RESEARCH ARTICLE
Genetic diversity of symbiotic cyanobacteria in Cycas revoluta
(Cycadaceae)
Shuntaro Yamada, Satoshi Ohkubo, Hideaki Miyashita & Hiroaki Setoguchi
Graduate School of Human and Environmental Studies, Kyoto University, Yoshida-nihonmatsucho, Sakyo-ku, Kyoto, Japan
Correspondence: Hiroaki Setoguchi,
Graduate School of Human and
Environmental Studies, Kyoto University,
Yoshida-nihonmatsucho, Sakyo-ku, Kyoto
606-8501, Japan. Tel.: +81 75 753 6860;
fax: 075 753 6694; e-mail:
[email protected]
Received 2 December 2011; revised 17 April
2012; accepted 19 April 2012.
Final version published online 23 May 2012.
DOI: 10.1111/j.1574-6941.2012.01403.x
MICROBIOLOGY ECOLOGY
Editor: Angela Sessitsch
Keywords
coralloid root; cycad; Cycas revoluta; DGGE;
genetic diversity; Nostoc.
Abstract
The diversity of cyanobacterial species within the coralloid roots of an individual and populations of Cycas revoluta was investigated based on 16S rRNA
gene sequences. Sixty-six coralloid roots were collected from nine natural populations of cycads on Kyushu and the Ryukyu Islands, covering the entire distribution range of the species. Approximately 400 bp of the 5′-end of 16S
rRNA genes was amplified, and each was identified by denaturing gradient gel
electrophoresis. Most coralloid roots harbored only one cyanobiont, Nostoc,
whereas some contained two or three, representing cyanobiont diversity within
a single coralloid root isolated from a natural habitat. Genotypes of Nostoc
within a natural population were occasionally highly diverged and lacked DNA
sequence similarity, implying genetic divergence of Nostoc. On the other hand,
Nostoc genotypes showed no phylogeographic structure across the distribution
range, while host cycads exhibited distinct north–south differentiation. Cycads
may exist in symbiosis with either single or multiple Nostoc strains in natural
soil habitats.
Introduction
Many land plants can form symbiotic associations with
nitrogen-fixing cyanobacteria. These cyanobacteria have
symbiotic associations with fungi (Geosiphon and lichens),
bryophytes (liverworts and hornworts), pteridophytes
(Azolla), gymnosperms (Cycadaceae), and angiosperms
(Gunnera) (Bergman et al., 1996; Rai et al., 2000).
Cycads are an ancient group of seed plants that have
existed for approximately 300 million years. In general,
cycads develop three types of roots: a tap root, which is
equivalent to the primary root system found in most
types of plants, lateral roots, and ‘coralloid roots’, which
are highly specialized lateral roots containing cyanobionts
(Costa & Lindblad, 2002). Mature coralloid roots are
thick, finger-like structures usually embedded in soil at a
shallow depth. Cyanobionts are restricted to the intercellular region of the cortex where they grow in a microaerobic and dark environment. Although not actively
photosynthesizing, they maintain their clear green color
in this environment (Costa & Lindblad, 2002). Nostoc
spp. are the most common cyanobionts in Cycadaceae,
whereas Anabaena and Calothrix species form symbiotic
associations less frequently (Obukowicz et al., 1981; Zhu,
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
1982; Grobbelaar et al., 1986). All known cycad cyanobionts are of the botanical order Nostocales (Komarek
& Anagnostidis, 1989). Several hypotheses of the mechanism of cyanobiont infection have been suggested, but
the details are yet to be determined.
Costa et al. (1999) collected 11 coralloid roots from
cycads cultivated in a botanical garden, including the genera Cycas, Encephalartos and Zamia. Only a single Nostoc
strain was detected in each coralloid root, based on DNA
sequence analyses of the tRNALeu (UAA) intron. They
also determined Nostoc diversity within single or multiple
coralloid root(s) of individual plants. Zheng et al. (2002)
collected coralloid roots from indigenous cycad plants in
a Chinese national park and found a large variety of
cyanobacteria in a single coralloid root using polymerase
chain reaction (PCR) fingerprinting. They also suggested
that different strains of cyanobacteria could exist in the
apical, middle and basal parts of a single coralloid root.
However, Costa et al. (2004) suggested that the finding of
multiple strains of cyanobacteria by Zheng et al. (2002)
was likely due to a methodological limitation of fingerprinting: fingerprinting patterns may differ according to
the DNA extraction method used, even with identical
DNA samples. Costa et al. (2004) also pointed out that
FEMS Microbiol Ecol 81 (2012) 696–706
Genetic diversity of symbiotic Nostoc in Cycas
the results of Zheng et al. (2002) would be hard to corroborate, as no plant or bacterial controls were used.
Thus, the number of cyanobiont strains that exist in a
single coralloid root remains uncertain. Costa et al.
(2004) also identified only a single strain of Nostoc within
individual coralloid roots and in individual plants of
indigenous cycads by sequencing of the tRNALeu (UAA)
intron. They also found that plants growing in close
proximity (female plants and their offspring) shared the
same cyanobionts in their coralloid roots, suggesting a
selective mechanism between the host plant and its cyanobionts. However, most previous studies used coralloid
roots collected from botanical gardens and/or greenhouses. Zheng et al. (2002) used coralloid roots collected
from cultivation in China and greenhouse specimens
from Stockholm. The latter source exhibited lower cyanobiont species diversity. Gehringer et al. (2010) were the
first to report the use of samples collected from their natural habitats. They collected coralloid roots from 31 Macrozamia species throughout their distribution range in
Australia and sequenced the 16S rRNA genes. The data
confirmed that coralloid roots harbored a single Nostoc
strain, and the same strain was sometimes symbiotic with
cycads in several locations. Host specialization of cyanobionts within the cycad genus Macrozamia was not
observed in the wild.
In general, host specialization of the genus Nostoc is
low (O’Brien et al., 2005). However, the water fern Azolla
harbors unique cyanobionts: Papaefthimiou et al. (2008)
analyzed the phylogeny of plural strains of symbiotic
cyanobacteria and free-living cyanobacteria and found a
robust cluster of Azolla symbionts, corroborating that the
association of a unique cyanobacterial type with a host
plant is strict and selective. They assumed that this may
have been caused by coevolution and that Azolla symbiosis might have evolved in an aquatic environment.
Cycas revoluta Thunb. grows on rocky and sandy coasts
of southern Japan, ranging from southern Kyushu to the
most southern edge of the Ryukyu Islands (Fig. 1). Thus,
distribution of C. revoluta is mostly isolated and scattered
on islands and its range is wide, approximately 900 km in
a northeast–southwest direction. This plant is a 1.5–5-mtall dioecious tree that produces large seeds approximately
4 cm in length and 3 cm in width (Yamazaki, 1995).
Because fertile seeds sink in seawater, seed dispersal of
C. revoluta is thought to be limited, and dispersal over
the sea is likely problematic. Phylogeography of this cycad
is highly geographically structured: chloroplast and mitochondrial DNA haplotype analysis indicated two major
areas, comprising northerly and southerly populations
that were demarcated north and south of Okinoerabujima
(Kyoda & Setoguchi, 2010). In addition, leaflet margin
morphology also exhibited north–south differentiation
FEMS Microbiol Ecol 81 (2012) 696–706
697
(Setoguchi et al., 2009). The phylogeographic structure of
C. revoluta is assumed to be determined by the formation
and division of a landbridge between mainland Asia and
Kyushu via the Ryukyu Islands during the Quaternary climatic oscillations (Kizaki & Oshiro, 1977, 1980; Ujiie,
1990; Kimura, 1996, 2000). However, no phylogeographic
study of cyanobionts in Cycas coralloid roots has been
conducted. Nostoc can be common in the environment,
but the cycad cyanobionts might also exhibit a phylogeographic structure across the distribution range if they
share the host plant’s migration history. In contrast, multiple Nostoc strains can occur in the environment, and so
cycad coralloid roots may use indigenous strain(s). In the
latter case, no phylogeographic structure would be
observed among cycad cyanobionts in the habitats of the
Ryukyu Islands and Kyushu.
We aimed to investigate the genetic diversity of cyanobionts within single or multiple coralloid root(s) of
individual plants, among the coralloid roots of individual
plants and within populations of C. revoluta. All materials
were collected from natural populations. In addition, we
studied the phylogeography of the coralloid root cyanobionts in relation to their host cycads across their distribution range in the Ryukyu Islands and Kyushu. We
amplified cyanobacterial 16S rRNA genes, and genotyping
Fig. 1. Coralloid root sampling locations. Locations of the nine
sampling sites on the Ryukyu Islands and Kyushu. Population name
abbreviations correspond to those in Table 1. (Inset) Location of the
Ryukyu Islands and Kyushu.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
S. Yamada et al.
698
was conducted by a combination of denaturing gradient
gel electrophoresis (DGGE) and sequencing.
Materials and methods
Sampling
The coralloid roots used in this study were collected from
natural C. revoluta habitats across its entire distribution
range. Details of sampling localities, coordinates, numbers
of samples, and abbreviations of localities are presented
in Fig. 1 and Table 1. Coralloid roots were excavated
from the ground at less than 10 cm in depth and stored
at 4 °C until DNA extraction.
At population Mt (Miyazaki: Toi Cape), two and nine
coralloid roots were excavated from the same cycad individual and in a very narrow area (approximately < 4 m2),
respectively, to detect genotype polymorphisms. In total,
66 coralloid roots were collected from nine populations.
DNA extraction and genotyping
The collected coralloid roots were initially washed in running water, then the surfaces were washed again for
10 min in distilled sterilized water using supersonic
waves. Next, coralloid roots were sectioned at the apical
and middle parts (see Fig. 2) following Zheng et al.
(2002). Each part was cut in round slices using a sterile
scalpel; then, the epidermal layers (including the nongreen part of the outer layer of the cortex) were removed
with a sterile scalpel under a stereomicroscope. Finally,
only the green-colored layer of the cortex (presumably
containing cyanobionts) was recovered with a sterile
needle.
Cyanobionts from each section were collected in
555 lL of cetyltrimenthyl ammonium bromide (CTAB:
0.02% w/v, pH 8.0 with 1 M Tris-HCl buffer). They were
homogenized, and DNA was extracted using the CTAB
method (Doyle & Doyle, 1990). The extracted DNA was
dissolved in 50 lL of TE buffer.
In addition, we extracted DNAs from ten C. revoluta
leaves from ten populations from the Ryukyu Islands to
examine DNA sequences of the cyanobacterial 16S rRNA
gene using the same primers below (as controls).
The cyanobacterial 16S rRNA gene was used for genotyping of symbiotic cyanobionts in C. revoluta coralloid
roots. In the first step, we conducted genotyping by DGGE
analysis using ~ 400 bp of the 5′-side of the 16S rRNA
gene. Mixtures of DNA from the apical and middle parts
of coralloid roots were used to detect polymorphisms
within single coralloid roots. In cases of polymorphic genotypes, we amplified and reanalyzed the same region using
DNA from the apical and middle parts separately. Each
band with different electrophoretic mobility was excised
and subjected to direct sequencing. In addition, several
samples were subjected to sequencing of ~700 bp of the 5′side of the 16S rRNA gene, as described later.
In the first step, the cyanobacterial 16S rRNA gene was
amplified using the forward primer 16S353F with a GC
clamp at its 5′-end and reverse primers 16S781R(a) and
16S781R(b) (see Fig. 3 for primer positions). Primer
information is presented in Table 2. Primers 16S359F and
16S781R, reported by Nübel et al. (1997), have been
commonly used for specific amplification of the cyanobacterial 16S rDNA fragment (e.g. Boutte et al., 2006,
2008). PCR was conducted in a total reaction volume of
20 lL containing 6.9 lL of autoclaved ion-exchanged
water, 10 lL of Ampdirect Plus (Shimadzu, Kyoto,
Japan), 0.1 lL of Ex Taq (Takara Bio, Ohtsu, Japan),
1.0 lL of each primer, and 1.0 lL of template DNA. PCR
was performed using the following protocol 1: 95 °C for
1 min, 20 cycles at 95 °C for 30 s, 65 °C (one cycle, this
temperature fell 0.5 °C) for 30 s, and 72 °C for 60 s; 10
cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for
60 s; and a final elongation cycle at 72 °C for 10 min.
PCR products were then visualized on 0.59 TAE-agarose
gels strained with ethidium bromide.
The PCR products were used for DGGE analysis on a
Dcode Universal Mutation Detection System (Bio-Rad
Laboratories Inc., Hercules, CA), as described by Boutte
Table 1. Sampling localities, number of coralloid roots and genotypes
Name
Localities
Latitude (N)
Longitude (E)
Number
of samples
Number of
genotypes
Mt
Aa
As
Tk
Oh
Os
My
Ik
Yk
Kushima City, Toi Cape (Miyazaki Pref.)
Amamioshima Isl., Ayamaru Cape (Kagoshima Pref.)
Amamioshima Isl., Setouchi (Kagoshima Pref.)
Tokunoshima Isl., Kanami Cape (Kagoshima Pref.)
Okinawa Isl., Hedo Cape (Okinawa Pref.)
Okinawa Isl., Sezokojima (Okinawa Pref.)
Miyakojima Isl., Ikema (Okinawa Pref.)
Ishigakijima Isl., Kabira (Okinawa Pref.)
Yonagunijima Isl., Kubura (Okinawa Pref.)
31°21′
28°28′
28°09′
27°53′
26°51′
26°38′
24°55′
24°28′
24°27′
131°20′
129°42′
129°17′
128°58′
128°14–15′
127°51′
125°14′
124°06′
122°56′
26
12
2
4
5
1
5
5
6
15
9
1
1
6
2
2
4
1
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
FEMS Microbiol Ecol 81 (2012) 696–706
Genetic diversity of symbiotic Nostoc in Cycas
699
(b)
(a)
a
m
Fig. 2. Morphology of coralloid roots of Cycas
revoluta. (a) Gross morphology and (b) tip of a
coralloid root. Cyanobionts were collected
from the apical (a) and middle (m) positions.
Fig. 3. Positions of primers used for PCR and sequencing of the 16S
rRNA gene and adjacent regions. The black and white triangles
indicate forward and reverse primers, respectively.
et al. (2006). Each PCR product (15 lL) was applied
directly onto a 9% (w/v) polyacrylamide gel in 0.59 TAE
buffer (40 mM Tris-base, 20 mM acetic acid, 10 mM
EDTA, pH 8.0) with a linear 30% to 60% denaturant gradient [100% denaturant solution was defined as 7 M urea
and 40% (v/v) formamide]. The gels were run at a constant temperature of 60 °C at 100 V for 13 h. PCR products were visualized with SYBR Gold (Invitrogen,
Carlsbad, CA). Bands that were visible by the naked eye
were excised from the DGGE gel on a blue light transilluminator (UVP, Upland, CA).
Excised bands were kept in 50 lL of TE buffer at
30 °C for 1 h. Frozen liquid was kept at 95 °C for
10 min and the DNA eluted from the gel (gel and
1 cm
liquid containing DNA can be separated in a sampling
tube). DNA was re-amplified using the primers
16S353F and 16S781R(a) or 16S781R(b) with protocol
1. PCR products were visualized on 0.59 TAE-agarose
gels stained with ethidium bromide. The PCR products
were sequenced using the standard methods of the BigDye Terminator Cycle Sequence Ready Reaction Kit
(Applied Biosystems, Foster City, CA, USA) using the
primers 16S353F, 16S359F, or 16S781R(a) and 16S781R
(b) on an ABI 3130 Genetic Analyzer (Applied Biosystems).
The sequences obtained together with those of representative reference strains were aligned using CLUSTAL X
(Thompson et al., 1997); end gaps were removed, and the
~ 300–350-bp sequences were realigned. A phylogenetic
tree based on neighbor-joining (NJ) was generated from
~ 310-bp sequences using CLUSTAL X (Thompson et al.,
1997) with 1000 bootstrap resampling events.
Identification of cyanobionts exhibiting unique
DNA sequences
Because some samples were suggested in the phylogenetic
analysis to nest outside of the Nostoc clade (Aa 10-7, Ik
Table 2. Primers information used in this study
Primer
Sequence (5′–3′)
Target site
Reference
16S353F
GC-16S353F
16S359F
16S781R(a)
16S781R(b)
16S1371Ra
16S1371Rb
16S1371Rc
23S30R
GC clamp
AGCAGTGGGGAATTTTCCGC
GCclamp-AGCAGTGGGGAATTTTCCGC
GGGGAATTTTCCGCAATGGG
GACTACTG G GGTATCTAATCCCATT
GACTACAGGGGTATCTAATCCCTTT
GTTRCRGTAAYGACTTCGGGCRTGA
GTTRCRGTAAYGACTTCGGGCGTKG
GTTRCRGTAAYGACTTCGGGCWTGG
CTTCGCCTCTGTGTGCCTAGGT
CGCCCGCCGCGCCCCGCGCCGGTCCC
GCCGCCCCCGCCCG
353–372
353–372
359–378
781–805
781–805
1371–1395
1371–1395
1371–1395
30–52
Ohkubo et al. (2006)
Ohkubo et al. (2006)
Nübel et al. (1997)
Nübel et al. (1997)
Nübel et al. (1997)
Murakami et al. (2004)
Murakami et al. (2004)
Murakami et al. (2004)
Murakami et al. (2004)
Target site indicates Escherichia coli numbering of 16S or 23S rRNA nucleotides.
16S353F is reconstructed a forward primer CYA359F.
FEMS Microbiol Ecol 81 (2012) 696–706
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
S. Yamada et al.
700
1-17, Ik 5-20, Mt 11-26, and Mt 15-28), they were further
amplified to obtain longer sequences using the forward
primer 16S353F and the reverse primer 23S30R. PCR was
conducted in a total reaction volume of 10 lL containing
1.6 lL of autoclaved ion-exchanged water, 5.0 lL of Multiplex (Qiagen, Hilden, Germany), 1.0 lL of each primer,
and 1.4 lL of template DNA. PCR was performed using
the following protocol: 95 °C for 15 min, 20 cycles at
95 °C for 30 s, 65 °C (by one cycle, this temperature fell
0.5 °C) for 90 s, and 72 °C for 2 min; 15 cycles at 95 °C
for 30 s, 55 °C for 90 s, and 72 °C for 2 min; and a final
elongation cycle at 72 °C for 10 min. PCR products were
visualized on 0.59 TAE-agarose gels stained with ethidium bromide.
Amplified DNA was used as the template in the following nested PCR. PCR products were diluted with autoclaved ion-exchanged water (about 10 times volume) and
subjected to nested PCR using the forward primer 16S353F
and the reverse primers 16S1371Ra or 16S1371Rb, or
16S1371Rc [Primers 16S1371R(a), 16S1371R(b), and 16S1371R
(c) are cyanobactrial specific primers that are different in
four bases at 3′-end (see Table 2). Initially, we attempted
16S1371R(a) and if not succeeded in the amplification, we
used 16S1371R(b) or 16S1371R(c). PCR was conducted in
a total reaction volume of 11.05 lL containing 4.0 lL of
autoclaved ion-exchanged water, 5.0 lL of Ampdirect Plus,
0.05 lL of Ex Taq, 0.5 lL of each primer, and 1.0 lL of
template DNA. PCR was performed using the following
protocol: 95 °C for 1 min; 20 cycles at 95 °C for 30 s, 65 °
C (by one cycle, this temperature fell 0.5 °C) for 30 s, and
72 °C for 90 s; 10 cycles at 95 °C for 30 s, 55 °C for 30 s,
and 72 °C for 90 s; and a final elongation cycle at 72 °C
for 10 min. After this, PCR products were visualized on
0.59 TAE-agarose gels stained with ethidium bromide.
PCR products were sequenced from the both sides using
the standard methods of the BigDye Terminator Cycle
Sequence Ready Reaction Kit on an ABI 3130 Genetic
Analyzer.
Phylogenetic analysis
The cyanobacterial 16S rRNA gene sequences obtained,
together with those of representative reference strains
(Papaefthimiou et al., 2008), were aligned using CLUSTAL X
(Thompson et al., 1997). End gaps were removed, and
the ~ 300–350-bp sequences were realigned. Chroococcidiopsis thermalis was selected as an outgroup based on
phylogenies of nostocacean cyanobacteria (Papaefthimiou
et al., 2008). In addition, we added 66 taxa as more
distantly related outgroups according to molecular
phylogeny of cyanobacteria by Schirrmeister et al. (2011).
We further removed end gaps, and ~ 310-bp sequences
were used for generating phylogenetic trees based on the
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
NJ method using CLUSTAL X (Thompson et al., 1997) with
1000 replicates of bootstrap analysis.
Results
Identification of genotypes by DGGE
DGGE analysis of the ~ 420-bp PCR products (including
~ 390 bp of the cyanobiont 16S rRNA gene and GC
clamped primers; that is, amplified using primers GC
clamped-16S359F and 16S781R) exhibited a diverse fingerprinting pattern (Fig. 4a–d). Almost all samples shared
a DNA fragment at the bottom of the electrophoretogram
(these fragments were identified as chloroplast 16S rRNA
genes, as described later). Most samples also exhibited
one to three clear bands representing the cyanobiont 16S
rRNA gene, while four samples (As 1, and My 2, 3, and
5) contained no such band. As the coralloid root tissue
was green colored, suggesting the presences of cyanobionts, this result could have been because of PCR failure due either to low-quality cyanobacterial DNA or
contamination by PCR inhibitors.
In this study, genotypes of the cyanobacterial 16S
rRNA gene were identified based on the position of each
band and on their nucleotide sequence. We were able to
determine sequences for all bands of cyanobacteria except
band 10 of Yk2 and YK4, band 23 of Mt2 and Mt4, and
band 31 of Mt19 and Mt21. As a result, almost all bands
from the same position exhibited the same sequence,
while bands 19 (Ik4), 20 (Ik5), and 21 (Os1) showed different genotypes (Fig. 4a). Each cyanobiont genotype is
indicated as a number above the appropriate band in
Fig. 4. Each DNA sequence was deposited in DDBJ/
EMBL/GenBank under accession numbers AB612916–
AB612956.
In total, 41 genotypes were detected from 66 coralloid
roots. Thirty-nine of the 66 (59.1%) coralloid roots contained one genotype, while eight (12.1%) contained two
genotypes. Two samples from Okinawa Island (Oh 2 and
3; 3.0%) had three genotypes that are endemic to this
population.
Although sampling size varied among the populations,
most populations exhibited genotype diversity, while only
one genotype was found on Yonagunijima Island (Yk
1-6). In contrast, different genotypes were identified from
coralloid roots of the same cycad individual (Mt 16 and
17). In addition, nine neighboring coralloid roots collected within a narrow area (Mt 7-15) also contained five
genotypes, suggesting the presence of polymorphic symbiotic cyanobionts. On the other hand, we found nine
sequences for Cycas rRNA genes that appeared in the
lowermost position in each electrophoretic pattern (Aa1,
Yk1, Oh1, IK1, Os1, Mt1, Tk1, As1, and My1).
FEMS Microbiol Ecol 81 (2012) 696–706
Genetic diversity of symbiotic Nostoc in Cycas
701
(a)
(b)
Fig. 4. DGGE electrophoretic patterns of the
16S rRNA gene PCR products from
cyanobionts collected from Cycas revoluta
coralloid roots. The bands that were excised
and sequenced are indicated by numbers
adjacent to each band. The localities of
coralloid roots are shown. The samples (Aa,
Yk, Oh, Ik, Os), (Mt), (Tk), and (As, My) were
analyzed separately, and their electrophoretic
patterns are presented in a, b, c, and d,
respectively. At site Mt, a star indicates that
samples were collected from the same point.
Double stars indicate that samples were
collected from the same plant. A band of Mt14 (b) was very obscure by the naked eye and
we omitted to analyze.
(c)
PCRs were also conducted using the same primer sets
(GC clamped-16S359F and 16S781R) for DNAs extracted
from 10 leaf samples, and single DNA fragment was
located at the bottom at each sample in the DGGE electrophoretogram. The DNA sequences were identical with
C. revoluta 16S rRNA gene sequences.
FEMS Microbiol Ecol 81 (2012) 696–706
(d)
Genotype variation within a coralloid root and
within a narrow habitat
DGGE fingerprinting suggested that 10 of the 66 samples
exhibited polymorphic genotypes within a coralloid root.
DGGE fingerprinting was conducted separately on DNA
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
S. Yamada et al.
702
Fig. 5. DGGE electrophoretic patterns of 16S rRNA gene PCR
products from tips of coralloid roots. The left and right lanes of each
sample show the apical (‘a’ in Fig. 2) and middle (‘m’ in Fig. 2)
positions, respectively.
from the apical and middle parts of eight samples (Aa 2,
Aa 5, Aa 11, Oh 1, Oh 2, Oh 3, Oh 5, and Os 1). DGGE
fingerprinting patterns were identical between the apical
(left) and middle (right) parts in six samples (Aa 5, Oh 1,
Oh 2, Oh 3, Oh 5, and Os 1), while two samples (Oh 2
and Oh 3) harbored three genotypes at both the apical
and middle parts of the coralloid roots (Fig. 5).
Nine coralloid roots excavated from a narrow, dense cycad
habitat harbored five cyanobacterial 16S rDNA genotypes,
corroborating the presence of polymorphisms in symbiotic
cyanobacteria within a natural population of host cycads.
and the lowermost bands in the DGGE electrophoretic
patterns (indicated as Cycas rRNA in Fig. 6a) were clustered with chloroplast DNA sequences (tobacco, black
pine, and C. revoluta) and located outside of the Nostoc
clade (bootstrap support was at 96.8%). In particular,
genotypes Oh 1-11 and Oh 1-12 were embedded within a
robust cluster of cpDNA, while nine genotypes made an
independent cluster. These nine genotypes were distinguished from C. revoluta chloroplast DNA sequences by
between15 substitution changes (Ik 1-17 and Mt 15-28)
and 19 substitution changes (As 10-7), with sequence
similarities ranging from 93.9% to 95.2%. The 16S rRNA
gene sequences for genotypes Ik 5-20 and Aa 10-7
(692 bp and 819 bp, respectively) were further determined using primers 23S30R and 16S1371R, and their
sequence homology, with the C. revoluta chloroplast
DNA, was found to range between 89.6% and 90.4%. The
branch length of the combined clade (cpDNA denoted
with a single asterisk in Fig. 6a) was longer than those of
other clades within the phylogenetic tree.
The other 29 genotypes (71%), however, were embedded within the tree among symbiotic Nostoc (in blue in
Fig. 6b) and free-living Nostoc, Anabaena, Trichormus,
Cylindrospermopsis, Calothrix, and Nodularia. In particular, 20 of the 29 genotypes were clustered with free-living
Nostoc (including soil, sand, and meadow) in Clade II.
Multiple strains of symbiotic cyanobacteria from single
coralloid roots were included (e.g. Oh 2-13, Oh 2-14, and
Oh 2-15). In addition, genotypes from a single coralloid
root (Aa 2-2 and Aa 2-3) clustered with both symbiotic
Nostoc and free-living Nostoc clades.
Discussion
Sequence and phylogenetic analysis
DNA fragments representing the 41 genotypes of the
cyanobacterial 16S rDNA (~ 310 bp of the 5′-end) were
excised from DGGE gels and sequenced. Phylogenetic
trees (NJ trees with 1000 bootstrap replicates) using the
obtained genotypes and addition of representative reference strains (strains of Nostoc, Anabaena, Cylindrospermopsis, Calothrix, and Trichormus) and chloroplast DNAs
of C. revoluta, chlorella, tobacco, and black pine (Fig. 6)
suggested no geographical structure within the 41 cyanobacterial 16S rDNA genotypes. Two clades in Fig. 6
(above bootstrap values of 90%) comprised allopatric
genotypes spread across the Ryukyu Islands and Kyushu
(clades I and II): for example, clade I encompassed the
most northern and southern habitats [Toi Cape (Mt) to
Ishigakijima Island (Ik), respectively] along with the
islands of Amamioshima and Okinawa.
Additionally, these 41 genotypes were paraphyletic
(indicated in red in Fig. 6). Twelve of the 41 genotypes
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
Diversity of symbiotic cyanobacteria within
and among coralloid roots
In this study, DGGE analyses and DNA sequence analysis
of the partial 16S rRNA gene suggested the presence of
diversity within single coralloid roots of C. revoluta
obtained from natural habitats. As described previously,
the existence of polymorphism within single coralloid roots
has been controversial (Zheng et al., 2002; Costa et al.,
2004). Thus, it is noteworthy that the present study confirmed that a single coralloid root can harbor multiple symbiotic cyanobacterial strains; a maximum of three Nostoc
strains were detected in a single coralloid root. Two
hypotheses may explain the cyanobacterial diversity
observed in this study. First, cyanobionts were sampled
from cycads growing in their natural habitat. In previous
studies, most cyanobionts were collected from cycads
growing in gardens or greenhouses. Zheng et al. (2002)
indicated that symbiotic cyanobacteria from cultivated cycFEMS Microbiol Ecol 81 (2012) 696–706
Genetic diversity of symbiotic Nostoc in Cycas
703
Fig. 6. Neighbor-joining phylogenetic tree (divided to a and b) based on 16S rRNA gene sequences of cyanobionts obtained in this study and
those from GenBank. CpDNA indicates a monophyletic clade comprising 16S rRNA sequences of chloroplast DNA of tobacco, black pine and
Cycas revoluta and two isolated genotypes in this study. Red indicates the sequences obtained in this study, while blue indicates symbiotic
Nostoc sequences from different hosts.
ads exhibited low genotypic diversity. Second, the coexistence of multiple symbiotic cyanobacterial strains in a single coralloid root may be unusual. We detected a
FEMS Microbiol Ecol 81 (2012) 696–706
polymorphism rate of 15.1% among 66 coralloid roots
although some genotypes were included within the cpDNA
clade. In the case of cycad populations at Ayamaru Cape,
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
704
S. Yamada et al.
Fig. 6. Continued.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
FEMS Microbiol Ecol 81 (2012) 696–706
Genetic diversity of symbiotic Nostoc in Cycas
only one of the 12 coralloid roots examined (8.3%) harbored multiple cyanobionts. On the other hand, previous
studies analyzed only a few coralloid roots at each locality,
suggesting that polymorphisms may have been overlooked.
We also detected multiple strains of symbiotic cyanobacteria from plural coralloid roots of the same individual. Coralloid roots of Mt 16 and 17 (Toi Cape)
developed on the same root system of a cycad tree; however, these exhibited different genotypes, indicating that
the symbiotic cyanobionts of coralloid roots of the same
host plant sometimes differ. In addition, plural strains of
symbiotic cyanobacteria were present within a very narrow area. Nine coralloid roots excavated from a small
population in a narrow area (< 4 m2) harbored four symbiotic Nostoc strains (because many cycads were growing
in this small area, we could not determine the host individuals). These genotypes were apparently paraphyletic,
implying that plural strains of symbiotic cyanobionts
inhabited the root systems of the C. revoluta population
(genotypes Mt 7-24, Mt 8(9,10)-25 and Mt 13-27 were
clustered within the Nostoc clade). Costa et al. (2004)
found that neighboring cycad trees shared the same Nostoc strain. They estimated that the identical cyanobiont
genotype accounts for the lower diversity of Nostoc strains
in sandy soil environments and kinship among the host
trees. However, our data did not support their conclusion, although we could not estimate the kinship of cycad
trees in the studied area based on genetic markers.
Contrary to this finding, coralloid roots from different
cycads at different points within Toi Cape (Mt 1, Mt 2, Mt 3,
Mt 4, and Mt 5) shared the same cyanobiont genotype
(Fig. 4b). This indicates that the same Nostoc strain was
sometimes symbiotic with coralloid roots in different locations, as suggested by Gehringer et al. (2010), corroborating
the wide distribution of a single genotype across the islands.
Phylogeny of genotypes and geographical
structure
Phylogenetic analysis of 41 cyanobiont genotypes suggested the presence of two clades among representative
reference strains. Twelve of the 41 genotypes and the lowermost bands in DGGE electrophoretic patterns (indicated as Cycas rRNA in Fig. 6a) were clustered with
chloroplast DNA sequences (tobacco, black pine, and
C. revoluta) and located outside of the Nostoc clade. In
particular, genotypes Oh 1-11 and Oh 1-12 were almost
identical with sequences of C. revoluta cpDNA, possibly
due to amplification of the cpDNA 16S rRNA gene. PCR
products using DNAs from leaves were also identical with
the cpDNA 16S rRNA gene. Thus, we should identify
these genotypes and lowermost bands of each DGGE electrophoretic pattern as 16S rRNA genes of C. revoluta
FEMS Microbiol Ecol 81 (2012) 696–706
705
chloroplast DNA. The nine genotypes in clade I (Fig. 6a)
may be chimeric DNA fragments, that is, hybrid products
of chloroplast and cyanobacterial sequences.
Twenty-nine of the 41 genotypes (71%) were embedded
within the phylogenetic tree, with positions among both
symbiotic Nostoc and free-living Nostoc, Anabaena, Trichormus, Cylindrospermopsis, Calothrix, and Nodularia. In
particular, 20 of the 29 genotypes were clustered with freeliving Nostoc (including soil, sand, and meadow) in Clade
II (Fig. 6b). Multiple strains of symbiotic cyanobacteria
from single coralloid roots were included in this clade (e.g.
Oh 2-13, Oh 2-14 and Oh 2-15). In addition, genotypes
Aa 2-2 and Aa 2-3, from a single coralloid root, clustered
with both symbiotic Nostoc and free-living Nostoc clades.
Thus, symbiotic Nostoc in C. revoluta may exhibit inapparent relationship with Nostoc strains (e.g. symbiotic or freeliving), while Azolla harbors specific strains of symbiotic
Nostoc (Papaefthimiou et al., 2008).
Most genotypes were identified as Nostoc strains. The
phylogenetic tree suggests conversion of Nostoc strains
between symbiotic and free-living individuals in soil and
water, and the 29 cyanobiont strains in Fig. 6b were scattered among these reference strains. Land plants, including C. revoluta, may therefore take up Nostoc strains from
the soil at random, with no specificity between cycads
and cyanobionts, as has been discussed elsewhere (Lindblad et al., 1989; Lotti et al., 1996; Costa et al., 1999,
2004; Zheng et al., 2002; Papaefthimiou et al., 2008; Gehringer et al., 2010). The Nostoc flora in each environment
may be diverse with a wide global distribution.
Thus, our data suggest that the genotypes of symbiotic
cyanobionts in C. revoluta coralloid roots exhibit no
geographical structure, although the host plant exhibits
north–south differentiation across its distribution range
(Setoguchi et al., 2009; Kyoda & Setoguchi, 2010). Cycas
revoluta can establish symbiosis with one or several strains
of Nostoc within each habitat. Note that 20 of the 29 genotypes of C. revoluta-symbiotic Nostoc were included in one
clade that also comprised six free-living Nostoc from soil
(clade II in Fig. 6b). Nevertheless, this clade was not supported by a high bootstrap value. Most free-living Nostoc
were isolated from soil in tropical regions (Southeast Asia,
South America, and Africa), suggesting that some strains of
C. revoluta-symbiotic Nostoc may be derived from free-living Nostoc in soil. Further study of the infection mechanisms
of cyanobionts during the early developmental stages of coralloid roots are needed to elucidate their genetic signature.
Acknowledgements
We thank the anonymous reviewers for their helpful
comments on the manuscript. We also thank Mr. Yu
Akita for permission to work within the national park at
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
706
Toi Cape, and Mr. Y. Maeda for allowing us to collect
coralloid roots on Amamioshima Island. This study was
supported by Grants-in-Aid for Scientific Research
(#22405013 and #21247005) from the Ministry of Education, Culture, Science, Sports and Technology, Japan.
References
Bergman B, Ray AN & Rasmussen U (1996) Chemical signaling
in cyanobacterial-plant symbioses. Trends Plant Sci 1: 191–197.
Boutte C, Grubisitic S, Balthasart P & Wilmotte A (2006)
Testing of primers for the study of cyanobacterial molecular
diversity by DGGE. J Microbiol Methods 65: 542–550.
Boutte C, Mankiewicz-Boczek J, Komarkova J, Grubisic S,
Izydorczyk K, Wautelet F, Jurczak T, Zalewski M & Wilmotte
A (2008) Diversity of planktonic cyanobacteria and
microcystin occurrence in Polish water bodies investigated
using a polyphasic approach. Aquat Microb Ecol 51: 223–236.
Costa JL & Lindblad P (2002) Cyanobaceria in symbiosis with
cycads. Cyanobacteria in Symbiosis (Ray AN, Bergman B &
Rasmussen U, eds), pp. 195–205. Kluwer Academic
Publishers, Dordrecht.
Costa JL, Paulsrud P & Lindblad P (1999) Cyanobiont
diversity within coralloid roots of selected cycad species.
FEMS Microbiol Ecol 28: 85–91.
Costa JL, Romero EM & Lindblad P (2004) Sequence based
data supports a single Nostoc strain in individual coralloid
roots of cycads. FEMS Microbiol Ecol 49: 481–487.
Doyle JJ & Doyle JL (1990) Isolation of plant DNA from fresh
tissue. Focus 12: 13–15.
Gehringer MM, Pengelly JJL, Cuddy WS, Fieker C, Forster PI &
Neilan BA (2010) Host selection of symbiotic cyanobacteria
in 31 species of the Australian cycad genus: Macrozamia
(Zamiaceae). Mol Plant Microbe Interact 23: 811–822.
Grobbelaar N, Scott WE, Hattingh W & Marshall J (1986) The
occurrence of coralloid roots on the South African species
of the Cycadales and their ability to fix nitrogen
symbiotically. S Afr J Bot 52: 467–471.
Kimura M (1996) Quaternary paleogeography of the Ryukyu
Arc. J Geogr 105: 259–285.
Kimura M (2000) Paleogeography of the Ryukyu Islands.
Tropics 10: 5–24.
Kizaki K & Oshiro I (1977) Palaeogeography of the Ryukyu
Islands (in Japanese with English summary). Mar Sci 9:
542–549.
Kizaki K & Oshiro I (1980) The origin of the Ryukyu Islands.
Natural History of the Ryukyus (in Japanese) (Kizaki K, ed),
pp. 1–37. Tsukiji-shokan, Tokyo.
Komarek J & Anagnostidis K (1989) Modern approach to the
classification system of Cyanophytes 4-Nostocales. Arch
Hydrobiol Suppl 82: 247–345.
Kyoda S & Setoguchi H (2010) Phylogeography of Cycas
revoluta Thunb. (Cycadaceae) on the Ryukyu Islands: very
low genetic diversity and geographical structure. Plant Syst
Evol 288: 177–189.
ª 2012 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
S. Yamada et al.
Lindblad P, Haselkorn R, Bergman B & Nierzwicki-Bauer SA
(1989) Comparison of DNA restriction fragment length
polymorphisms of Nostoc strains in and from cycads. Arch
Microbiol 152: 20–24.
Lotti F, Giovanetti L, Margheri MC, Ventura S & Materassi R
(1996) Diversity of DNA methylation pattern and total
DNA restriction pattern in symbiotic Nostoc. World J
Microbiol Biotechnol 12: 38–42.
Murakami A, Miyashita H, Iseki M, Adachi K & Mimuro M
(2004) Chlorophyll d in an epiphytic cyanobacterium of red
algae. Science 303: 1633 (Supporting online material) www.
sciencemag.org/cgi/content/full/303/5664/1633/DC1.
Nübel U, Garcia-Pichel F & Muyzer G (1997) PCR primers to
amplify 16S rRNA genes from cyanobacteria. Appl Environ
Microbiol 63: 3327–3332.
O’Brien H, Miadlikowska J & Lutzoni F (2005) Assessing host
specialization in symbiotic cyanobacteria associated with
four closely related species of the lichen fungus Peltigera.
Eur J Phycol 40: 363–378.
Obukowicz M, Schaller M & Kennedy GS (1981)
Ultrastructure and phenolic histochemistry of the Cycas
revoluta-Anabaena symbiosis. New Phytol 87: 751–754.
Ohkubo S, Miyashita H, Murakami A, Takeyama H, Tsuchiya
T & Mimuro M (2006) Molecular detection of epiphytic
Acaryochloris ssp. on marine macroalgae. Appl Environ
Microbiol 72: 7912–7915.
Papaefthimiou D, Hrouzek P, Mugnai MA, Lukesova A,
Turicchia S, Rasmussen U & Ventura S (2008) Differential
patterns of evolution and distribution of symbiotic
behaviour in nostocacean cyanobacteria. Syst Evol Microbiol
58: 553–564.
Rai AN, Sonderback E & Bergman B (2000) Cyanobacteriumplant symbioses. New Phytol 147: 449–481.
Schirrmeister BE, Antonelli A & Bagheri HC (2011) The origin
of multicellularity in cyanobacteria. BMC Evol Biol 11: 45.
Setoguchi H, Kyoda S, Maeda Y & Nomura N (2009) Geographical
variation in leaflet of Cycas revoluta (Cycadaceae) on the
Ryukyu Islands. J Phytogeogr Taxon 57: 1–6.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F &
Higgins DG (1997) The CLUSTALX windows interface:
flexible strategies for multiple sequence alignment aided by
quality Analysis tools. Nucleic Acids Res 25: 4876–4882.
Ujiie H (1990) Geological history of the Ryukyu Island Arc.
Nature of Okinawa Geomorphology and Geology (Ujiie H,
ed), pp. 251–255. Hirugisha, Naha.
Yamazaki T (1995) Cycadaceae. Flora of Japan, Vol. 1
(Iwatsuki K, Yamazaki T, Boufford DE & Ohba H, eds), pp.
263. Kodansha, Tokyo.
Zheng W, Song T, Xiaodong B, Bergman B & Rasmussen U
(2002) High cyanobacterial diversity in coralloid roots of
cycads revealed by PCR fingerprinting. FEMS Microbiol Ecol
40: 215–222.
Zhu C (1982) Fine structure of blue-green algae and the cells
lined along the endophyte cavity in the coralloid root of
Cycas. Acta Bot Sin 24: 109–114.
FEMS Microbiol Ecol 81 (2012) 696–706