Microbiology (2007), 153, 2976–2983
DOI 10.1099/mic.0.2006/005413-0
Conjugative DNA transfer in Streptomyces: SpdB2
involved in the intramycelial spreading of plasmid
pSVH1 is an oligomeric integral membrane protein
that binds to dsDNA
Yvonne Tiffert, Birke Götz,3 Jens Reuther, Wolfgang Wohlleben
and Günther Muth
Correspondence
Günther Muth
Mikrobiologie/Biotechnologie, Mikrobiologisches Institut, Fakultät für Biologie,
Eberhard Karls Universität Tübingen, Auf der Morgenstelle 28, 72076 Tübingen, Germany
[email protected]
Received 20 December 2006
Revised
3 May 2007
Accepted 3 May 2007
In the current model of conjugal plasmid transfer in mycelium-forming streptomycetes, plasmid
transfer by the FtsK-like TraB protein is followed by the subsequent spreading of the newly
transferred plasmid within the neighbouring mycelial compartments. Several plasmid-encoded
Spd proteins are involved in the plasmid spreading by an unknown mechanism. spdB2 of the
conjugative pSVH1 plasmid of Streptomyces venezuelae was heterologously expressed in
Escherichia coli and Streptomyces lividans, with a C-terminal His-tag-encoding sequence.
Induction of spdB2-His expression affected viability in both species. The integral membrane
protein SpdB2-His was eluted from the membrane fraction of S. lividans with Triton X-100, and
purified as a soluble protein by Ni-NTA affinity chromatography. Cross-linking experiments with
glutaraldehyde showed that SpdB2-His formed oligomers. SpdB2-His had a nonspecific
DNA-binding activity: while all types of dsDNA were bound, single-stranded M13-DNA was not
recognized. The spd genes of the spdB3–spd79–spdB2 operon of pSVH1 were simultaneously
expressed in E. coli with different affinity tags. While expression of StrepII-SpdB3 was not
detected, Spd79-flag and SpdB2-His were localized in the membrane fraction of E. coli. In the
absence of SpdB2, most of the Spd79-flag protein was found in the cytoplasmic fraction,
indicating that SpdB2 affects localization of Spd79. Pulldown assays with StrepII-TraB protein of
pSVH1 demonstrated that TraB interacted with SpdB2, suggesting that the septal DNA
translocator TraB is also involved in intramycelial plasmid spreading.
INTRODUCTION
Gram-positive soil bacteria of the genus Streptomyces are
the most important producers of antibiotics (Hopwood
et al., 1995). In contrast to most other bacteria,
streptomycetes do not divide by binary fission, but grow
by apical tip extension (Flardh, 2003b). The hyphal
filaments septate infrequently, forming a branched substrate mycelium containing multiple nucleoids (Flardh,
2003a). In response to nutrient limitation, aerial hyphae
grow up from the substrate mycelium, and become
synchronously septated to form uninucleoid spore chains
(Hopwood, 2006).
The substrate mycelium of Streptomyces has been shown to
be capable of exchanging DNA by conjugation (Kieser et al.,
1982; Hopwood & Wright, 1973). A single plasmidencoded protein (TraB) is sufficient to promote intermycelial plasmid transfer from the donor into the recipient
3Present address: Institute of Molecular Biology and Biophysics, ETH
Zurich, HPK D14.1, Schafmattstrasse 20, 8093 Zurich, Switzerland.
2976
(Kieser et al., 1982; Maas et al., 1998; Kosono et al., 1996;
Pettis & Cohen, 1994). TraB belongs to the septal DNA
translocator proteins of the FtsK family, and has been shown
to recognize the clt region, which is a specific sequence of
approximately 50 bp that is required for plasmid transfer
(Reuther et al., 2006a). Binding of TraB to the clt region does
not involve processing of the DNA, suggesting that doublestranded plasmid DNA is translocated during Streptomyces
conjugation. Localization of TraB to the hyphal tip has
indicated that Streptomyces conjugation proceeds at the
hyphal tip (Reuther et al., 2006a).
In adaptation to the mycelial growth characteristics of
Streptomyces, primary plasmid transfer at the hyphal tips is
followed by a series of secondary transfer processes within
the recipient mycelium (Hopwood & Kieser, 1993). The
newly transferred plasmid is most probably translocated via
the septal cross-walls to the neighbouring mycelial
compartments, although this model needs to be confirmed
by experimental data. Plasmid spreading results in the
rapid colonization of the recipient mycelium with the
Downloaded from www.microbiologyresearch.org by
2006/005413 G 2007 SGM
IP: 88.99.165.207
On: Thu, 15 Jun 2017 18:31:34
Printed in Great Britain
Plasmid spreading during Streptomyces conjugation
Table 1. Plasmids used in this study
Plasmid
Characteristics
Source or reference
pSVH1
pGM190
pDrive
pJoe2775
Conjugative rolling-circle-replicating plasmid from S. venezuelae
Streptomyces–E. coli shuttle vector, tsr aphII, pSG5 derivative, PtipA promoter
TA cloning vector, bla kan
E. coli expression vector, bla, Prham promoter, C-terminal His-tag
pGB1
pYT
pJoe2775 derivative, bla, Prham promoter, spdB2-His
E. coli expression vector, bla, Prham promoter, N-terminal Strep-tag II
pYT3
pYT5
pYT7
pYT90
pJR201
pEB211
pYT derivative, bla, Prham promoter, strepII-spdB3 spd79-flag
pGB1 derivative, bla, Prham promoter, strepII-spdB3 spd79-flag spdB2-His aac(3)IV
pGB1 derivative, bla, Prham promoter, strepII-traB spdB2-His aac(3)IV
pGM190 derivative, tsr aphII, PtipA promoter, spdB2-His
pYT derivative, bla, Prham promoter, strepII-traB
pSVH1-derivative, pK18 insertion in NheI site
plasmid. Because unregulated expression of the transfer and
spread of genes is detrimental (Kendall & Cohen, 1987;
Pettis et al., 2001), the conjugation process is associated with
temporary retardation of growth and morphological
differentiation. When a plasmid-carrying Streptomyces spore
germinates on a lawn of plasmid-free recipients, inhibition
zones (pocks) of 1–3 mm are formed. These pock structures
indicate the area where the recipient mycelium has obtained
a plasmid (Hopwood & Kieser, 1993).
Whereas the primary transfer from the donor to the
recipient requires only TraB (Pettis & Cohen, 1994), several
plasmid-encoded spread (Spd) proteins are involved in
intramycelial plasmid spreading via the septal cross-walls
(Kataoka et al., 1991; Servı́n-González et al., 1995). The spd
genes of the different plasmids are often cotranscribed, and
overlap in their stop and start codons. They encode
hydrophobic proteins of different sizes, some of which are
very small (50–100 aa), and they do not show any sequence
conservation or similarity to any other proteins in
databases (Grohmann et al., 2003). Therefore, the molecular function of the Spd proteins is completely unknown.
Plasmid pSVH1 is a 12 652 bp conjugative pock-forming
plasmid from Streptomyces venezuelae. pSVH1 contains two
operons of translationally coupled genes, where insertional
Reuther et al. (2006b)
G. Muth (unpublished)
Qiagen
J. Altenbuchner (personal
communication)
This study
Y. Tiffert & J. Reuther
(unpublished)
This study
This study
This study
This study
Reuther et al. (2006a)
Reuther et al. (2006b)
mutagenesis has shown involvement in pock formation
(Reuther et al., 2006b). We report the characterization of
the pSVH1 spdB3–spd79–spdB2 operon, and show that
SpdB2 is an oligomeric integral membrane protein that
binds dsDNA, and interacts with Spd79 and TraB. This
indicates that a complex DNA-translocation apparatus is
inserted into the septal cross-walls to promote intramycelial plasmid spreading during Streptomyces conjugation.
METHODS
Strains, plasmids, culture conditions. For propagation of plasmids
and heterologous gene expression, Escherichia coli XL1-blue (Bullock
et al., 1987), E. coli BL21(DE3)pLys (Invitrogen) and Streptomyces
lividans TK64 (Hopwood et al., 1983) were used. E. coli and S. lividans
strains were cultivated as described (Sambrook, 2001; Kieser et al.,
2000). Plasmids and primers used in this study are listed in Tables 1
and 2, respectively.
Expression and purification of SpdB2-His. The spdB2 gene of
pSVH1 was amplified by PCR using the primers SpdB2up and SpdB2Hlow, which contain restriction sites (Table 2, underlined nucleotides) for NdeI and HindIII, and a His6-encoding sequence was
incorporated at the C-terminal end of spdB2. The resulting product
was cloned into pJoe2775 that had been cut with NdeI and HindIII (J.
Altenbuchner, personal communication), and this resulted in pBG1.
Table 2. Oligonucleotide primers used in this study
Restriction sites are underlined.
Primer
SpdB2up
SpdB2-Hlow
SpdB3up
Spd79-flaglow
Rhamup
Apralow
Sequence (5§A3§)
GGCATATGAGCACGTACCGC
AAGCTTTCAATGATGATGATGATGATGGGTACCGGCGACGTGCAGGC
AGGATCCAACGTCATCGTTGCT
AAGCTTTCACTTATCGTCGTCATCCTTGTAATCTCGGGTACCTCCGGCA
ACCGGTAATGGTGCATGCATCGATCACCACAATTCA
ATGGCCATCCAACGTCATCTCGTTCTC
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 18:31:34
2977
Y. Tiffert and others
For expression in S. lividans, the PCR fragment described above was
subcloned into pDrive, and inserted as a NdeI–EcoRI fragment, under
the control of the tipA promoter, into pGM190, yielding pYT90.
After breaking the cells by using a French press, the subcellular
membrane fraction was isolated as described previously (Reuther et al.,
2006a). Integral membrane proteins were solubilized in Triton X-100
extraction buffer (25 mM Tris/HCl, pH 7.5, 20 % (w/v) glycerol, 1 M
NaCl, 2 % Triton X-100). Unsolubilized membrane debris was removed
by centrifugation (100 000 g, 30 min), and the supernatant containing
the solubilized membrane proteins was loaded to a gravity flow Ni-NTA
Superflow column (IBA). SpdB2-His was dialysed against 50 mM Tris/
HCl, 100 mM NaCl and 1 % Triton X-100, and concentrated using
Amicon Ultra-10 PL centrifugal filter devices (Millipore).
Expression and detection of SpdB3, Spd79 and SpdB2. spdB3
and spd79 were amplified with primers SpdB3up and Spd79-flaglow,
and cloned into pYT via BamHI and HindIII sites, which had been
incorporated into the primer sequences. Primer Spd79-flaglow also
encoded a flag-tag. The resulting pYT3 plasmid encoded SpdB3 with
an N-terminal Strep-tag II (Voss & Skerra, 1997), and Spd79 with a
C-terminal flag-tag (Brizzard et al., 1994). Subsequently, a 1.4 kb
aac(3)IV cassette was inserted into the singular HindIII site, and the
whole fragment, including the rhamnose-inducible Prham promoter,
was amplified using primers Rhamup and Apralow. The PCR
fragment was digested with AgeI and MscI (sites included in primer
sequences), and cloned into pBG1, which had been cut with Kpn21
and MscI, generating pYT5.
MscI (Table 1), resulting in pYT7. A culture of E. coli BL21 (pYT7)
was induced with 0.2 % rhamnose, harvested by centrifugation,
resuspended in 1 M NaCl, 2 % Triton X-100, 25 mM Tris/HCl,
pH 7.5, and 20 % glycerol, and broken by French press treatment. The
strepII-TraB fusion protein was purified from the cleared lysate using
StrepTactin-Sepharose (IBA), according to the manufacturer’s
instructions. Protein samples were analysed for copurification of
SpdB2-His by SDS-PAGE and immunoblotting using anti-His
(Novagen) and anti-strep-tagII antibodies (IBA).
Agarose gel shift assay. A 0.5–1 mg quantity of DNA [pEB211,
pUC18, phage l HindIII fragments (Fermentas) and single-stranded
M13 DNA] was mixed with different amounts (2.5–15 pmol) of
SpdB2-His protein and reaction buffer (100 mM Tris/HCl, pH 8,
200 mM NaCl, 5 mM b-mercaptoethanol). After incubation at 24 uC
for 15 min, gel loading solution (10 mM Tris/HCl, pH 7.6, 0.03 %
bromophenol blue, 0.03 % xylene cyanol FF, 60 % glycerol and
60 mM EDTA) was added, and the mixture was analysed on a 1 %
agarose gel. Following electrophoresis, DNA bands were visualized by
ethidium-bromide staining. As a negative control, thioesterase The1,
which is involved in phosphinothricin tripeptide biosynthesis of
Streptomyces viridochromogenes, was expressed with a His-tag in E.
coli, and purified by Ni-NTA chromatography (S. Eys, W. Wohlleben
& E. Schinko, personal communication). The purified protein, which
contained additional contaminating E. coli proteins, did not show any
retardation of pEB211-DNA (data not shown).
Cross-linking of SpdB2. Approximately 5 mg SpdB2-His was
incubated in a total volume of 25 ml, with 0.01, 0.1 and 0.3 %
RESULTS
glutaraldehyde, in the presence and absence of 1.25 mM DTT, for 1 h
on ice. The reaction was stopped by adding 2.5 ml 1 M Tris/HCl,
pH 8.0. Cross-linking was analysed by using a 10 % SDS gel and
immunoblotting with Anti-His antibodies (Novagen).
Heterologous expression and purification of
SpdB2
Pulldown assay with StrepII-TraB. The 1.4 kb aac(3)IV cassette
was inserted into the HindIII site of pJR201 (Reuther et al., 2006a),
and a 3.5 kb fragment was amplified using primers Rhamup and
Apralow. Following digestion with AgeI and MscI, the respective
fragment was cloned into pGB1 that had been cut with Kpn21 and
Two operons of plasmid pSVH1 have been shown to be
involved in pock formation and intramycelial plasmid
spreading (Reuther et al., 2006b). SpdB2, encoded by the
spdB3–spd79–spdB2 operon, is the only Spd protein that
has a clear homologue in all conjugative Streptomyces
plasmids (Table 3). Four transmembrane helices and
Table 3. SpdB2 homologous proteins
Protein
SpdB2
SpdB2
SpdB2SL
TraI
FP11.21
FP1.21
SpdB2
Orf 231
SpdB
SpdB2
SCP2.27c
SpdA
SpdB2
Gp25
Plasmid/phage
No. of aa
pI
pSVH1
pSG5
pSLS
pMEA300
pFP11
pFP1
pJV1
pMR2
pIJ101
SLP1
SCP2
pSAM2
pSNA1
PhiC-31
409
404
408
374
465
480
371
231
291
335
533
224
309
238
9.6
10.01
10.91
10.58
9.76
10.82
9.84
9.48
5.66
6.75
5.79
5.07
6.70
4.79
Transmembrane Coiled coils
helices*
4
4
4
4
4
3 (4)
4
3 (4)
4
4
4
4
4
3 (4)
+
+
2
+
+
+
2
2
2
+
+
2
2
2
Signal
peptide
Pfam domain
2
2
+
2
2
2
+
+
+
+
2
+
2
+
–
–
TolA PF06519
–
–
–
TolA PF06519
–
–
–
–
–
–
–
*Number of transmembrane helices predicted with TMPRED (www.ch.embnet.org/software/TMPRED_form.html). Numbers in parentheses indicate
less significant predictions.
2978
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 18:31:34
Microbiology 153
Plasmid spreading during Streptomyces conjugation
Fig. 1. Purification of SpdB2-His from the
membrane fraction of S. lividans by Ni-NTA
chromatography. (a) Schematic drawing of
SpdB2 structure. The 409 aa SpdB2 protein
contains coiled coils at the N terminus, and
four transmembrane helices. (b) Subcellular
fractions of S. lividans (pYT90) were analysed
by SDS-PAGE and immunoblotting with Histag-specific antibodies (Novagen) for the
presence of SpdB2-His. Lanes: 1, crude
extract; 2, soluble proteins; 3, membraneassociated proteins; 4, integral membrane
proteins. (c) SpdB2-his was eluted from the
membrane fraction of S. lividans (pYT90) with
2 % Triton X-100, purified using a gravity flow
Ni-NTA Superflow column, and analysed by
using SDS-PAGE (10 %). Lanes: 1, flowthrough; 2, washing fraction; 3–6, elution
fractions; all with 250 mM imidazole. M,
protein molecular mass marker (Fermentas):
119, 79 and 46 kDa.
putative coiled-coil structures are predicted for the SpdB2
protein (Fig. 1a). spdB2 was fused with a C-terminal His6tag-encoding sequence, and expressed in E. coli under the
control of the Prham promoter (Wilms et al., 2001).
Whereas SpdB2-His was synthesized as insoluble inclusion
bodies at 37 uC, it was incorporated into the membrane of
E. coli at an incubation temperature of 30 uC (data not
shown). Minor amounts of SpdB2-His were also detected
in the membrane-associated fraction. Two hours after
induction of SpdB2 expression, the cultures began to lyse,
demonstrating that expression of the integral membrane
protein SpdB2-His was highly toxic to E. coli (data not
shown).
18 uC (Fig. 1b). Again, viability was affected after induction
of spdB2-His expression. Phase-contrast microscopy
revealed lysed hyphae (Fig. 2), suggesting that the
incorporation of SpdB2-His into the membrane interfered
with growth.
spdB2 fused with a C-terminal His6-tag-encoding sequence
was also expressed in S. lividans under the control of the
tipA promoter. As in E. coli, most of the SpdB2-His protein
was insoluble at an elevated incubation temperature
(30 uC), but was detected in the membrane fraction of S.
lividans when the expression culture was incubated at
Since SpdB2 is involved in intramycelial DNA translocation, the capability of SpdB2-His to interact with pSVH1
DNA was studied. Various amounts of SpdB2-His (0.5–
3 mg) were incubated with 1 mg pEB211 DNA, and
analysed for DNA-binding activity on a 1 % agarose gel.
In the presence of .1.5 mg SpdB2-His, migration of
Integral SpdB2-His was recovered from the membrane
fraction by Triton X-100 treatment, and it was purified by
non-denaturing Ni-NTA chromatography (Fig. 1c). From
400 ml S. lividans culture, approximately 100 mg soluble
SpdB2 protein was obtained.
DNA-binding activity
Fig. 2. Induction of spdB2-His expression
affects viability of S. lividans. S. lividans
(pYT90, a), and S. lividans (pGM190, b) as a
control, were grown for 1 day at 30 6C in Smedium on a rotary shaker. Expression was
induced by addition of 12.5 mg thiostrepton
ml”1, and growth was continued at 18 6C.
After 38 h induction, samples were taken and
processed for phase-contrast microscopy.
Arrows indicate lysed hyphae.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 18:31:34
2979
Y. Tiffert and others
experiments were performed. Purified SpdB2-His protein
was incubated with different amounts of glutaraldehyde in
the presence of DTT to prevent oxidation of the protein. The
cross-linked protein complexes were separated by SDSPAGE, and detected by immunoblotting with anti-His-tag
antibody. In the presence of 0.1–0.3 % glutaraldehyde, the
monomeric SpdB2-His disappeared, and higher molecular
mass bands, corresponding to a dimer, a tetramer and a
higher oligomer, were observed (Fig. 4).
Interaction of SpdB2 with other Spd proteins
Fig. 3. DNA-binding activity of SpdB2-his. Purified SpdB2-his
protein (0.5–3 mg) was incubated with 1 mg pSVH1 DNA (a), and
single-stranded M13-DNA (b), and electrophoresed on a 1 %
agarose gel. With increasing protein concentration, doublestranded pSVH1 DNA was retarded in the gel well, while the
single-stranded M13-DNA was not bound by SpdB2-his.
pEB211 DNA was retarded (Fig. 3a). The protein–DNA
complex was too large to enter the gel, suggesting that
multimers of SpdB2-His bound to the DNA. In contrast,
His-tagged thioesterase The1, used as a negative control,
did not show any DNA-binding activity (data not shown).
The DNA-binding activity of SpdB2-His was not specific
for plasmid pSVH1, since nonspecific DNAs, such as
pUC18 plasmid DNA or phage l DNA, were also shifted
(data not shown). Interestingly, SpdB2-His did not bind to
single-stranded M13 phage DNA (Fig. 3b).
The genetic organization of the spdB3–spd79–spdB2
operon, with translationally coupled genes, suggests a
cooperative function of the Spd proteins in plasmid
spreading. Spd79 contains a single transmembrane helix,
while SpdB3 is predicted to be a cytoplasmic protein. To
analyse the interaction of the Spd proteins, spdB3, spd79
and spdB2 were co-expressed in E. coli (pYT5) under the
control of the rhamnose-inducible Prham promoter, and
each protein had a distinct affinity tag (Strep-tagII, flag-tag
and His6-tag). Using affinity-tag-specific antibodies, the
subcellular localization of the respective proteins was
determined. While it was not possible to detect StrepIISpdB3 in any of the subcellular fractions (data not shown),
Spd79-flag and SpdB2-His were recognized by specific
antibodies. When the spd genes were expressed separately
(pYT3), Spd79-flag was mainly found as a soluble protein
in the cytoplasmic fraction, and only minor amounts were
detected in the membrane and membrane-associated
fractions. However, when spd79-flag was coexpressed with
spdB2-His (pYT5), the localization pattern of Spd79
changed, and the major amount of Spd79-flag was found
in the membrane and membrane-associated fractions
(Fig. 5), where SpdB2-His was localized (Fig. 1b). This
suggests that Spd79-flag interacts in vivo with the integral
membrane protein SpdB2-His.
Cross-linking of SpdB2
To analyse whether SpdB2 acts as a monomer, or forms an
oligomeric complex as suggested by the presence of coiledcoil structures in its N-terminal region, in vitro cross-linking
Interaction of SpdB2 with TraB
Since TraB is the only plasmid-encoded molecular motor
protein, a function of TraB in intramycelial plasmid
Fig. 4. Cross-linking of SpdB2-His with
glutaraldehyde. Purified SpdB2-his protein
(5 pmol) was incubated with glutaraldehyde
(0.01–0.3 %). Cross-linking products were
analysed by SDS-PAGE (10 %) and immunoblotting with Anti-His-tag antibodies
(Novagen). Protein bands corresponding to
the size of monomers, dimers, tetramers and
higher oligomers are marked by arrows.
2980
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 18:31:34
Microbiology 153
Plasmid spreading during Streptomyces conjugation
Fig. 5. The integral SpdB2-His protein affects
subcellular localization of Spd79-flag. strepIIspdB3 and spd79-flag were expressed in E.
coli under the control of the Prham promoter, in
the presence (pYT5) and absence (pYT3) of
SpdB2-His. (a) Schematic drawing of the
expression cassettes of plasmids pYT3 and
pYT5. (b) Detection of Spd79-flag (arrows)
in the subcellular fractions by immunoblotting with Anti-flag-tag-specific antibodies
(Stratagene). In the absence of SpdB2-His
(pYT3), most of the Spd79-flag was detected
as a soluble protein (lane 1). When spdB2-His
(pYT5) was simultaneously expressed, the
majority of the Spd79-flag localized to the
membrane fraction (lane 3) and the membrane-associated fraction (lane 2).
spreading has been postulated (Grohmann et al., 2003). To
analyse whether TraB interacts with the integral membrane
protein SpdB2, probably forming a multimeric protein
complex at the septal cross-walls, a strepII-TraB fusion
protein was coexpressed with SpdB2-His in E. coli (pYT7).
After induction of gene expression, the membrane proteins
were solubilized with 2 % Triton X-100 and 1 M NaCl, and
purified by StrepTactin affinity chromatography. The
washing and the elution fractions were analysed by SDSPAGE and immunoblotting for the presence of StrepIITraB and SpdB2-His. Elution fractions that contained
StrepII-TraB also contained SpdB2-His (Fig. 6). In
contrast, when crude extract containing only SpdB2-His
was applied to StrepTactin-Sepharose, SpdB2-His was not
detected in the elution fractions (data not shown). The
copurification of SpdB2-His with StrepII-TraB demonstrated a tight interaction of SpdB2 and TraB, indicating
that TraB is also involved in intramycelial plasmid
spreading.
DISCUSSION
Conjugal plasmid transfer in mycelial Streptomyces probably involves the subsequent spreading of the transferred
plasmid to the neighbouring mycelial compartments
(Hopwood & Kieser, 1993). This is believed to be the first
report on the characterization of Spd Proteins that are
required for intramycelial plasmid translocation.
Plasmid spreading on agar plates is manifested by growth
retardation zones, called pock structures, which indicate
the transconjugant areas (Bibb et al., 1981; Kieser et al.,
1982). The size of a pock structure suggests that starting
from a single germinating spore, several hundred transfer
or spreading events have to take place during one round of
conjugation. These inhibition zones are the result of
unregulated expression of the tra and spd genes
(Grohmann et al., 2003). TraB of many Streptomyces
plasmids represents a kill function (Kataoka et al., 1991;
Hagège et al., 1993). Also, expression of genes involved in
Fig. 6. Interaction of SpdB2-His with StrepIITraB. spdB2-His and strepII-traB were coexpressed in E. coli under the control of the
rhamnose-inducible Prham promoter (a).
Purification of StrepII-TraB via StrepTactin
chromatography resulted in the copurification
of SpdB2-His, as indicated by SDS-PAGE
and
immunoblotting
with
Anti-His-tag
(Novagen) and Anti-Strep tagII (IBA) antibodies (b).
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 18:31:34
2981
Y. Tiffert and others
pock formation can be detrimental. KilB of plasmid pIJ101
has been characterized as a kill-function protein (Kendall &
Cohen, 1987; Pettis et al., 2001), and in this study we
showed that inducing expression of the pSVH1 spdB2 gene
influenced viability of E. coli and S. lividans. Although the
rationale for the observed toxicity of the TraB and SpdB
proteins is unclear, it can be speculated that overexpression
of a putative pore-forming membrane protein may result
in cell lysis.
Several plasmid-encoded Spd proteins are involved in
intramycelial plasmid spreading. Interestingly, these proteins are highly diverse in different plasmids. Some of them
are very small (50–90 aa), and do not show any sequence
similarity to Spd proteins encoded by other plasmids
(Grohmann et al., 2003).
Although the SpdB2 homologues of different Streptomyces
plasmids do not possess conserved sequence motifs, they
are encoded by nearly all Streptomyces plasmids
(Grohmann et al., 2003). Surprisingly, even the actinophage PhiC-31 contains a SpdB2 homologue, which might be
involved in the intramycelial spreading of phage DNA
during infection (Smith et al., 1999). Despite the lack of
sequence similarity, the SpdB2 homologues show conserved features (Table 3), with most homologues containing four transmembrane helices. As expected for an integral
membrane protein, SpdB2-His of plasmid pSVH1 was
detected in the membrane fraction of E. coli, and could not
be solubilized by 1 M NaCl, but it was solubilized by 2 %
Triton X-100, demonstrating a tight interaction with the
membrane. Many SpdB2 homologues possess coiled-coil
structures, and contain imperfect 4–5 aa repetitive
sequences. Such structures are often involved in protein–
protein interaction (Fong et al., 2004). Cross-linking
experiments with SpdB2-His showed oligomerization.
Bands corresponding to dimers, tetramers and higher
molecular mass oligomers were detected. For seven of 13
SpdB2 proteins, a signal peptide was predicted. For
SpdB2sl from pSLS, and SpdB2 of pJV1, a Pfam TolA
domain was identified (http://smart.embl-heidelberg.de/).
TolA is involved in the uptake of colicins and singlestranded phage DNA (Click & Webster, 1998).
Genetic organization of the spd genes in operons with
translationally coupled genes suggests a cooperating
function of the respective proteins. Indeed, we showed
that the presence of the integral membrane protein SpdB2
directed the soluble Spd79 protein to the membrane,
suggesting that SpdB2 is required for correct localization of
Spd79. Furthermore, SpdB2 seemed to stabilize Spd79,
because higher concentrations of Spd79 were detected
when spdB2 was co-expressed.
Since the Spd proteins are involved in DNA translocation
via the septal cross-walls, interaction of one of the Spd
proteins with DNA was assumed. Such DNA-binding
activity was demonstrated for the integral membrane
protein SpdB2. In these experiments, SpdB2-His of
pSVH1 did not specifically interact with a specific pSVH1
2982
sequence, as was the case for TraB of pSVH1 that
recognized the clt locus, which is required for conjugal
pSVH1 transfer (Reuther et al., 2006a). SpdB2 bound to
any double-stranded DNA, irrespective of its conformation
or origin. At the moment, we cannot fully exclude that a
specific binding activity of SpdB2-His was lost during
membrane extraction and purification of the protein.
Interestingly, SpdB2 bound dsDNA only, and did not
interact with single-stranded M13 DNA; this supports the
concept of dsDNA transfer during Streptomyces conjugation (Reuther et al., 2006a; Possoz et al., 2001).
From sequence analysis, none of the Spd proteins is
predicted to have enzymic activity. Since DNA translocation to neighbouring mycelial compartments is a transport
process requiring energy, the involvement of a motor
protein has to be postulated. The only plasmid-encoded
molecular motor protein is the septal DNA translocator
ATPase TraB, which promotes plasmid transfer at the
hyphal tip (Reuther et al., 2006a). As we showed in a
pulldown assay, TraB interacted with SpdB2. This suggests
that TraB not only mediates the primary plasmid transfer
from the donor to the recipient, but also has a major role
during intramycelial plasmid spreading. A TraBpSG5-EGFP
fusion protein has been shown to be localized to the hyphal
tips (Reuther et al., 2006a), indicating that conjugation in
Streptomyces takes place at the tips of the mycelium. In
contrast, the plasmids have to be translocated via the septal
cross-walls during plasmid spreading. This implies that the
TraB protein, normally localized at the tip, has to be
redirected to the septal cross-walls. An interesting question
is whether the proposed redirection of TraB can be
visualized in an experimental approach by coexpression of
SpdB2pSG5 with TraBpSG5-EGFP.
We propose in a speculative model that plasmid spreading
is mediated by a multiprotein complex at the septal crosswalls. Oligomers of SpdB2, together with Spd79 and
probably other Spd proteins, form a membrane-traversing
channel. TraB interacts with this complex, and pumps
dsDNA through the Spd channel to the neighbouring
mycelial compartment.
ACKNOWLEDGEMENTS
We thank the Landesstiftung Baden-Württemberg GmbH ‘Kompetenznetzwerk Resistenz’ for financial support, and B. Gust for
helpful comments on the manuscript.
REFERENCES
Bibb, M. J., Ward, J. M., Kieser, T., Cohen, S. N. & Hopwood, D. A.
(1981). Excision of chromosomal DNA sequences from Streptomyces
coelicolor forms a novel family of plasmids detectable in Streptomyces
lividans. Mol Gen Genet 184, 230–240.
Brizzard, B. L., Chubet, R. G. & Vizard, D. L. (1994). Immunoaffinity
purification of FLAG epitope-tagged bacterial alkaline phosphatase
using a novel monoclonal antibody and peptide elution. Biotechniques
16, 730–735.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 18:31:34
Microbiology 153
Plasmid spreading during Streptomyces conjugation
Bullock, W. O., Fernandez, J. M. & Short, M. J. (1987). XL1-blue: a
Kosono, S., Kataoka, M., Seki, T. & Yoshida, T. (1996). The TraB
high efficiency plasmid transforming recA Escherichia coli strain with
b-galactosidase selection. Biotechniques 5, 376–379.
protein, which mediates the intermycelial transfer of the Streptomyces
plasmid pSN22, has functional NTP-binding motifs and is localized
to the cytoplasmic membrane. Mol Microbiol 19, 397–405.
Click, E. M. & Webster, R. E. (1998). The TolQRA proteins are
required for membrane insertion of the major capsid protein of the
filamentous phage f1 during infection. J Bacteriol 180, 1723–1728.
Flardh, K. (2003a). Essential role of DivIVA in polar growth and
morphogenesis in Streptomyces coelicolor A3(2). Mol Microbiol 49,
1523–1536.
Maas, R. M., Gotz, J., Wohlleben, W. & Muth, G. (1998). The
conjugative plasmid pSG5 from Streptomyces ghanaensis DSM 2932
differs in its transfer functions from other Streptomyces rolling-circletype plasmids. Microbiology 144, 2809–2817.
Pettis, G. S. & Cohen, S. N. (1994). Transfer of the pIJ101 plasmid in
Curr Opin Microbiol 6, 564–571.
Streptomyces lividans requires a cis-acting function dispensable for
chromosomal gene transfer. Mol Microbiol 13, 955–964.
Fong, J. H., Keating, A. E. & Singh, M. (2004). Predicting specificity in
Pettis, G. S., Ward, N. & Schully, K. L. (2001). Expression
Flardh, K. (2003b). Growth polarity and cell division in Streptomyces.
bZIP coiled-coil protein interactions. Genome Biol 5, R11.
Grohmann, E., Muth, G. & Espinosa, M. (2003). Conjugative plasmid
transfer in Gram-positive bacteria. Microbiol Mol Biol Rev 67,
277–301.
Hagège, J., Pernodet, J.-L., Sezonov, G., Gerbaud, C., Friedmann, A.
& Guérineau, M. (1993). Transfer functions of the conjugative
integrating element pSAM2 from Streptomyces ambofaciens: characterization of a kil-kor system associated with transfer. J Bacteriol
175, 5529–5538.
Hopwood, D. A. (2006). Soil to genomics: the Streptomyces
characteristics of the transfer-related kilB gene product of
Streptomyces plasmid pIJ101: implications for the plasmid spread
function. J Bacteriol 183, 1339–1345.
Possoz, C., Ribard, C., Gagnat, J., Pernodet, J. L. & Guerineau, M.
(2001). The integrative element pSAM2 from streptomyces: kinetics
and mode of conjugal transfer. Mol Microbiol 42, 159–166.
Reuther, J., Gekeler, C., Tiffert, Y., Wohlleben, W. & Muth, G. (2006a).
Unique conjugation mechanism in mycelial streptomycetes: a DNAbinding ATPase translocates unprocessed plasmid DNA at the hyphal
tip. Mol Microbiol 61, 436–446.
chromosome. Annu Rev Genet 40, 1–23.
Reuther, J., Wohlleben, W. & Muth, G. (2006b). Modular architecture
Hopwood, D. A. & Kieser, T. (1993). Conjugative plasmids of
of the conjugative plasmid pSVH1 from Streptomyces venezuelae.
Plasmid 55, 201–209.
streptomyces. In Bacterial Conjugation, pp. 293–311. Edited by D. B.
Clewell. New York: Plenum.
Hopwood, D. A. & Wright, H. M. (1973). Transfer of a plasmid between
Streptomyces species. J Gen Microbiol 77, 187–195.
Hopwood, D. A., Kieser, T., Wright, H. M. & Bibb, M. J. (1983).
Plasmids, recombination and chromosome mapping in Streptomyces
lividans 66. J Gen Microbiol 129, 2257–2269.
Hopwood, D. A., Chater, K. F. & Bibb, M. J. (1995). Genetics of
antibiotic production in Streptomyces coelicolor A3(2), a model
streptomycete. Biotechnology 28, 65–102.
Kataoka, M., Seki, T. & Yoshida, T. (1991). Regulation and function
of the Streptomyces plasmid pSN22 genes involved in pock formation
and inviability. J Bacteriol 173, 7975–7981.
Kendall, K. J. & Cohen, S. N. (1987). Plasmid transfer in Streptomyces
lividans: identification of a kil-kor system associated with the transfer
region of pIJ101. J Bacteriol 169, 4177–4183.
Kieser, T., Hopwood, D. A., Wright, H. M. & Thompson, C. J. (1982).
pIJ101, a multi-copy broad host-range Streptomyces plasmid: functional analysis and development of DNA cloning vectors. Mol Gen
Genet 185, 223–238.
Kieser, T., Bibb, M. J., Buttner, M. J., Chater, K. F. & Hopwood, D. A.
(2000). Practical Streptomyces Genetics. Norwich, UK: John Innes
Foundation.
http://mic.sgmjournals.org
Sambrook, J. & Russell, D. W. (2001). Molecular Cloning: a Laboratory
Manual, 3rd edn. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory.
Servı́n-González, L., Sampieri, A., Cabello, J., Galván, L., Juárez, V. &
Castro, C. (1995). Sequence and functional analysis of the
Streptomyces phaeochromogenes plasmid pJV1 reveals a modular
organization of Streptomyces plasmids that replicate by rolling circle.
Microbiology 141, 2499–2510.
Smith, M. C., Burns, R. N., Wilson, S. E. & Gregory, M. A. (1999). The
complete genome sequence of the streptomyces temperate phage
straight phiC31: evolutionary relationships to other viruses. Nucleic
Acids Res 27, 2145–2155.
Voss, S. & Skerra, A. (1997). Mutagenesis of a flexible loop in
streptavidin leads to higher affinity for the Strep-tag II peptide and
improved performance in recombinant protein purification. Protein
Eng 10, 975–982.
Wilms, B., Hauck, A., Reuss, M., Syldatk, C., Mattes, R., Siemann, M.
& Altenbuchner, J. (2001). High-cell-density fermentation for
production of L-N-carbamoylase using an expression system based
on the Escherichia coli rhaBAD promoter. Biotechnol Bioeng 73,
95–103.
Edited by: J. Anné
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 18:31:34
2983