Supplementary Material PCR amplification of the BRCA2 gene The components of the PCR reaction were: 20mM Tris-HCl(pH8.4), 50mM KCl, 1.5mM MgCl2, 0.1mM in each of dATP, dCTP, dGTP, TTP, 0.1µM of each primer, 5ng/µl DNA, 0.05units/µl Taq polymerase (Taq Platinum, GIBCO BRL, Gaithersburg, MD). The primer sequences are as follows: Exon Primer name 2 2-F 2-R 3-F 3-R 4-F 4-R 5/6-F 5/6-R 7-F 7-R 8-F 8-R 9-F 9-R 10a-F 10a-R 10b-F 10b-R 10c-F 10c-R 10d-F 10d-R 10e-F 10e-R 11a-F 11a-R 11b-F 11b-R 11c-F 11c-R 11d-F 11d-R 11e-F 3 4 5/6 7 8 9 10a 10b 10c 10d 10e 11a 11b 11c 11d 11e Sequence GTT CCA GGA GAT GGG ACT GAA ACA CAT AAG GAA CAG TTT ATG GTT CCA TAG TCA AGA TCT TTA GCA ACT GAT TTG CCC AGC ATG ACA TTA CAA CTC CCT ATA CAT TCT CA AAC CAG CCA ATT CAA CAT CAC A ATA TCT AAA AGT AGT ATT CCA ACA A AAT TGC CTG TAT GAG GCA GAA T GTT ATA CCT TTG CCC TGA GAT T GTC AGT TAC TAA CAC ACT TAT CA GTT TAT TCA CTG TGT TGA TTG AC CAT ATA GGA CCA GGT TTA GAG A CAT CAC ACT ACT CAG GAT GAC A GCA TGG TGG TGC ATG CTT GTA CCA AGT ACT CAG AAT AAC CCT T TTT GTC ACT TCC ACT CTC AAA G TCC ATG AAG CAA ACG CTG ATG A CCA GAT ATT GCC TGC TTT ACT G GAC CTA TTA GAC ACA GAG AAC A CTG CAT TCT TCA AAG CTA CAG A TCA GGT CAT ATG ACT GAT CCA A AAC ACA GAA GGA ATC GTC ATC T CCG AAA GAC CAA AAA TCA GAA CT AGC AAA CCA ACA TGG CAT ACG T CCA AAC ACT ACC TTT TTA ACT TAG T GAC CTC TTC TTT TAT ATC TGA AAC T CTG AAG AAC CAA CTT TGT CCT TA AGT GCT GGC ATT TTC ATG ATC AT TAT TAC CCC AGA AGC TGA TTC T TAC CTT TGA GCT TGT CTG ACA T ATG TCA CCC AGT ACA ACA TTC A CCT TTC ATT AGC AAC TTG GAA GA GAG AGT AGC ATC ACC TTC AAG A Amplicon size 348 bp 466 bp 454 bp 421 bp 398 bp 372 bp 495 bp 497 bp 470 bp 454 bp 416 bp 400 bp 380 bp 350 bp 299 bp 484 bp 464 bp 11f 11g 11h 11i 11j 11k 11l 11m 11n 11o 11p 11q 11r 11s 11t 11u 11v 11w 12 13 14a 14b 15 16 11e-R 11f-F 11f-R 11g-F 11g-R 11h-F 11h-R 11i-F 11i-R 11j-F 11j-R 11k-F 11k-R 11l-F 11l-R 11m-F 11m-R 11n-F 11n-R 11o-F 11o-R 11p-F 11p-R 11q-F 11q-R 11r-F 11r-R 11s-F 11s-R 11t-F 11t-R 11u-F 11u-R 11v-F 11v-R 11w-F 11w-R 12-F 12-R 13-F 13-R 14a-F 14a-R 14b-F 14b-R 15-F 15-R 16-F 16-R CTG CCC ATT TGT TCA TGT AAT C AAA CAA GCA ACC CAA GTG TCA A CAG AAA CAA CTA CAC TAC TCT GT GGA AAT CAA GCT CTC TGA ACA T CAT CTG GTT TTC AGG CAC TTC A CCC CTC AGA TGT TAT TTT CCA A ACC CCA CTT CAT TTT CAT CTG T GGA ATG CAG AGA TGC TGA TCT CAT TGA AAC GAC AGA ATC ATG AC CTG CTC ATG GCA CAA AAC TGA GAA TTT CTA CTG GCA GCA GTA T CTT CTG CAG AGG TAC ATC CAA TGC TCC GTT TTA GTA GCA GTT A CTG ATC AGC ACA ACA TAT GTC T CTT TTC ATC ACG TTC GGG TTG T GAT CAG AAA CCA GAA GAA TTG C ACA CTT TGG GGC AGC TGT GAT TGC AAA GGA ATC TTT GGA CAA AG GCT AAG GCT GAA TTT TCA ATG AC GTG GTG CCA CCT AAG CTC TTA GTA TCT TGT TTT TCG GAG AGA TG ACT TCT GTG AGT CAG ACT TCA T TGT GGG TAT GCA TTT GCA TCT T CAG TAG CAT GTC TAA CAG CTA T GTT TCA TGT GAA ACA CAA ACG AT GAT ATT TGC GTT GAG GAA CTT G GCG TGC TAC ATT CAT CAT TAT C GGA TAG CCA GTG GTA AAA TCG T AGA CTT GCT TGG TAC TAT CTT CT TCA CCT TGT GAT GTT AGT TTG GA CAT TTT GTC TAG ACG TAG GTG AA CTG CTA TAC GTA CTC CAG AAC A AAC AAG TGA GAC TTT GGT TCC TA GCA CTG TGT AAA CTC AGA AAT G TGT GGC ATG ACT TGG CAG TTT ACT TTT TCT GAT GTT CCT GTG AA TCC CCC AAA CTG ACT ACA CAA CAT TTA AAG AGT CAA TAC TTT AGC T GCA CAG TGG CTC ATG TCT GTA GCA TCC GTT ACA TTC ACT GAA A TAA CTT CTT AAC GTT AGT GTC ATT AGG CTA GCC TTG AAA AAT GTG A CAT CAG AGC GAT GTC CAT CAA TTG ATT ACT ACA GGC AGA CCA A TAA CAA GTC CAC AAG AAG TTA TC TTT TGG TCA GGC TGG TCT TGA TCA TTC ATC CAT TCC TGC ACT AA TTT TGT AGT GAA GAT TCT AGT AGT CAG AAT GCT TAA CCA TAA TGC AC 433 bp 403 bp 387 bp 346 bp 331 bp 496 bp 470 bp 423 bp 408 bp 386 bp 371 bp 348 bp 328 bp 498 bp 469 bp 431 bp 406 bp 383 bp 332 bp 302 bp 495 bp 449 bp 482 bp 472 bp 17 18a 18b 18c 19 20 21 22 23 24 25a 25b 26 27a 27b 27c 27d 17-F 17-R 18a-F 18a-R 18b-F 18b-R 18c-F 18c-R 19-F 19-R 20-F 20-R 21-F 21-R 22-F 22-R 23-F 23-R 24-F 24-R 25a-F 25a-R 25b-F 25b-R 26-F 26-R 27a-F 27a-R 27b-F 27b-R 27c-F 27c-R 27d-F 27d-R CAC CAT GCT CAG CAA TGA AGT GAT GGC AAC TGT CAC TGA CAA TCC ACT ATT TGG GGA TTG CTA A TAC CAC CCA TCT GTA AGT TCA A TAG AAG CAG AAG ATC GGC TAT A GAA TTT AAC TGA ATC AAT GAC TGA TCC TCC CCT CTT AGC TGT CTT GAC CTC CCA AAA ACT GCA CAA A GGC AGT TCT AGA AGA ATG AAA AC ACC CCT TCT CTA CCA AAA ATA CA CTC AGG TGA TCC ACT AAT CTC CCC TTG TTG CTA TTC TTT GTC T TGA CAG AGT GAG ACC CTG TCT CCT TTT GGA GAA ATG CAG CAT T CAC ACC CTT AAG ATG AGC TCT TAG TGG ATT TTG CTT CTC TGA TA ATC CAC TAC TAA TGC CCA CAA A TCC CGT GGC TGG TAA ATC TGA ACA TAC AGT TAG CAG CGA CAA A CAG ATC ACT AGT TAG CTA GCA A AGC TTT CGC CAA ATT CAG CTA T CTC TTG AAA GTG GCC CTC TTT GGA TAG ACC TTA ATG AGG ACA T TCC TGA GGT TCA TGG GCA ATT GCA TGT TTG ACA ATT GGT ATC AC GGA GCC ACA TAA CAA CCA CAT T GGG GAG GGA GAC TGT GTG TA TTT CGT ATT TGG TGC CAC AAC T AAG TCT TGT AAA GGG GAG AAA GA CTG GTG GGA GCA GTC CTA GT ATT CTC CTC AGA TGA CTC CAT T ACT GGA AAG GTT AAG CGT CAA T CTC AGA CTG AAA CGA CGT TGT A GCA ACT GAA GCA AAA GTA TAC CA 498 bp 432 bp 389 bp 312 bp 480 bp 453 bp 411 bp 443 bp 416 bp 398 bp 361 bp 336 bp 427 bp 400 bp 379 bp 352 bp 318 bp One primer (designated “-F”) in each pair was synthesized with an 18base M13 –21 forward sequence (TGTAAAACGACGGCCAGT) at its 5’ end, and the other primer (designated “-R”) was synthesized with an 18 base M13 –28 reverse sequence (CAGGAAACAGCTATGACC) at its 5’ end. For the longer exons, two or more overlapping amplicons were designed. The thermocycling conditions were: 94˚C, 4min, followed by 11 cycles, each with a denaturing step at 94˚C for 20 seconds and an extension step at 72˚C for 20 seconds, and with a 20 second annealing step that decreased 1˚C/ cycle, beginning at 60˚C in the first cycle and decreasing to 50˚C in the eleventh cycle; the eleventh cycle was then repeated 25 times; a 6 minute incubation at 72˚C followed by a 4˚C soak completed the program. DNA sequencing An aliquot of each PCR reaction was diluted 1:10 with water. The diluted PCR product was sequenced on both strands using an M13 Forward and an M13 Reverse Big Dye Primer kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s recommendations. The sequencing products were separated on a fluorescent sequencer (model 377 from Applied Biosystems, Foster City, CA). Base calls were made by the instrument software, and reviewed by visual inspection. Each sequence was compared to the corresponding normal sequence using Sequencher 3.0 software (LifeCodes, Stamford, CT). Denaturing Gradient Gel Electrophoresis (DGGE) analysis of exon 15 and 27 of the BRCA2 gene Genomic DNA samples were from healthy blood donors derived from the Netherlands Center of Blood Transfusion Service (CLB, Amsterdam, The Netherlands). DNA fragments that harbor the mutations in the EUFA423 patient, exon 15 and exon 27, were amplified from the patient and 60 unrelated controls. Primer sets, IC-B2-15.1F with ICB2-15.1R, and IC-B2-27.1F with IC-B2-27.1R, were obtained from Ingeny (Ingeny International, The Netherlands) (www.Ingeny.com). Samples were run in parallel using DGGE (1). Gels were stained with ethidium bromide and visualized with UV light. Reverse Transcription-PCR For RT-PCR analysis of the HSC62 cells, RNA was purified from fibroblasts and lymphoblasts using the Qiagen RNeasy Protect mini kit. First-strand cDNA was synthesized from 2 µg RNA using Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). Primers used to amplify a region of BRCA2 from exon 18 through exon 22 were BRCA2ex18FP (CCTCCCCTCTTAGCTGTCTTAAA) and BRCA2ex22RP (CCCTTGATAAACCTTGTTCCTTT). Primers used to amplify a region of the FANCD2 gene were DF3862 (CATCCTGTTCTGCATGTATG) and DSR4360 (TGATGACTCTGATTAGACCC). Segregation analysis of EUFA423 kindred For segregation analysis of EUFA423 pedigree, DNA from lymphoblastoid cell lines of the father (EUFA424L), mother (EUFA425L) and three siblings (EUFA664L, EUFA665L and EUFA666L) of EUFA423 were used to PCR amplify exon 15 and region 27a in exon 27 of the BRCA2 gene. The DNA sequence of both strands of each PCR product was determined. Microcell mediated chromosome transfer of human chromosome 13 into EUFA423 fibroblasts. Microcell fusions were performed as described (2). Briefly, donor A9+13 Hytk cells (mouse A9 cells containing hygromycin-marked human chromosome 13 (3) were split into 150 mm2 tissue culture plates. After 20-24 h, micronuclei were induced by treating the A9+13 Hytk cells for 48 h with 0.05 mg/ml colcemid. Micronucleated cells were then trypsinized and allowed to sit for 8-16 h onto tissue culture plates cut into the shape of a bullet. Bullets were then placed into 50 ml centrifuge tubes containing enucleation media (serum-free alpha-MEM and 10 mg/ml of cytochalasin B) and centrifuged at 14,000 rpm for 30 min at 37˚C. The resulting microcell pellets were resuspended in serum-free alpha-MEM and filtered through an 8 m and then a 5 m Whatman Nuclepore membrane. The filtered microcells were then mixed with 100 mg/ml of phytohemagglutinin P and added to a monolayer of immortalized EUFA423 fibroblasts. After 15 min fibroblasts and A9+13 Hytk microcells were fused with 50% polyethylene glycol for 1 min, washed with serum-free alpha-MEM and allowed to grow overnight in alpha-MEM with 15% fetal bovine serum. The next day, cells were split 1:5 onto 150 mm2 tissue culture plates, and the following day, cells were selected in alpha-MEM medium, supplemented with 15% fetal bovine serum, 200 µg/ml hygromycin and hypoxanthine, aminopterin, thymidine (HAT). Clones were subsequently picked, expanded and analyzed. Chromosome Breakage Analysis Chromosome Breakage Analysis was performed as previously described (4). fig. S1. FA-D1 cells and BRCA2(-/-) tumor cells exhibit a similar pattern of chromosome breakage. Metaphase chromosome spreads from FA-D1 fibroblasts or CAPAN1 cells exposed to MMC (20 ng/ml) for 48 hours. Radial forms are indicated (arrows). fig. S2. The FA-D1 reference line, HSC62, contains a homozygous mutation in the splice acceptor site of intron 19 (IVS19-1 G to A). Schematic representation of an alternate splicing mechanism at the junction of intron 19 and exon 20 of HSC62, resulting in the loss of the first 12 bases of exon 20, corresponding to an in-frame deletion of four amino acids from BRCA2 (a.a. 2830 to 2833). fig. S3. Possible functions of the BRCA2 protein in the FA/BRCA pathway. (A) Schematic representation of the FA/BRCA pathway. DNA damage-inducible or S phase specific monoubiquitination of FANCD2 requires the FA protein complex (A/C/G/E/F complex). Monoubiquitination targets D2 to DNA repair foci containing BRCA1, BRCA2, and RAD51. The BRCA2 protein may function upstream in this pathway, by promoting D2 monoubiquitination, and/or downstream in the pathway by promoting homologous recombination repair. (B) Whole cell lysates were prepared from the indicated EBV lymphoblast lines (lanes 2-11) or BRCA2(-/-) CAPAN-1 cells (lane 12), and cellular proteins were immunoblotted with a monoclonal antibody specific for FANCD2 (F17 monoclonal). These cell lines and their growth requirements have previously been described (5). Supplementary References 1. R. M. Myers et al., in Methods Enzymology, R. Wu, Ed. (Academic Press, San Diego, 1987), vol. 155, pp. 501-527. 2. M. Whitney et al., Nature Genet. 11, 341 (1995). 3. A. P. Cuthbert et al., Cytogenet. Cell Genet. 71, 68 (1995). 4. C. Timmers, Mol. Cell 7, 241 (2001). 5. I. Garcia-Higuera et al., Mol. Cell 7, 249 (2001). table S1. FA patients with Biallelic Mutations in BRCA2 Clinical history Cell line FA Subtype Assignment Age (sex) Abnormal Pigmentation Abnormal Thumb Bone Chromosome Marrow Breakage Failure Cancer Mutant Allele #1 (exon) BIC entry Mutant Allele #2 (exon) BIC entry HSC62 D1 30 yr old (M) - + - + - IVS19-1 G to A (20) - IVS19-1† G to A (20) - EUFA423 D1 3 yr old (F) + + - ++ Brain tumor 7691 insAT (15) - 9900 insA (27) 4 HSC230 B 2 yr old (M) + + + ++ - 3033 del AAAC (11) many 10204 A to T‡ (27) many EUFA579 U/A* 2 yr old + + + ++ AML 7235 G to A (13) 1 5837 TC to AG (11) 1 + + + ++ AML 8415 G to T (18) 2 8732 C to A (20) 1 (F) AP37P U/A* 2 yr old (M) * U/A, unassigned FA subtype † Family History of Cansanguinity ‡ Polymorphic STOP variant (ter3326) BIC, Breast Cancer Information Core (www.nhgri.nih.gov/intramural_research/lab_transfer/bic)
© Copyright 2026 Paperzz