lateral Root Development. Root Development. Beeckman, T.,
Oxford, UK: Blackwell Publishing Limited, In press.
Malamy, J.E. and Ryan, K.S. (2001) Environmental regulation of lateral root initiation
in Arabidopsis. Plant Physiol, 127, 899-909.
Morgan, P. and Gausman, H. (1966) Effects of ethylene on auxin transport. Plant
Physiol, 41, 45-52.
Muday, G.K. and Haworth, P. (1994) Tomato root growth, gravitropism, and lateral
development: correlation with auxin transport. Plant Physiol Biochem, 32, 193203.
Muday, G.K., Lomax, T.L. and Rayle, D.L. (1995) Characterization of the growth and
auxin physiology of roots of the tomato mutant, diageotropica. Planta, 195, 548553.
Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and bioassays
with tobacco tissue cultures. Physiologia Plantarum, 15, 473-479.
Negi, S., Ivanchenko, M.G. and Muday, G.K. (2008) Ethylene regulates lateral root
formation and auxin transport in Arabidopsis thaliana. Plant J, 55, 175-187.
Phatak, S., Jaworski, C. and Liptay, A. (1981) Flowering and adventitious root growth
of tomato cultivars as influenced by ethephon. HortScience, 16, 181-182.
179
Prayitno, J., Rolfe, B.G. and Mathesius, U. (2006) The Ethylene-insensitive sickle
mutant of Medicago truncatula shows altered auxin transport regulation during
nodulation. Plant Physiol, 142, 168-180.
Reed, R.C., Brady, S.R. and Muday, G.K. (1998) Inhibition of auxin movement from
the shoot into the root inhibits lateral root development in arabidopsis. Plant
Physiol, 118, 1369-1378.
Resnick, J.S., Wen, C.K., Shockey, J.A. and Chang, C. (2006) REVERSION-TOETHYLENE SENSITIVITY1, a conserved gene that regulates ethylene receptor
function in Arabidopsis. Proc Natl Acad Sci U S A, 103, 7917-7922.
Robbins, J., Kays, S. and Dirr, M. (1983) Enhanced rooting of wounded mung bean
cuttings by wounding and ethephon. J Am Soc Hortic Sci, 108, 325-329.
Roy, B., Basu, R. and Bose, T. (1972) Interaction of auxins with growth-retarding, inhibiting and ethylene-producing chemicals in rooting of cuttings. Plant Cell
Physiol, 13, 1123-1127.
Ruzicka, K., Ljung, K., Vanneste, S., Podhorska, R., Beeckman, T., Friml, J. and
Benkova, E. (2007) Ethylene regulates root growth through effects on auxin
biosynthesis and transport-dependent auxin distribution. Plant Cell, 19, 21972212.
Sakai, H., Hua, J., Chen, Q.G., Chang, C., Medrano, L.J., Bleecker, A.B. and
Meyerowitz, E.M. (1998) ETR2 is an ETR1-like gene involved in ethylene
signaling in Arabidopsis. Proc Natl Acad Sci U S A, 95, 5812-5817.
Sitbon, F., Hennion, S., Sundberg, B., Little, C.H.A., Olsson, O. and Sandberg, G.
(1992) Transgenic tobacco plants coexpressing the agrobacterium tumefaciens
180
iaaM and iaaH genes display altered growth and indoleacetic acid metabolism.
Plant Physiol., 99, 1062-1069.
Sorin, C., Bussell, J.D., Camus, I., Ljung, K., Kowalczyk, M., Geiss, G., McKhann,
H., Garcion, C., Vaucheret, H., Sandberg, G. and Bellini, C. (2005) Auxin and
light control of adventitious rooting in Arabidopsis require ARGONAUTE1.
Plant Cell, 17, 1343-1359.
Sorin, C., Negroni, L., Balliau, T., Corti, H., Jacquemot, M.P., Davanture, M.,
Sandberg, G., Zivy, M. and Bellini, C. (2006) Proteomic analysis of different
mutant genotypes of Arabidopsis led to the identification of 11 proteins
correlating with adventitious root development. Plant Physiol, 140, 349-364.
Stasinopoulos, T.C. and Hangarter, R.P. (1989) Preventing photochemistry in culture
media by long-pass light filters alters growth of cultured tissues. Plant Physiol, 93,
1365-1369.
Stepanova, A.N., Yun, J., Likhacheva, A.V. and Alonso, J.M. (2007) Multilevel
interactions between ethylene and auxin in Arabidopsis roots. Plant Cell, 19,
2169-2185.
Suttle, J.C. (1988) Effect of ethylene treatment on polar IAA transport, net IAA uptake
and specific binding of N-1-naphthylphthalamic acid in tissues and microsomes
isolated from etiolated pea epicotyls. Plant Physiol., 88, 795-799.
Swarup, R., Perry, P., Hagenbeek, D., Van Der Straeten, D., Beemster, G.T.,
Sandberg, G., Bhalerao, R., Ljung, K. and Bennett, M.J. (2007) Ethylene
upregulates auxin biosynthesis in Arabidopsis seedlings to enhance inhibition of
root cell elongation. Plant Cell, 19, 2186-2196.
181
Tieman, D.M. and Klee, H.J. (1999) Differential expression of two novel members of
the tomato ethylene-receptor family. Plant Physiology, 120, 165-172.
Torrey, J.G. (1976) Root hormones and plant growth. Ann Rev Plant Physiol, 27, 435459.
Tyburski, J. and Tretyn, A. (2004) The role of light and polar auxin transport in root
regenration from hypocotyls of tomato seedling cuttings. Plant Growth Reg, 42,
39-48.
Visser, E., Cohen, J.D., Barendse, G., Blom, C. and Voesenek, L. (1996) An EthyleneMediated Increase in Sensitivity to Auxin Induces Adventitious Root Formation
in Flooded Rumex palustris Sm. Plant Physiol, 112, 1687-1692.
Vrebalov, J., Ruezinsky, D., Padmanabhan, V., White, R., Medrano, D., Drake, R.,
Schuch, W. and Giovannoni, J. (2002) A MADS-box gene necessary for fruit
ripening at the tomato ripening-inhibitor (Rin) locus. Science, 296, 343-346.
Wilkinson, J.Q., Lanahan, M.B., Yen, H.C., Giovannoni, J.J. and Klee, H.J. (1995)
An ethylene-inducible component of signal transduction encoded by Never- ripe
Science, 270, 1807-1809.
Yen, H.C., Lee, S., Tanksley, S.D., Lanahan, M.B., Klee, H.J. and Giovannoni, J.J.
(1995) The tomato Never-ripe locus regulates ethylene-inducible gene expression
and is linked to a homolog of the Arabidopsis ETR1 gene. Plant Physiol, 107,
1343-1353.
Yokotani, N., Tamura, S., Nakano, R., Inaba, A., McGlasson, W.B. and Kubo, Y.
(2004) Comparison of ethylene- and wound-induced responses in fruit of wild-type, rin
and nor tomatoes. Postharvest Biology and Technology, 32, 247-252.
182
CHAPTER V
CONCLUSION
This research explored the mechanisms by which auxin and ethylene regulate
development of roots from the stem of plants, a process called adventitious root
formation. We have used Arabidopsis and its widely available mutants and transgenic
lines, as well as the agriculturally important species of tomato, with its more limited
genetics resources, to dissect the hormonal controls of development of adventitious roots,
as well as understand the species specific effect of hormones. These results have
uncovered a critical function for auxin and ethylene physiology in modulating the
development of adventitious roots.
Though adventitious roots serve numerous functions in plants, the ability to form
adventitious roots is species specific. We find that tomato forms many adventitious roots,
while Arabidopsis forms almost no adventitious roots, unless the base of hypocotyls and
roots has been excised. Root excision enhanced the formation of adventitious roots by
approximately 10-fold in Arabidopsis, while only a 2-3 fold increase with a similar
treatment was seen in tomato. This difference of the rooting between these plants makes
physiological sense in the context of the architecture of the shoot of these plants. Tomato
grows as a bushy vine, while Arabidopsis grows as a rosette. Tomato, if grown upright
can reach up to 5-6 meters, while Arabidopsis forms small stems, with inflorescences
reaching approximately 15-20 cm. Tomato, having a larger shoot structure, which grows
along the soil surface, possibly benefits from adventitious roots that increase the surface
area for nutrient and moisture uptake. Therefore an apparent selective advantage of
adventitious root formation is evident in tomato.
183
This thesis also examines the mechanism by which excision of stems can enhance
adventitious root formation and the role of auxin in this process. Stem cuttings, with or
without auxin treatments, have been used to propagate commercially important species
(reviewed in De-Klerk et al., 1999). Though this practice has been used for many years,
the mechanism by which cutting of stems induce adventitious roots is unknown. We
utilized Arabidopsis hypocotyls from which roots were excised. We have demonstrated a
positive role for shoot apex derived auxin and exogenously applied auxin in stimulation
of adventitious roots. Additionally, excision enhanced auxin transport from the shoots
leads to localized auxin accumulation above the site of excision. This change in auxin
accumulation was found to precede the development of adventitious roots. The change in
auxin accumulation was limited to 1-2 mm above the site of excision, coinciding with
positions of adventitious root formation. There was no change in overall free IAA levels
through out the hypocotyl as a result of excision. The lack of change is overall auxin
accumulation is consistent with previous studies looking for changes in free IAA levels
during the development of adventitious roots under different conditions. In apple stem
cuttings and flooded Rumex palustris no significant changes in free IAA levels were
found (reviewed in De-Klerk et al., 1999; Visser et al., 1996). These results are consistent
with changes in auxin distribution, rather than synthesis, leading to formation of
adventitious roots after excision, and suggest a role for auxin transport in this process.
Alterations in expression, activity and or localization of auxin transport proteins
are important in mediating changes driving physiological processes. We find that
excision enhanced auxin transport is mediated by auxin transport proteins ABCB19 and
PIN1, as defects in these proteins result in reduced adventitious root formation.
184
Additionally, we find increases in transcript levels of PIN1 with excision. In contrast,
changes in ABCB19-GFP protein accumulation were found without changes in transcript
levels. This change in protein accumulation may be due to dephosphorylation as
treatments with the phosphatase inhibitor, canthardin, causing reduction in accumulation
of ABCB19, and auxin transport in hypocotyls. Interestingly, canthardin treatments
changed the location of emergence of adventitious roots and associated auxin
accumulation, without altering the number of roots formed. These results suggest that
changes in transcription, as well as protein modifications, are involved in mediating auxin
transport that drives the formation of adventitious roots.
Our result that PIN1 mediated auxin transport is required for adventitious root
formation is consistent with OsRNAi lines of PIN1 in rice having reduced formation of
adventitious roots (Xu et al., 2005). Additionally, defects in a guanine nucleotide
exchange factor for ADP-ribosylation factor; GNOM, a known regulator of localization
of auxin transport protein in Arabidopsis, resulted in reduced formation of adventitious
roots as well as altered expression of PIN proteins in rice (Liu et al., 2009). Furthermore,
consistent with our observation that protein phosphorylation is involved in modulating
adventitious root formation, over expressing lines of PID (a serine theronine protein
kinase) was found to have delayed formation of adventitious roots in rice (Morita and
Kyozuka, 2007). This confirms that changes in auxin physiology involve modulation of
transcription as well as post-transcriptional changes during adventitious root formation.
Moreover the mediators of auxin transport required for adventitious root formation seems
to be conserved between at least some of the species.
185
Ethylene is involved in the regulation of lateral root formation in tomato and
Arabidopsis (Negi et al., 2008; Negi et al., 2010). Therefore, we asked if ethylene may
modulate adventitious root formation. Treatments with the ethylene precursor ACC
caused reduction of formation of adventitious roots in Arabidopsis. Mutants that are
insensitive to ethylene have enhanced adventitious root formation, while ethylene
overproducing and constitutive mutants have reduced formation of adventitious roots.
These results indicate that ethylene negatively regulates adventitious roots in Arabidopsis.
In contrast, in tomato both treatment with ACC and examination of mutants with
altered ethylene signaling and synthesis yielded an opposite conclusion. In wild type
treated with ACC, and in mutants with enhanced ethylene synthesis, tomato hypocotyls
formed enhanced number of adventitious roots, while ethylene insensitive mutants had
fewer adventitious roots than control wild type. Additionally, ACC treatment resulted in
the expansion of localization of formation of adventitious roots. The positive effect of
ethylene in our experiments is supported by previous experiments looking at the effect of
ethylene in tomato (Clark et al., 1999; Roy et al., 1972; Kim et al., 2008). These results
suggest that, opposite to the effect on Arabidopsis, ethylene positively regulates
adventitious root formation in tomato. Moreover, ethylene negatively regulates lateral
root formation in tomato. The positive effect of ethylene on adventitious root formation
seen in tomato might be a compensatory mechanism seen similar to that is reported for
plants growing under flooded conditions (Visser et al., 1996). Under flooded conditions,
the functioning of primary root and lateral root system is impaired by limited oxygen
exchange. Stimulation of growth of adventitious roots that are above the point of flooding
under such conditions would then help plants adapt to such situations. Thus, different
186
from auxin, which has a positive effect on adventitious roots in both species, the effect of
ethylene seems specific to the species and to the type of root development.
Ethylene-auxin cross talk has been shown to modulate other root processes such
as elongation, lateral root formation, and gravity response (Ruzicka et al., 2007; Negi et
al., 2008; Buer et al., 2006). Earlier studies have looked at this phenomenon during
adventitious root formation in several species of plants (Riov and Yang, 1989; Visser et
al., 1996; Clark et al., 1999), but there has been no study that utilized the genetic tools to
understand hormonal interaction modulating adventitious root formation. We examined
the role of ethylene in altering auxin transport and or synthesis in Arabidopsis and tomato
using mutants defective in ethylene signaling and synthesis, and find that ethylene
negatively regulates auxin transport without having an effect on overall free IAA levels
in both these species. The negative effect of ethylene on auxin transport in Arabidopsis
was in part due to its negative effect on ABCB19 accumulation. The relationship between
ethylene regulated changes in auxin transport and the adventitious root pattern is also
dissimilar between these species. Decreased auxin transport after ACC treatment
correlates with enhanced adventitious root formation in tomato, while ethylene induced
decrease in auxin transport in Arabidopsis is correlated with decrease in adventitious root
formation. The reason for this contrasting effect of ethylene on auxin transport and
adventitious root formation in two species is mysterious. Additionally, in Arabidopsis,
ethylene insensitive mutants exhibited enhanced local auxin accumulation, consistent
with its phenotype of increased adventitious root formation. This suggests that ethylene
negatively regulates auxin transport and local auxin accumulation in Arabidopsis.
187
Conditions of stress such as wounding induces accumulation of secondary
metabolites called flavonoids (reviewed in Winkel-Shirley, 2002). Flavonoids have been
shown to inhibit auxin transport in roots (reviwed in Winkel-Shirley, 2002; Buer and
Muday, 2004; Peer et al., 2004). We find that excision enhances flavonoid accumulation
regionally near the point of excision in Arabidopsis. This localized accumulation of
flavonoids may be important for blocking auxin out of hypocotyls, in turn resulting in
accumulation of auxin 1-2mm above the site of excision. Consistent with this hypothesis,
we find that the absence of flavonoids in tt4-2 mutants cause them to be less sensitive to
excision induced enhancement of adventitious root formation and auxin transport. This
change in flavonoid accumulation is at least partly due to changes in transcript
accumulation of enzyme involved in the flavonoid biosynthetic pathway, as determined
by qRT-PCR. Additionally, the eto1-1 mutant, which has increased ethylene synthesis,
was found to have enhanced accumulation of transcripts of the flavonoid biosynthetic
enzyme, suggesting that ethylene increases flavonoid accumulation. Thus, our results
suggest that flavonoids can regulate auxin transport and possibly auxin accumulation,
driving the formation of adventitious roots.
Few studies have looked at the importance of wound released compounds in
development of adventitious root formation. In apple stem cuttings, application of
wounding related compounds along with suboptimal IBA application, although not by
itself, was able to induce adventitious root formation (reviewed in De-Klerk et al., 1999).
No change is auxin accumulation was found in stem with treatment of wounding related
compounds (reviewed in De-Klerk et al., 1999). Conversely, in hypocotyls of Impatiens
balsamina, anthocyanin content and distribution was found to be under the regulation of
188
auxin, with enhanced anthocyanins increasing the formation of adventitious roots (Arnold
and Albert, 1964). But in the internode segments of sorghum, no correlation was found
between accumulation of anthocyanins and initiation of adventitious roots (Stafford,
1968). These reports indicate that there might be a complex relation between woundinduced compounds, including flavonoids, and their regulation of adventitious root
formation in different species.
Based on the results from these experiments, I propose a model to integrate the
events that are important for excision enhanced adventitious root formation in
Arabidopsis, as shown in Figure V-1 and V-II. Excision induces flavonoid accumulation
as soon as 4 hrs, followed by increased accumulation of auxin transport protein at 6hrs
after excision. This causes an increase in auxin transport. This movement of auxin is
blocked 1-2 mm above the site of excision, possibly caused by flavonoid accumulation,
resulting in local auxin accumulation at 9 hrs. This leads to cell division and
differentiation for the development of adventitious root formation, starting at 18 hrs after
excision. Emerged adventitious root can be seen 72 hrs after excision. Additionally,
treatment with ethylene causes reduction in auxin transport through increasing flavonoid
accumulation, decreasing the accumulation of ABCB19, resulting in reduced auxin
accumulation at the site of excision, and leading to reduced adventitious root formation.
Together these results have helped in unraveling the mechanism by which ethylene and
auxin regulate the process of adventitious root formation.
The next step in this project would be to further investigate whether flavonoids
directly interact with ABCB19 in regulating auxin transport and accumulation, and
identifying the target of canthardin. In addition, exploring the role of ABCB19 in
189
0 hrs Root excision
4 hrs
6 hrs
9 hrs
↑flavonoid accumulation
↑expression and accumulation
of auxin transport proteins
↑Local auxin induced gene
expression
18 hrs
Primordia formation
72 hrs
Emerged
adventitious roots
Increased movement of auxin
Local flavonoid accumulation
Accumulation of auxin
Adventitious root primordium
Emerged adventitious root
190
Figure V-1: Model for excision induced adventitious root formation.
In Arabidopsis, excision induces flavonoids accumulation blocks auxin movement
causing auxin accumulation above the site of excision which leads to development of
adventitious roots.
191
192
Figure V-1I: Cell model for excision induced adventitious root formation.
Excision enhances transport of auxin through increased transcription of PIN1 and
increased accumulation of ABCB19. This movement is blocked by flavonoid
accumulation causing enhanced auxin accumulation above the site of excision which
leads to development of adventitious roots. ACC treatment reduces auxin transport into
the cells, through decreasing ABCB19 accumulation and enhancing flavonoid
accumulation, which results in reduced auxin accumulation. This results in decreased
adventitious root formation.
193
adventitious root formation in tomato would provide insight into the role of these auxin
transport proteins in adventitious root formation across species. Thus, the experiments
detailed in this thesis provide a framework for understanding adventitious root formation.
194
Literature cited
Arnold AW, Albert SI (1964) Chemical facotrs affecting anthocyanin formation and
morphogenesis in culutured hypocotyl segments of Impateins balsamina. Plant
Physiol 39: 307-312
Buer CS, Muday GK (2004) The transparent testa4 mutation prevents flavonoid
synthesis and alters auxin transport and the response of Arabidopsis roots to
gravity and light. Plant Cell 16: 1191-1205
Buer CS, Sukumar P, Muday GK (2006) Ethylene modulates flavonoid accumulation
and gravitropic responses in roots of Arabidopsis. Plant Physiology 140: 13841396
Clark DG, Gubrium EK, Barrett JE, Nell TA, Klee HJ (1999) Root formation in
ethylene-insensitive plants. Plant Physiol 121: 53-60
De-Klerk G, Krieken W, DeJong J (1999) The formation of adventitious roots: New
concepts, new possibilities. In Vitro Cell Dev Biol-Plant 35: 189-199
Kim HJ, Lynch JP, Brown KM (2008) Ethylene insensitivity impedes a subset of
responses to phosphorus deficiency in tomato and petunia. Plant Cell Environ 31:
1744-1755
Liu SP, Wang JR, Wang L, Wang XF, Xue YH, Wu P, Shou HX (2009) Adventitious
root formation in rice requires OsGNOM1 and is mediated by the OsPINs family.
Cell Research 19: 1110-1119
Morita Y, Kyozuka J (2007) Characterization of OsPID, the rice ortholog of PINOID,
and its possible involvement in the control of polar auxin transport. Plant and Cell
Physiology 48: 540-549
195
Negi S, Ivanchenko MG, Muday GK (2008) Ethylene regulates lateral root formation
and auxin transport in Arabidopsis thaliana. Plant J 55: 175-187
Negi S, Sukumar P, Liu X, Cohen JD, Muday GK (2010) Genetic dissection of the
role of ethylene in regulating auxin-dependent lateral and adventitious root
formation in tomato. Plant J 61: 3-15
Peer WA, Bandyopadhyay A, Blakeslee JJ, Makam SI, Chen RJ, Masson PH,
Murphy AS (2004) Variation in expression and protein localization of the PIN
family of auxin efflux facilitator proteins in flavonoid mutants with altered auxin
transport in Arabidopsis thaliana. Plant Cell 16: 1898-1911
Riov J, Yang S (1989) Ethylene and Auxin-ethylene interaction in adventiitous root
formation in Mung bean (Vigna radiata) cuttings. Journal of Plant Growth
Regulation 8: 131-141
Roy B, Basu R, Bose T (1972) Interaction of auxins with growth-retarding, -inhibiting
and ethylene-producing chemicals in rooting of cuttings. Plant Cell Physiol 13:
1123-1127
Ruzicka K, Ljung K, Vanneste S, Podhorska R, Beeckman T, Friml J, Benkova E
(2007) Ethylene regulates root growth through effects on auxin biosynthesis and
transport-dependent auxin distribution. Plant Cell 19: 2197-2212
Stafford HA (1968) Relationships between the development of adventitious roots and
the biosynthesis of anthocyanins in first internodes of sorghum. Plant Physiol 43:
318-326
196
Visser E, Cohen JD, Barendse G, Blom C, Voesenek L (1996) An Ethylene-Mediated
Increase in Sensitivity to Auxin Induces Adventitious Root Formation in Flooded
Rumex palustris Sm. Plant Physiol 112: 1687-1692
Winkel-Shirley B (2002) Biosynthesis of flavonoids and effects of stress. Current
Opinion in Plant Biology 5: 218-223
Xu M, Zhu L, Shou HX, Wu P (2005) A PIN1 family gene, OsPIN1, involved in auxindependent adventitious root emergence and tillering in rice. Plant and Cell
Physiology 46: 1674-1681
197
APPENDIX
ADVENTITIOUS ROOTS AS A MODEL TO STUDY AUXIN CANALIZATION
Introduction
The plant hormone, auxin is thought to have a feedback regulation on localization
of efflux carriers (Paciorek et al., 2005). Relocalization of PIN1 proteins have been
observed during floral primordia development in shoots, which is attributed to local
changes in auxin concentration during primordia development. Additionally, auxin can
prevent internalization of efflux carriers and thus promote its own transport (Paciorek et
al., 2005). This suggests that there is an intricate connection between auxin transport and
efflux carrier localization to coordinate plant development and morphogenesis. The idea
that auxin can regulate its own transport is the central feature of the canalization
hypothesis proposed by Sachs (Sachs, 1981). This hypothesis suggests that auxin can
direct its own transport through a feedback effect, strengthening its polar movement.
Events leading to vascular development in cotyledons, leaves, and stems have been
proposed to be auxin driven based on this hypothesis (Sachs, 1986). This feedback by
auxin to regulate its own transport may occur at many levels including signaling,
synthesis, or localization of efflux carriers. The positive regulation of auxin on its own
transport through canalization has been proposed by Sauer et al during changes in auxin
accumulation induced by IAA treatments or during wounding and lateral root formation
(Sauer et al., 2007). They found changes in localization of PIN1 and PIN2 during these
processes, regulation of which was dependent on AUX/IAA and ARF signaling (Sauer et
al., 2007). In addition, two other experiments looked at auxin movements in stem cuttings
of Tomato and Tagetes and found contradictory physiological evidence on auxin induced
198
polar movement (Sheldrake, 1974,Went, 1941). Using Arabidopsis to study the
movement of auxin, provides an advantage as the wide array of mutants and transgenic
lines could be used to dissect the molecular mechanism of this process.
The goal of these experiments is to test whether the polarity of auxin transport can
be reversed by altering local auxin concentrations consistent with the canalization
hypothesis. These experiments utilize Arabidopsis hypocotyls and formation of
adventitious roots as a model system. Arabidopsis seedlings, when grown under low light
condition, form elongated hypocotyls, which can be induced to form adventitious roots.
Adventitious roots emerge at a specific location above the site of excision. We tested
whether changing auxin maxima from the apical end to basal end of the hypocotyl
explants would drive changes in auxin transport and thus location of adventitious root
formation. These experiments demonstrate that auxin transport is essential for
adventitious root formation and that the polarity of the stem segments is directly tied to
the source of auxin and its transport.
199
Results
Auxin polarity can be altered by changing auxin availability
We asked whether the polarity of auxin transport could be reversed in Arabidopsis
hypocotyls by changing the location of the auxin supply resulting in altered positioning
of adventitious root formation. Hypocotyl explants were prepared by removing the shoot
apex and cotyledons and by cutting 0.5-0.75cm of hypocotyls segments. Agar cylinders,
containing control agar or agar supplemented with 100 µM IAA was applied to the apical
or basal end of the hypocotyl explant. In addition, this experiment was performed with
hypocotyl explants in two orientations. Hypocotyl explants were oriented either vertically
or inverted and formation and position of adventitious roots were recorded 7 days after
treatment, as shown in Figure A-1 and Table A-I. Hypocotyl explants with control agar
applied locally did not produce any adventitious roots (A-1A). Application of an IAA
containing agar line at the apical end induced adventitious root formation at the basal end
of the hypocotyl. But a few roots also formed at the apical end in contact with the IAA
containing agar line (A-1A (ii),(iii)). When IAA was applied in similar dose at the apical
end, but hypocotyls were placed upside down, there were fewer adventitious roots formed,
as shown in Table A-I. This suggests that shoot apex can be replaced by external IAA
and that the orientation of the hypocotyl affects the magnitude of adventitious root
formation, consistent with basipetal IAA transport mediated delivery of IAA to the
hypocotyl base.
Hypocotyl explants treated with IAA applied at the basal end and oriented
vertically routinely formed a few adventitious roots at the root end in contact with agar.
200
A
B
Figure A-1: Shifting auxin maxima from apex to base of hypocotyl explant can change
the position of adventitious root formation and auxin accumulation.
(A)Hypocotyl explants were treated locally at the apical or basal end with 100µM IAA as
indicated by arrow heads. The position and number of adventitious roots were analyzed
seven days later. The vertical arrows indicate the direction of gravity. Scale bar is 1mm.
(B) Hypocotyl explants of AtGH3:GUS were treated locally with 100µM IAA and
changes in AtGH3:GUS expression was examined after 7 days in GUS stained and
201
cleared hypocotyl explants.; (i): control; (ii), (iii): IAA applied at the apical end; (iv), (v):
IAA applied at the basal end at the apical end, 100µM NPA was applied below the IAA
application in (iv). The vertical arrows indicate the direction of gravity. Scale bar is 1mm.
202
Table A-I: Changing local auxin maxima from apical end to basal end
changes the position of adventitious root formation.
IAA in μM
Site of
Orientation
Number of
adventitious
application
rootsa
Apex
Base
0±0
0±0
0
Apical end
upright
100
Apical end
upright
1.6±0.3 4.9±0.4
100
Apical end
inverted
0.4±0.2 3.1±0.3
100
Basal end
upright
0.2±0.1 2.9±0.3
100
Basal end
inverted
1.9±0.3 5.5±0.5
Hypocotyl explants were treated locally at the apical or basal end with
100µM IAA as indicated by arrow heads and position and number of
adventitious roots were analyzed 7 days later. Average and standard error
of 16-21 seedlings are reported
203
Occasionally, some of the hypocotyls formed adventitious root or primordia at the shoot
end (A-1A(iv)). Hypocotyls with IAA applied at the basal end but with the hypocotyl
explant inverted so that IAA was applied at the top, formed adventitious roots at the
apical end consistent with establishment of a new polarity in this tissue (A-1A(v)). This
suggests that IAA applied locally at the basal end could move towards the shoot end in
the acropetal direction, and induce adventitious root formation at the apical end. The
accentuated formation of adventitious roots at the apical end in seedlings with an inverted
orientation suggests that gravity may play a role in accelerating the reversed movement
of IAA.
To confirm that auxin transport is driving adventitious root formation at the shoot
end when applied at the root end, an agar line containing 100µM NPA was applied below
the agar line with 100µM IAA, and plates were oriented vertically or inverted. Most of
the hypocotyls treated with NPA produced few if any adventitious roots at the shoot end,
as shown in Figure A-1A(vi). (have to repeat the experiment) This suggests that the
formation of adventitious roots was as a result of polar auxin transport from the basal end
towards the apical end.
Auxin induced GUS expression can be seen during reversal of polarity
To look at changes in auxin accumulation with and without reversal of auxin
transport polarity during adventitious root formation, expression of the AtGH3:GUS
transgene was examined in response to local application of control agar and agar
containing 100µM IAA at the apical or basal end of hypocotyl explants (n =7-13) as
shown in Figure A-1B. None of the AtGH3:GUS hypocotyl explants with control agar at
204
the apical end, showed At GH3:GUS expression. In contrast, 90% of vertically oriented
and 100% of inverted hypocotyls with IAA applied at the apical end to mimic the normal
auxin stream had AtGH3:GUS expression at apical and basal ends. When IAA was
applied at the basal end to induce reversal of polarity, 60% of hypocotyls oriented
vertically showed staining only at the apical end, but when orientation was inverted all
the hypocotyls had GH3-GUS expression in both the apical and basal ends of hypocotyl
explants. All of these experiments are consistent with auxin application at the basal end
of hypocotyl explant driving auxin transport in the reverse or acropetal direction, when
gravity reinforces this polarity of auxin movement.
Acropetal auxin transport in the reverse direction was observed after polarity reversal
We asked whether conditions that reverse the polarity of adventitious root
formation also reverse the polarity of auxin movement. Explants were treated with IAA at
the apical or basal ends. After two days, 3H-IAA transport in both acropetal and basipetal
polarities of the hypocotyls were examined in 3mm sections during a 3 hour transport
assay, as shown in Figure A-2. Hypocotyls that had control agar treatment at the shoot
end exhibited background levels of transport. When the shoot apex was replaced with
IAA, basipetal transport was restored and acropetal IAA transport was low, consistent
with one single basipetal auxin transport stream in hypocotyls. In contrast, if IAA is
applied at the apical end and hypocotyls are inverted, the basipetal transport gets further
reduced while acropetal transport remains low. In upright hypocotyl explants with local
IAA treatment given at basal end, had stronger basipetal polarity of transport from the
apical end towards basal end with very low amounts of acropetal transport. But when
205
Figure A-2: Acropetal auxin transport can be observed after polarity reversal.
An agar cylinder containing radioactive IAA was applied at the apical or basal end after
removing the shoot apex of intact or excised 5 day old low light grown seedlings. 3mm
sections from the opposite end were removed after 3hrs and the amount of radioactive
IAA present in these sections were measured using a scintillation counter. Average ± std
error is given.
206
IAA was applied locally at the basal end and the hypocotyls were inverted, a higher
amount of acropetal transport from basal end to the apical end was observed in addition
to the basipetal auxin stream suggesting a bidirectional polarity. This result is consistent
with formation of a new polarity of IAA transport, even under conditions where the old
polarity is not totally lost. These polarity movements parallel the adventitious root
formation phenotype as adventitious roots formed at the apical end when auxin was
locally applied at the basal end with the inversion of hypocotyl explants.
207
Discussion
We asked if the inherent auxin transport polarity of hypocotyls which defines the
pattern of adventitious root development, could be reversed by altering the auxin maxima.
Hypocotyl explants were treated with IAA applied locally at either the apical or basal end
and the amount of auxin moving in both direction and the number of adventitious roots
formed at either end were quantified seven days later. Indeed, the shift of auxin maxima
from apical end to basal end induced a reversal in polarity of auxin transport from being
basipetal to acropetal as evident from both the direct measurement of IAA transport and
the induction of adventitious root emergence from the apical end. The canalization
hypothesis of auxin flow proposes that auxin has a positive effect on strengthening its
polar transport (Sachs, 1981) and these experiments extend this hypothesis to directly
demonstrate that a local auxin maxima can completely reverse the endogenous polarity of
a stem that is depleted of the endogenous auxin maxima.
A second reinforcing cue for this reversal of developmental polarity is gravity.
Changing auxin maxima to the basal end of hypocotyl explants induced acropetal
transport and adventitious roots formation at the apical end with higher frequency in
explants that were inverted. This suggests that gravity reinforced the flow of auxin which
drives canalization and leads to the change in developmental polarity resulting in
formation of adventitious roots at the apical end. Auxin transport changes in response to
gravity are well characterized. Gravity is known to induce lateral movement of auxin,
resulting in accumulation of auxin on the lower sides of stems and roots undergoing
gravitropic curvature (Muday and Rahman, 2008). This report suggests that local auxin
maxima and gravity are reinforcing cues to control auxin transport polarity.
208
Our results repeat and extend a previous study in which auxin was applied to the
apex of Tagetes stem segment to locally induced adventitious root formation (Went,
1941). When this segment was planted with the rooted apex below ground, stems
showed a reversal of auxin transport polarity when measured three weeks later (Went,
1941). The nodes in these inverted stems expanded and exhibited gravitropic
reorientation, but no developmental alterations in polarity were found. In contrast, in
young Arabidopsis hypocotyls, we were able to reverse both auxin transport and
developmental polarity.
The ability of auxin to regulate its own polar movement as suggested by
canalization hypothesis is a fascinating aspect of this hormone. Here we report evidence
that local IAA sources can reverse both auxin transport polarity and developmental
polarity, as reported by auxin transport measurements and adventitious root formation.
We have uncovered an important role of gravity in canalization flow of auxin. We find
that ABCB19 mediated transport is important for adventitious root formation and may be
essential for polarity reversal. Using Arabidopsis hypocotyls as a model system we have
provided additional evidence in support of the canalization hypothesis showing auxindependent changes in auxin transport and adventitious root formation.
209
Methods
Plant growth conditions
To induce reversal of polarity, agar lines with indicated amount of IAA or other
compounds were applied locally at either end of root excised hypocotyls after removal of
shoots. They were placed in vertical or inverted orientation with shoot apex up or down,
respectively under light intensity of 100 μmol m–2 s–1. Localized application of NPA was
done as a second agar cylinder below agar cylinder containing IAA. Observations on
position and number of emerged adventitious roots were performed after 7 days using a
dissecting microscope.
β –Glucuronidase staining
AtGH3:GUS transgenic seedlings were incubated in 2 mM GUS substrate (100
mM sodium phosphate buffer, 0.5% Triton X, 2mM X-gluc salt, 0.5 mM ferricyanide and
0.5mM ferrocyanide) at 37o C for overnight. Samples were then washed with 100 mM
sodium phosphate buffer, pH 7 and stored in 95% ethanol. The samples were analyzed
for localization of GUS staining using stereomicroscope (details are given below).
Microscopy
Quantification of adventitious roots was done using a dissecting microscope. GFP
fluorescence was observed using Zeiss LSM510 fluorescence laser scanning confocal
microscope. All images were taken at similar settings using 63X water immersion lens
with FITC narrow band filter. Pictures of hypocotyl explants were taken using EpiFluorescent Stereomicroscope (Leica MZ16 FA) and Sony Cyber Shot DSC -505v. All
210
pictures within an experiment were taken under similar settings, unless indicated
otherwise.
Auxin transport measurements in hypocotyl
To measure auxin transport after reversal of polarity, agar lines with indicated
amount of IAA was applied locally at either end of root excised hypocotyls of 5 day old
low light grown seedlings, after removal of shoots. They were placed in vertical or
inverted orientation with shoot apex up or down, respectively and placed under light
intensity of 100 μmol m–2 s–1 with yellow filter. After two days, agar lines were replaced
with agar lines containing tritiated IAA and were transferred to dark. After 3hrs, 3mm
sections from either end were taken and quantified using scintillation counter.
211
Literature cited
Muday GK, Rahman A (2008) Auxin transport and the integration of gravitropic
growth. In S Gilroy, P Masson, eds, Plant Tropisms. Blackwell Publishing,
Oxford, pp 47-78
Paciorek T, Zazimalova E, Ruthardt N, Petrasek J, Stierhof YD, Kleine-Vehn J,
Morris DA, Emans N, Jurgens G, Geldner N, Friml J (2005) Auxin inhibits
endocytosis and promotes its own efflux from cells. Nature 435: 1251-1256
Sachs T (1981) The control of the patterned differentiation of vascular tissues. Adv. Bot.
Res 9: 151-162
Sachs T (1986) Cellular patterns determined by polar transport. In M Bopp, ed, Plant
Growth Substances 1985. Springer-Verlag, Berlin Heidelberg, pp 231-235
Sauer M, Balla J, Luschnig C, Wisniewska J, Reinohl V, Friml J, Benkova E (2007)
Canalization of auxin flow by Aux/IAA-ARF-dependent feedback regulation of
PIN polarity (vol 20, pg 2902, 2006). Genes & Development 21: 1431-1431
Sheldrake A (1974) Polarity of auxin transport in inverted cuttings. New Phytologist 73:
637-642
Went F (1941) Polarity of auxin transport in inverted Tagetes cuttings. Botanical Gazette
103: 386-390
212
CURRICULUM VITAE
POORNIMA SUKUMAR
Department of Biology
Wake Forest University, Box 7325
Winston-Salem, NC, 27109
Educational Experience:
•
Ph.D. (ABD),
Grade Point Average: 3.9/4.0
Wake forest University, Winston Salem,
NC.
Advisor Name: Dr. Gloria K. Muday.
2006-Present
Dissertation: Plant Physiology: Hormonal Regulation of Adventitious Root
Formation in Arabidopsis and Tomato.
•
Master of Science in Biology,
Grade Point Average: 3.9/4.0
Wake Forest University, Winston-Salem,
NC.
Advisor Name: Dr. Gloria K. Muday.
2004-2006
Thesis: Role of Auxin Transport in the Photomorphogenic Mutant hy5.
•
Bachelor of Science in Agriculture,
Grade Point Average: 9.0/10
(Ranked 1st in the University),
Kerala Agricultural University, India.
1999-2003
Research Experience:
•
•
•
•
•
Laboratory experience in plant physiology
o Modulation of auxin transport during plant responses to gravity, wounding.
o Molecular techniques ( e.g. RT-PCR).
Microscopy techniques: Confocal laser scanning microscope, Epifluoresecent
microscope, Compound microscopes, & Stereomicroscope
Biologist in a in-class bioinformatics project aimed at developing a software to
identify protein spots in 2 D gels.
Green house assistant for the Department of Biology, Wake Forest University,
Winston-Salem.
Field experience growing research tomatoes.
213
•
Trained in quantification of free auxin in tissue using GC-Mass Spectrometry in
Dr Jerry Cohen’s lab, University of Minnesota, St Paul, Minnesota.
Teaching Experience:
•
•
Teaching assistant: Biochemistry 670: 2009 Fall
Teaching Assistant: Cell Biology 214: 2009 Spring
•
•
•
•
•
•
•
Microscopy Teaching Assistant: 2007 Fall
Teaching Assistant: Cell Biology 214: 2006 Fall
Teaching Assistant: Cell Biology 214: 2006 Spring
Teaching Assistant: Biochemistry 670: 2005 Fall
Teaching Assistant: Comparative Physiology 112: 2005 Spring
Teaching Assistant: Comparative Physiology 112: 2004 Fall
Trained undergraduate students in the laboratory during Ph.D. studies-2006present
BIBILIOGRAPHY
Journal Publications:
•
•
•
•
•
•
•
Sukumar P, Muday GK (2010) “Polar auxin transport by MDR1 drives
adventitious root formation in Arabidopsis” in preparation.
Negi S*, Sukumar P*, Liu X, Cohen J, Muday GK (2010) "Genetic dissection of
the role of ethylene in regulating auxin dependent lateral and adventitious root
formation in tomato" Plant Journal 61;3-15.
Chen, Z. Y., Noir, S., Kwaaitaal, M., Hartmann, H. A., Wu, M. J., Mudgil, Y.,
Sukumar, P., Muday, G., Panstruga, R., and Jones, A. M. J. (2009) "Two seventransmembrane domain MLO proteins co-function in root thigmomorphogenesis"
Plant Cell 21;1972-1991.
Sukumar P*, Edwards KS*, Rahman A, Delong A, Muday GK (2009)" PINOID
kinase regulates root gravitropism through modulation of PIN2-dependent
basipetal auxin transport in Arabidopsis" Plant Physiology 150(2) 722-735.
Sibout R, Sukumar P, Hettiarachchi C, Holm M, Muday GK, Hardtke CS (2006)
"Opposite root growth phenotypes of hy5 versus hy5 hyh mutants correlate with
increased constitutive auxin signaling" PLoS Genet 2(11); 1898-191.
Buer CB, Sukumar P, Muday GK (2006)"Ethylene modulates flavonoid
accumulation and gravitropic response in roots of Arabidopsis thaliana" Plant
Physiology, 140(4);1384–1396.
co-authorship
Poster Abstracts:
214
•
•
•
•
•
•
•
•
•
•
•
•
Sukumar P and Muday GK (2009) “Ethylene and auxin cross talk regulates
adventitious root formation in Arabidopsis and Tomato”, 8th International
Conference on Ethylene, Ithaca, NY, USA.
Sukumar P and Muday GK (2009) 'Role of auxin and ethylene in adventitious
root formation in Arabidopsis and Tomato', 9th Annual Graduate Student research
day, Wake Forest University, NC, USA.
Sukumar P and Muday GK (2008) "Polar auxin transport drives adventitious root
formation", 22nd Annual Plant Molecular Biology Meeting, Asheville, NC, USA.
Sukumar P and Muday GK (2008) “Role of auxin and ethylene in adventitious
root formation in Arabidopsis and Tomato” American Society of Plant Biologists,
Merida, Mexico.
Sukumar P and Muday GK (2008) “Role of auxin and ethylene in adventitious
root formation in Arabidopsis”, 8th Annual Graduate Student Research Day, Wake
Forest University, NC, USA
Sukumar P and Muday GK (2007) “Role of auxin and ethylene in adventitious
root formation in Arabidopsis” 21st Annual Plant Molecular Biology Retreat,
Wilmington, NC, USA.
Sukumar P and Muday GK (2007) "Role of auxin and ethylene in adventitious
root formation in Arabidopsis” American Society of Plant Biologists, Chicago,
Illinois, USA.
Sukumar P and Muday GK (2006) “Role of auxin and ethylene in adventitious
root formation in Arabidopsis”, FASEB, Vermont, USA.
Barnard R, Kolb B, Scott W, Sukumar P, Olex A (2006) 'Bioinformatics: Protein
spot identification tool, 6th Annual Graduate Student Research Day, Wake Forest
University, NC,USA.
Sukumar P, Hardtke CS, Muday GK (2006) “Defects in gravity response and
lateral root growth in hy5 are flavonoid independent”, 6th Annual Graduate
Student Research Day, Wake Forest University, NC, USA.
Sukumar P, Hardtke CS, Muday GK (2005)“Defects in gravity response and
lateral root growth in hy5 are flavonoid independent” 19th Annual Plant Molecular
Biology Retreat, Willmington, NC, USA.
Sukumar P, Hardtke CS, Muday GK (2005) 'Defects in gravity response and
lateral root growth in hy5 are flavonoid independent' 5th Annual Graduate Student
Research Day, Wake Forest University, NC, USA.
Conferences:
•
•
•
8th International Conference on Ethylene 2009 from 21st to 25th June in Ithaca,
New York and presented a poster-“Ethylene and auxin cross talk regulates
adventitious root formation in Arabidopsis and Tomato”.
Annual Graduate Student Research day, 6th April 2009, Wake Forest University,
NC, and presented a poster – “Role of auxin and ethylene in adventitious root
formation in Arabidopsis and Tomato”.
Perspectives in Biology Symposium 2008, 14th Nov, Wake Forest University, NC,
poster- “Role of auxin and ethylene in adventitious root formation in
Arabidopsis”.
215
•
•
•
•
•
•
•
•
•
Annual 22nd Plant Molecular Biology Retreat 2008, 26th to 28th Septemeber,
Asheville, NC, USA.
American Society of Plant Biologists 26th to 30th June 2008 plant biology meeting
in Merida, Mexico, presented a poster- “Role of auxin and ethylene in
adventitious root formation in Arabidopsis and Tomato”.
Annual Graduate Student Research day, 5th March 2008, and presented a poster“Role of auxin and ethylene in adventitious root formation in Arabidopsis”.
Annual 21st Plant Molecular Biology Retreat 28th to 30th Sep 2007, and presented
a poster- “Role of auxin and ethylene in adventitious root formation in
Arabidopsis”.
American Society of Plant Biologists 2007 Plant Biology meeting in Chicago and
presented a poster- “Role of auxin and ethylene in adventitious root formation in
Arabidopsis”.
Perspectives in Biology Symposium 2006, 10th-11th Nov, Department of Biology,
WFU.
FASEB 2006 conference on Mechanisms of plant development held in Vermont,
Aug 5th to 9th and presented a poster- “Role of auxin and ethylene in adventitious
root formation in Arabidopsis”.
Sixth Annual Graduate Student Research Day, 24th March 2006, Wake forest
University, Winston-Salem, NC, and presented posters-“Bioinformatics: Protein
spot identification tool” and “ Defects in gravity response and lateral root growth
in hy5 are flavonoids independent”.
19th Annual Plant Molecular Biology Retreat from Sep 30th to Oct 2nd 2005 and
presented a poster-“Defects in gravity response and lateral root growth in hy5 are
flavonoid independent”.
Talks:
•
•
•
“Adventitious root formation: Unraveling hormonal cross talk’, Departmental
seminar, Department of Biology, Wake Forest University, Winston-Salem, NC,
March 31st, 2010
“Polar auxin transport drives adventitious root formation”, Annual 22nd Plant
Molecular Biology Retreat 2008, Asheville, NC - 26th-28th of September, 2008.
“Role of flavonoids during gravity response and root formation in Arabidopsis”,
Departmental seminar, Department of Biology, Wake Forest University, WinstonSalem, NC, 4th April, 2006.
Awards & Honors
•
•
•
Tuttle-Newhall Travel Fund, 2009- to attend 8th International Conference on plant
hormone ethylene in Ithaca, NY.
Elton C. Cocke Travel Fund, 2008 to attend ASPB 2008 meeting in Merida,
Mexico.
1st place in poster competition- 8th Annual Graduate Student Research Day, 2008.
216
•
•
•
•
•
•
•
•
Vecellio Fund, Department of Biology, 2008-to meet expenses to work in Dr
Jerry Cohen’s lab in University of Minnesota.
Elton C. Cocke Travel Fund, 2007- to attend ASPB 2007 meeting in Chicago.
Vecellio Fund, Department of Biology, 2007- to attend ASPB 2007 meeting in
Chicago.
Wake Forest Alumni Travel award, 2006 - to attend FASEB meeting in Vermont.
Indian Council of Agricultural Research (ICAR) Merit Scholarship (Based on
Grade Point Average).
Kerala Agricultural University Merit Scholarship: Based on CBSE % marks
(High School).
Kochi Refineries Limited Scholarship (Won by students who get into professional
programs in Universities, directly from high school).
Duke of Edinburg: Bronze Medal for Extracurricular activities.
Professional Development Activities
•
•
•
•
Attend the Cell and Molecular Biology lunch group at Department of Biology,
which discusses molecular and cell biolgy research, 2006-present.
Attend relevant bioinformatics meetings at Department of Computer scicence,
Wake Forest University, 2007-present.
Member of American Society of Plant Biologists, 2007-present.
Member of Wake Forest University Graduate Student Association, 2004-present.
Selected Courses:
PhD & Masters:
• Teaching Skills and Instructor Devlopment
• Biochemistry
• Molecular Biology
• Microscopy
• Statistics: Research design and Analysis I
• Bioinformatics
Bachelors Degree:
• Molecular Biology,
• Biotechnology-I, Biotechnology-II
• Anatomy, Embryology
• Cytology,
• Principles of Genetics
• Crop Physiology
• Microbiology-I & II
• Agricultural Biochemistry
217