J Neuropathol Exp Neurol
Vol. 75, No. 1, January 2016, pp. 86–98
doi: 10.1093/jnen/nlv004
ORIGINAL ARTICLE
Elevated Expression of the Cerebrospinal Fluid Disease
Markers Chromogranin A and Clusterin in Astrocytes of
Multiple Sclerosis White Matter Lesions
Marvin M. van Luijn, PhD, Marjan van Meurs, Marcel P. Stoop, PhD, Evert Verbraak, PhD,
Annet F. Wierenga-Wolf, Marie-José Melief, Karim L. Kreft, PhD, Robert M. Verdijk, MD, PhD,
Bert A. ’t Hart, PhD, Theo M. Luider, PhD, Jon D. Laman, PhD, and Rogier Q. Hintzen, MD, PhD
INTRODUCTION
Abstract
Using proteomics, we previously identified chromogranin A
(CgA) and clusterin (CLU) as disease-related proteins in the cerebrospinal fluid (CSF) of patients with multiple sclerosis (MS). CgA
and CLU are involved in cell survival and are implicated in neurodegenerative disorders and may also have roles in MS pathophysiology. We investigated CgA and CLU expression in lesions and
nonlesional regions in postmortem brains of MS patients and controls and in the brains of marmosets with experimental autoimmune
encephalomyelitis. By quantitative PCR, mRNA levels of CgA and
CLU were elevated in white matter but not in grey matter of MS patients. In situ analyses showed greater expression of CgA and CLU
in white matter lesions than in normal-appearing regions in MS patients and in the marmosets, primarily in or adjacent to perivascular
spaces and inflammatory infiltrates. Both proteins were expressed
by glial fibrillary acidic protein-positive astrocytes. CgA was more
localized in astrocytic processes and endfeet surrounding blood vessels and was abundant in the superficial glia limitans and ependyma,
2 CSF-brain borders. Increased expression of CgA and CLU in reactive astrocytes in MS white matter lesions supports a role for these
molecules as neuro-inflammatory mediators and their potential as
CSF markers of active pathological processes in MS patients.
Key Words: Apolipoprotein J, Astrogliosis, Cell survival, CSF proteomics, Glial fibrillary acidic protein, Neuroinflammation, White
matter pathology.
From the Departments of Immunology (MMVL, MVM, EV, AFW-W, MJM, JDL, RQH) and Neurology (MPS, KLK, TML, RQH), MS Center
ErasMS and Department of Pathology (RMV), Erasmus University Medical Center, Rotterdam, The Netherlands; Department of Immunobiology
(BAT), Biomedical Primate Research Centre, Rijswijk and Department
of Neuroscience, University Medical Center Groningen, The
Netherlands.
Send correspondence to: Prof Rogier Q. Hintzen, MD, PhD, Erasmus University Medical Center, Department of Neurology, Room Ba 4.92, PO Box
2040, 3000 CA Rotterdam, The Netherlands. E-mail: r.hintzen@
erasmusmc.nl
This study was supported by the Dutch MS Research Foundation (grant program no. 10-490c MS).
Supplementary Data can be found at http://www.jnen.oxfordjournals.org.
86
Multiple sclerosis (MS) is a chronic inflammatory disease of the central nervous system (CNS) characterized by
demyelination and axonal loss that eventually results in neurological disability (1, 2). The heterogeneous disease course
and limited access to primary CNS tissue make it a challenge
to unravel the complex pathogenetic events in MS. One way
to approach this is to identify and characterize proteins in the
MS brain that are associated with CNS pathogenesis. The application of cerebrospinal fluid (CSF) proteomics is a valuable tool in this respect and may guide insight into the prognosis and treatment of MS patients (3–7). Because the CSF
bathes CNS tissues, differences in CSF protein levels in MS
likely reflect pathogenic mechanisms underlying CNS parenchymal pathology.
In a previous proteomics study, we identified 2 proteins, chromogranin A (CgA) and clusterin (CLU), that were
differentially present in the CSF of MS patients compared
with patients with other neurological diseases (8). CgA and
CLU are molecules with numerous and versatile roles; they
are both implicated in cell survival and neurodegeneration
(Supplementary Data 1). CgA is a member of the granin family and is expressed and secreted by endocrine and brain tissue. In peripheral blood, it acts as a peptide hormone precursor and is a marker for specific types of cancer (9), but the
role of CgA in the CNS is less clear. It has been described as
triggering inflammatory, apoptotic, and neurotoxic pathways
in microglia (10, 11). This directly links to its upregulation in
Alzheimer disease (AD) (12, 13). CLU (ie, apolipoprotein J)
serves as a cytoprotective protein and tumor marker and is,
therefore, an important target for cancer treatment. It is expressed by different cell types but is most prevalent in brain
tissue (14, 15). In AD, CLU is genetically associated with disease risk (16, 17) and mediates pathological processes in the
brain via different mechanisms (18).
In this study, we hypothesized that the presence of CgA
and CLU in MS CSF might be the result of specific pathological processes in the brains of MS patients. To address this,
we studied the expression of CgA and CLU in distinct compartments and cells of postmortem brain material from MS
patients and controls. In addition, we assessed CgA and CLU
C 2015 American Association of Neuropathologists, Inc. All rights reserved.
V
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
expression in the brains of nonhuman primates with experimental autoimmune encephalomyelitis (EAE), an animal model of
MS. We found that CgA and CLU are increased in lesions of
white matter, predominantly in astrocytes, but not in grey matter of MS and EAE brain samples. These findings underscore
the role of CgA and CLU as potential CSF biomarkers in MS
patients.
MATERIALS AND METHODS
Primary Cells and Tissue
A collection of frozen postmortem white and grey matter
tissue blocks from patients with MS and AD, as well as nondemented controls (NDC) used in our group was obtained from
the Netherlands Brain Bank (Amsterdam, The Netherlands).
Peripheral blood mononuclear cells (PBMC) of MS patients
and controls were collected in Vacutainer CPT tubes (BD Biosciences, Erembodegem, Belgium). Patient characteristics are
shown in Table 1. Ages were significantly different for white
matter and PBMC between the MS and control groups (both
p < 0.01) but did not correlate with CgA and CLU levels (data
not shown). For grey matter, postmortem delay and pH of CSF
were only significantly different between the AD and NDC reference groups (Kruskal Wallis followed by Dunn’s test,
p < 0.001 and p < 0.01, respectively; data not shown). All patients and controls gave written informed consent for the use of
primary material and clinical data for research purposes. This
study was approved by the medical ethics committees of the
VU University Medical Center (Amsterdam) and the Erasmus
Medical Center (Rotterdam, The Netherlands).
Marmoset brain tissue was obtained from the Biomedical Primate Research Centre (BPRC) (Rijswijk, The Netherlands). Marmosets were immunized with nonglycosylated
recombinant human myelin oligodendrocyte glycoprotein
(rhMOG; amino acids 1–125; produced in E. coli at the
BPRC) in complete Freund’s adjuvant to induce EAE (n ¼ 5)
and were killed after 2 to 5 months (EAE clinical scores 2.5–
3.5, equivalent with serious motor deficits). The animal study
was done according to Dutch law on animal experimentation.
Brain tissue was collected and immediately stored at –80 C
or in liquid nitrogen until further use.
Quantitative Real-Time PCR
For RNA isolation, brain tissue was dissociated using a
gentleMACS Dissociator (Miltenyi Biotec, Auburn, CA). To
extract RNA from lysed cells, we used the GenElute Mammalian Total RNA kit (Sigma-Aldrich, Saint-Louis, MO) and
followed manufacturer’s instructions. DNAse I (Invitrogen,
Carlsbad, CA) was added to all samples. For cDNA synthesis,
we added 1 lg RNA to 20 ll standard cDNA reaction mix, including oligo(dT)15 primer (100 lg/ml, Promega, Madison,
WI) and Superscript II (200 U/ll; Invitrogen). After 50 minutes, incubation at 42 C, cDNA was heated for 3 minutes at
99 C, put on ice, and diluted 40 times with sterile H2O. Optimal primer-probe sets were designed via the Universal Probe
Library (Roche Applied Science, Penzberg, Germany). We
used the following primers for CgA (NM_001275.3) and CLU
(NM_001831.3), respectively: FW, CATCCAAGGATGTTAT
CgA and CLU Expression in MS White Matter
GGAGAAA, REV, GTCTGTGG CTTCACCACTTTT
(amplicon: 46 nt) and FW, GGGACC AGACGGTCTCAG,
REV,
CGTACTTACTTCCCTGATTGGAC
(amplicon:
60 nt). For each reaction, we added 6 ml of the diluted cDNA
to 9 ml reaction mix containing 1x TaqMan Universal Master
Mix (Applied Biosystems, Foster City, CA), primers (5 lM),
and probe (0.1 lM). Samples were measured using TaqMan
7900HT (Applied Biosystems). The thermal cycling protocol
included initial steps of 2 minutes at 50 C and 10 minutes at
95 C followed by 40 cycles of 15 seconds at 95 C and 1 minute at 60 C. CT values were analyzed using SDS 2.4.1 software (Applied Biosystems). Calibration curves and PCR efficiency for CgA and CLU were validated. Expression levels
were related to those of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and b-glucuronidase (GusB) (validated for
brain samples) and 18S (validated for PBMC samples) as reference genes using the primer/probe assays from Applied Biosystems. We followed the MIQE guidelines (Minimum Information for Publication of Quantitative Real-Time PCR
Experiments) for our quantitative PCR experiments (19).
Primary Antibodies
We used mouse antihuman CgA (PHE5; Santa Cruz
Biotechnology, Dallas, TX) and anti-CLU (E5; BD PharMingen, Franklin Lakes, NJ) monoclonal antibodies (mAbs) for
in situ analysis of frozen brain tissue samples. Their use and
specificity was confirmed by immunohistochemistry using
control human tissue (Supplementary Data 2). CgA immunoreactivity in brain tissue was compared between PHE5 and a
second anti-CgA mAb, LK2H10 (AbD Serotec, Oxford, UK)
using immunofluorescence and Western blotting. The source
and concentrations of all primary antibodies used in this study
are shown in Supplementary Data 3. Irrelevant isotype antibodies and omission of primary antibodies served as negative
controls.
Western Blotting
Brain tissue was homogenized using the gentleMACS
Dissociator (Miltenyi Biotec) and lysed in radio-immunoprecepitation assay (RIPA) lysis buffer supplemented with 10% complete protease inhibitor cocktail (Roche, Mannheim, Germany)
on ice for 30 minutes, centrifuged at 4 C for 10 minutes at
10,000 x g. Cell lysates were reduced with 10% DTT, loaded
onto a 10% precast polyacrylamide gel (Bio-Rad) followed by
immunoblotting on a Immobilon-P membrane (Merck Millipore, Darmstadt, Germany) for 1.5 hours at 4 C. Membranes
were blocked in 4% nonfat dry milk and incubated with mouse
antihuman CgA (PHE5) or b-actin (AC-15; Abcam, Cambridge,
UK) and horseradish peroxidase (HRP)-conjugated rabbit-antimouse Ig (Dako, Glostrup, Denmark). Protein bands were visualized using Western Lightning Plus-ECL (Perkin Elmer Inc.,
Waltham, MA).
Immunohistochemistry
Six-mm-thick frozen sections of brain tissue were
mounted on chrome alum/gelatin-coated glass slides. Frozen
sections are routinely used in our laboratory for in situ analyses
87
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
van Luijn et al
TABLE 1. Patient Characteristics
Analysis method
White matter
Number of patients
per analysis:
Male/female
Age in years, mean (range)
Postmortem delay in min, mean (range)
pH CSF, mean (range)a
Grey matter
Number of patients
per analysis:
qPCR
ISH
Both
qPCR
ISH
Both
Male/female
Age in years, mean (range)
pH CSF, mean (range)b
Postmortem delay in min, mean (range)
Brain areac
Inferior temporalis gyrus
Medial temporalis gyrus
Medial frontal gyrus
Superior temporalis gyrus
Superior frontal gyrus
PBMC
Number of patients
Male/female
Age in years, mean (range)
NDC
MS
AD
22
20
22
20
10/12
81 (68-92)
449 (175-1485)
6.56 (6.02-7.20)
36
21
32
17
13/23
62 (34-88)
473 (225-1020)
6.49 (5.68-6.92)
–
–
–
–
–
–
–
–
23
17
16
10
9/14
63 (38-82)
6.75 (6.25-7.18)
489 (175-865)
39
23
27
11
9/30
63 (34-81)
6.53 (5.99-7.22)
415 (180-700)
32
24
16
8
8/24
65 (42-77)
6.50 (6.06-7.36)
368 (210-900)
0 (0)
22 (92)
2 (8)
0 (0)
0 (0)
1 (2)
31 (74)
3 (7)
1 (2)
7 (17)
0 (0)
31 (97)
0 (0)
0 (0)
1 (3)
18
8/10
34 (19-50)
53
10/43
44 (22-72)
–
–
–
qPCR, quantitative PCR; ISH, in situ hybridization; min, minutes; CSF, cerebrospinal fluid; AD, Alzheimer disease; MS, multiple sclerosis; NDC, nondemented control; PBMC, peripheral blood mononuclear cells.
a
Data unavailable for 4 NDC and 2 MS patients.
b
Data unavailable for 3 NDC and 3 MS patients.
c
For 1 NDC and 4 MS patients, 2 different grey matter areas were used in separate analyses.
to assure optimal antigen reactivity. The slides were kept overnight in a box in a humidified atmosphere at room temperature
(RT). Sections were air-dried at RT for 1 hour and were stored
in a sealed box with silica gel until use. We used phosphate
buffered saline for white matter and Tris-buffered saline for
grey matter as wash and staining buffers. Human brain sections were fixed for 10 minutes with acetone containing 0.02%
H2O2 and air-dried for 10 minutes. Marmoset brain sections
were fixed with 4% paraformaldehyde (Sigma-Aldrich) containing 0.02% H2O2 and stained for endogenous peroxidase
with 4-chloro-1-naphthol (Sigma-Aldrich) in 0.05 M Tris-HCl.
After washing, primary antibodies were diluted in buffer containing 0.1% bovine serum albumin (BSA) to stain the slides
overnight at 4 C. Slides were washed in buffer with 0.05%
Tween and then incubated with biotinylated rabbit antimouse
IgG (Dako) in buffer/1% BSA/1% normal human serum for
30 minutes at RT. Avidin-biotin complex (ABC)-HRP conjugate (Dako) in buffer with 1% BSA was added for 1 hour. HRP
was detected using substrate with AEC (3-amino-9-ethyl-
88
carbozole; Sigma-Aldrich). Sections were counterstained with
Mayer’s hematoxylin (Merck, Schiphol-Rijk, The Netherlands) and sealed with Kaiser’s glycerol/gelatin (Boom NV,
Meppel, The Netherlands).
Lesion Staging and Quantification
Classification of the different lesion types in MS white
matter and grey matter was based on previous studies (20,
21). For MS white matter tissue, we used the presence of myelin and inflammatory cells to discriminate normal-appearing
regions (no myelin loss, hardly any human leukocyte antigen
class II (HLA-II) reactivity), as well as active, not demyelinated (no myelin loss, presence of HLA-II-positive cells), active, demyelinated (myelin loss, strong HLA-II reactivity
throughout lesion), chronic active (gliotic hypocellular center, active rim with HLA-II-positive cells), and chronic inactive (gliotic hypocellular) lesions. We used Oil Red O to detect myelin degradation products in macrophages, and we
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
used mAbs against HLA-II/MHC-II (major histocompatibility complex class II) and myelin proteolipid protein or MOG
to analyze brain inflammation and demyelination. Microtubule-associated protein-2 expression was assessed to distinguish white and grey matter tissue. CgA and CLU expression
was scored per lesional or nonlesional region as follows: 0,
no positive cells; 1, maximum of 5% of the cells positive;
2, 30% of the cells positive; 4, 60% of the cells positive;
6, 80% of the cells positive; 8, (virtually) all cells positive
(22).
Immunofluorescence
After incubation with 0.1% sodium cyanoborohydride
and 0.3 M glycine (Sigma-Aldrich), fixed brain slides were incubated with primary antibody for 1 hour at RT. Then, slides
were washed in buffer with 0.05% Tween and stained with an
AlexaFluor antimouse secondary antibody (Molecular Probes,
Eugene, OR) for 30 minutes at RT. Incubation was performed
in buffer with 10% normal human serum. For double staining,
the second primary antibody was either detected with AlexaFluor antibody (for rabbit anti-glial fibrillary acidic protein
[GFAP]) or directly labeled to an AlexaFluor using a Zenon labeling kit (Molecular Probes, for mouse anti-CD68 and antiNeuN mAbs). Slides were washed with buffer and incubated
with 0.3% Sudan Black B (Sigma-Aldrich) to prevent background fluorescence by lipids. Nucleus staining was performed
with DAPI (4’,6-diamidino-2-phenylindole; Life Technologies, Schiphol-Rijk), and the slides were embedded with Vectashield (Vector laboratories, Burlingame, CA). We used a
fluorescence (Zeiss Axioplan 2) and confocal laser-scanning
(Leica TCS SP2) microscope to analyze the cells.
Statistics
Statistical analyses were performed in GraphPad Prism
software (version 5.04). Two-tailed Mann-Whitney U test
was used to compare 2 groups. We performed the KruskalWallis followed by Dunn’s multiple comparison test for comparison of more than 2 groups. Correlations were evaluated
using the Spearman’s rank test. P < 0.05 was considered as
statistically different, and mean values and standard errors of
the mean are indicated.
RESULTS
CgA and CLU Levels Are Increased in White
Matter But Not in Grey Matter of MS Patients
We first assessed expression levels of CgA and CLU in
MS brains by analyzing mRNA from randomly chosen white
and grey matter tissue samples of patients and controls. In
MS white matter containing different lesions (Table 2), relative CgA and CLU mRNA levels were strongly increased
compared with those in NDC white matter (Supplementary
Data 4) (CgA means: 0.043 vs 0.008, p ¼ 0.01, Fig. 1A; CLU
means: 42.2 vs 16.1, p ¼ 0.007, Fig. 1B). For 2 NDC whitematter samples, CgA mRNA expression was not detected at
all; therefore, these data could not be included. Differences in
expression levels relative to those of GAPDH were verified
CgA and CLU Expression in MS White Matter
using a second housekeeping gene, GusB (Supplementary
Data 5A).
In grey matter tissue, CgA mRNA expression was not
different between MS patients (for cortical lesion staging, see
Table 2) and NDC (Fig. 1A; Supplementary Data 4). This did
not significantly change after normalizing for postmortem delay and pH of CSF, both of which correlated with CgA levels
(data not shown). Similar results were obtained for CLU (Fig.
1B), except for an elevated expression in grey matter of AD
patients (mean ¼ 11.6) compared with MS patients (mean ¼
6.1) and NDC (mean ¼ 5.4; Kruskal-Wallis followed by the
Dunn’s test, both P < 0.001; Fig. 1B). The difference between
AD patients and NDC was abrogated in older individuals (
69 years; Supplementary Data 5B). CgA and CLU mRNA
levels in PBMC from the blood of MS patients and healthy
controls were not different (p ¼ 0.50 and p ¼ 0.29, respectively; Supplementary Data 5C).
These results indicate an increase in CgA and CLU
mRNA expression levels in brain white matter but not grey
matter of MS patients. The predominance of active lesions in
these white matter samples (Table 2) suggests that both proteins are upregulated in lesional compared to nonlesional
areas of MS white matter.
CgA and Clusterin Are Strongly Expressed in
Astrocytes of MS White Matter Lesions
High numbers of CgA- and CLU-positive cells were
present in MS white matter, particularly in active demyelinating lesions; this contrasted with findings in the normal-appearing white matter, as determined by immunohistochemistry (Fig. 2A, B; Supplementary Data 6). These numbers
remained high in the majority of the few chronic inactive lesions that were encountered (CgA: score > 2.0 for 3 out of 5,
CLU: score > 2.0 for 5 out of 7). In NDC white matter, CgA
and CLU expression was low, with a moderate increase in
HLA-II-positive regions (data not shown). Additional staining for CLU was seen for endothelial cells in MS and NDC
white matter, but this was less intense than in MS white matter lesions. CgA and CLU were strongly expressed by GFAPpositive astrocytes, especially in those surrounding perivascular spaces and infiltrates in MS white matter (Figs. 2A, B,
3; Supplementary Data 6B, D). This was supported by strong
correlation of CgA and CLU with GFAP mRNA levels in
white matter tissue (Supplementary Data 7A). CgA was most
abundant in branched processes and perivascular endfeet
(glia limitans), whereas CLU was found more toward the
cell body of astrocytes (Fig. 3). CgA was not observed
in accumulations of nonphosphorylated neurofilament H
(Supplementary Data 7B), which is used as a determinant for
axonal dystrophy. In contrast to CgA, CLU-positive cells
were also seen within perivascular infiltrates of MS white
matter (Fig. 2A, B; Supplementary Data 6B, D). Analogous
findings were obtained in in situ analysis of white matter
from marmosets with rhMOG-induced EAE (Fig. 2C). The
co-expression of CLU, but not CgA, with CD68 in MS white
matter (Fig. 3) indicates that these cells are perivascular macrophages or microglia.
89
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
van Luijn et al
TABLE 2. Lesion Staging of Multiple Sclerosis White and Grey Matter Tissues Used for qPCR
White matter
Lesiona
Sample
A-ND
A-D
C-A
C-IA
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
MS WM1
MS WM2
MS WM3
MS WM4
MS WM5
MS WM6
MS WM7
MS WM8
MS WM9
MS WM10
MS WM11
MS WM12
MS WM13
MS WM14
MS WM15
MS WM16
MS WM17
MS WM18
MS WM19
MS WM20
MS WM21
Grey matter
Lesionb
Sample
Type I
Type II
Type III
Type IV
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
þ
MS GM1
MS GM2
MS GM3
MS GM4
MS GM5
MS GM6
MS GM7
MS GM8
MS GM9
MS GM10
MS GM11
MS GM12
MS GM13
MS GM14
MS GM15
MS GM16
MS GM17
MS GM18
MS GM19
MS GM20
MS GM21
MS GM22
MS GM23
qPCR, quantitative PCR; A-ND ¼ active lesion, not demyelinated; A-D ¼ active lesion, demyelinated; C-A ¼ chronic active lesion; C-IA ¼ chronic
inactive lesion; Type I ¼ mixed grey and white matter lesion; Type II ¼ small intracortical lesion; Type III ¼ widespread subpial lesion; Type IV ¼ lesion
that stops at white matter border; þ, lesion present in sample; , lesion not present in sample.
a
See Materials and Methods for lesion staging.
b
Lesion staging based on (20).
These data show that the increased levels of CgA and
CLU in MS white matter result from restricted expression by
GFAP-positive astrocytes in pre-active and active demyelinating lesions. This suggests that both proteins are directly involved in pathogenic events mediated by reactive astrocytes
in MS white matter.
High Expression of CgA in Cerebral Surface
Layers Bordering the Subarachnoid Space
In grey matter of MS patients, CgA-positive astrocytes
were also present but were less prominent in MS and NDC
than in AD samples (Supplementary Data 8A). CgA immunoreactivity in astrocytes detected using mAb PHE5 in astrocytes was more pronounced than in neurons, which was
in sharp contrast to a second mAb against human CgA,
LK2H10 (Supplementary Data 8B–D). Similar, but also some
different, forms of CgA were recognized by these antibodies
in brain tissue (Supplementary Data 9), likely reflecting differences in CgA cleavage products and epitope specificity.
CLU was also expressed in cortical astrocytes, but
the strongest expression was observed in neurons, which was
increased in MS compared with NDC and AD grey matter
90
tissue (Supplementary Data 10). In contrast to MS white-matter lesions (Fig. 2), CgA and CLU expression was low in cortical MS lesions (ie., types I–IV in [20]; Table 2) and was
comparable to nonlesional MS and NDC grey matter (data
not shown). As described previously (18), CLU was highly
abundant in the cerebral cortex in patients with AD, that is, in
association with amyloid plaques (Supplementary Data 10A).
Because both CgA and CLU were exclusively found in
MS CSF (8), we also explored their expression in cortical and
ventricular surfaces. CgA showed restricted and pronounced
expression in the superficial (cortical) glia limitans (Fig. 4A–
C), the subpial layer of astrocytic endfeet covering the subarachnoid CSF. This was more prevalent in MS patient brains
than in NDC and AD grey matter (Fig. 4B) and resembled the
presence of CgA in the perivascular glia limitans (Fig. 2A;
Supplementary Data 8A). The expression of CgA in the superficial glia limitans was widespread and not restricted to
subpial cortical lesions in MS (data not shown). CLU was
mostly lacking in the superficial glia limitans, although some
astrocytes below this layer also showed CLU expression (Fig.
4B, C). The same expression patterns were found for the
brains of marmosets with EAE (Fig. 4D). Furthermore, CgA,
but not CLU, was abundant in cuboidal ependymal cells as
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
CgA and CLU Expression in MS White Matter
FIGURE 1. Chromogranin A (CgA) (A) and clusterin (CLU) (B) mRNA levels in postmortem tissue samples. For white matter samples of MS patients, n ¼ 21 for both CgA and CLU; nondemented controls (NDC), CgA: n ¼ 18, CLU: n ¼ 20. For grey matter samples of MS patients, n ¼ 23 for both CgA and CLU; NDC, CgA: n ¼ 17, CLU: n ¼ 16; Alzheimer disease (AD) patients, CgA: n ¼ 24,
CLU: n ¼ 23. CgA and CLU expression levels were related to those of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). We used the Mann-Whitney U (A) and the Kruskal-Wallis followed by Dunn’s multiple comparison test (B)
to compare the different groups. **p < 0.01, ***p < 0.001.
DISCUSSION
well (Fig. 4E). These observations suggest that CgA and
CLU are not overrepresented in MS grey matter tissue, consistent with their expression at the mRNA level (Fig. 1). The
prominent expression of CgA in these brain surface layers offers a potential link to its presence in MS CSF.
The loss in maintenance of neuronal integrity underlies
many neurological disorders, in which disturbed interactions
between neurons and glial cells are central events. To understand this better, it is pivotal to determine changes in celland tissue-specific expression and regulation of molecules
91
van Luijn et al
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
FIGURE 2. Immunohistochemical analysis of chromogranin A (CgA) (A) and clusterin (CLU) (B) in MS normal-appearing white
matter (NAWM; CgA: n ¼ 15, CLU: n ¼ 20) in active lesions that are not demyelinated (A-ND; CgA: n ¼ 42, CLU: n ¼ 48) or are
demyelinated (A-D; CgA: n ¼ 10, CLU: n ¼ 17) and in or surrounding perivascular infiltrates (PVI; CgA: n ¼ 17, CLU: n ¼ 19) of MS
white matter. Brain sections of 25 (A) and 30 (B) MS patients were assessed. To quantify the expression patterns, we used standard arbitrary scores representing the number of positive cells in each lesional and nonlesional area. The images shown for nondemented controls (NDC) were negative for HLA-II and are representative of 15 different NDC. (C) CgA and CLU expression in or
close to PVI in the white matter of a marmoset with experimental autoimmune encephalomyelitis (EAE). We analyzed a total of 22
PVI in the brains of 5 animals.
92
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
CgA and CLU Expression in MS White Matter
FIGURE 2. Continued
involved in neuronal survival in brain diseases. CgA and
CLU are survival proteins involved in neurodegeneration, but
their roles in CNS inflammatory demyelinating disorders are
not well understood. In this report, we demonstrate that CgA
and CLU levels are elevated in the white matter, but not grey
matter, of MS patients. Both CgA and CLU showed high expression in pre-active (ie., inflammatory but not overtly demyelinating) and active demyelinating MS white-matter lesions, especially in astrocytes. These results suggest that CgA
and CLU are involved in the pathogenesis of MS, probably
by mediating neuronal integrity, and they enhance our previous findings that both proteins are differentially present in
MS CSF (8), which has been confirmed by other independent
studies (23, 24).
The high abundance of CgA and CLU in GFAP-positive astrocytes in MS white matter lesions suggests a critical
role of these molecules during astrogliosis, a typical pathological event in neurological diseases. Astrocyte activation
includes upregulation of GFAP and proliferation in response
to brain injury. The moderate increase of CgA and CLU expression in some HLA-II-positive cell areas of NDC white
matter indicates that this is probably a general response of astrocytes to brain inflammation. In amyotrophic lateral sclerosis model mice, CgA was co-expressed with GFAP in
reactive astrocytes in the spinal cord, in contrast to wild type
mice (25). CgA is also one of the few members of the granin
family that is expressed by astrocytes in the brains of patients
with AD (26). Secretion of CgA by these cells probably triggers signaling pathways in microglia resulting in neuronal
death, including iNOS (inducible nitric oxide synthase) production, mitochondrial stress, apoptosis, and glutamate release (10, 27, 28). CgA triggering of microglia can also stimulate the production of interleukin-1b (29), which is strongly
linked to inflammatory disorders (30). Additionally, our previous proteomics study identified CgA fragment YPGPQAEGDSEGLSQGLVDR in the CSF of MS patients (8), revealing 70% similarity to chromacin, a CgA-derived peptide
with antibacterial activity (31). Thus, CgA probably serves as
an immunostimulatory molecule in the brain in MS patients
by triggering innate mechanisms contributing to neurodegeneration (32).
For CLU, not only the cell type, but also the molecular
characteristics are important for its function, making it a considerable challenge to determine its role in pathogenesis.
Under steady-state conditions, CLU is mainly present in its
secreted form and serves as a complement inhibitor (33). In
our proteomics study, we also identified C3 as another member of the complement system in MS CSF (8). Both positive
93
van Luijn et al
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
FIGURE 3. Immunofluorescence staining of MS white matter tissue with mouse monoclonal antibodies to chromogranin A (CgA)
(A) or clusterin (CLU) (B). Sections were stained with antimouse AF488 second antibody (green) and with either anti-GFAP (astrocyte marker) or anti-CD68 (microglia/macrophage marker), with anti-rabbit AF594 or AF647 second antibody, respectively.
Images are representative of at least 3 different patients.
94
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
CgA and CLU Expression in MS White Matter
FIGURE 4. Grey matter tissue from MS patients and from marmosets with experimental autoimmune encephalomyelitis (EAE) assessed for chromogranin A (CgA) and clusterin (CLU) expression in and surrounding the superficial glia limitans and the ependyma. (A) Representative immunostaining for CgA at the superficial glia limitans of the brain of an MS patient. Antimicrotubuleassociated protein-2 was used to detect the grey matter. (B) Quantification of CgA- and CLU-positive cells at the superficial glia
limitans of MS grey matter (CgA, n ¼ 22, CLU: n ¼ 23) compared to grey matter of nondemented controls (NDC) (CgA: n ¼ 10,
CLU: n ¼ 9) and Alzheimer disease (AD) patients (CgA: n ¼ 11, CLU: n ¼ 10). We used arbitrary scores representing the number of
positive cells. (C) Representative staining for CgA and CLU with the astrocyte marker GFAP at the superficial glia limitans of MS
brain. This was observed for at least 3 different patients. (D, E) Immunohistochemical analysis of CgA and CLU at the glia limitans
(D; n ¼ 5) and cuboid ependymal cells (E; n ¼ 2) in the brain of marmosets with EAE.
95
van Luijn et al
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
FIGURE 4. Continued
and negative effects of the complement system on neuropathology have been reported (34, 35). However, under certain
stress conditions, CLU can circumvent the secretory pathway
to reach the cytoplasm or the nucleus (36), thereby changing
its function. Cytoplasmic CLU inhibits apoptosis by binding
to activated Bax (37), whereas the nuclear isoform of CLU is
pro-apoptotic (38, 39). Therefore, neuronal accumulation of
CLU in MS could adversely affect cell survival, as shown for
neurons after brain injury in mice (40). These contradictory
roles of CLU are currently intensely debated (41).
Their elevated levels in MS CSF (8), and not, for example, in the CSF of AD patients (42, 43), is likely the result of
astrocytic activation in the white matter, as reported for other
astrocyte-derived proteins in MS, such as GFAP and S100B
(44–46). In follow-up EAE studies, CgA and CLU were not
found in the CSF after disease onset (47, 48). This is likely related to the different aspects that are mimicked in the rat EAE
model, such as the lack of demyelination (49). In the present
study, CgA and CLU show strongest expression in active demyelinating white matter MS lesions. Although not significant,
96
both proteins were also differentially abundant in MS CSF
after treatment with natalizumab (anti-VLA4 mAb) (50), an effective therapeutic agent in MS.
In addition to the superficial glia limitans and the ependyma, CgA is highly abundant at the glia limitans of perivascular spaces. This could either mean that CgA is actively secreted by astrocytes into MS CSF, or reflect a passive
phenomenon in which CgA regulates the enhanced bloodbrain barrier permeability found in MS (51), thereby leaking
into the CSF. The possibility that there is more uptake of
CgA and CLU by reactive astrocytes seems less likely because their mRNA expression was elevated and correlated
with GFAP expression in MS white matter. The abundance of
CLU in MS CSF may be explained by its role as carrier of
several proteins across the blood-brain and -CSF barrier, such
as b-amyloid (52, 53). Amyloid precursor protein is upregulated during axonal injury in MS (54), and CLU may clear it
and prevent aggregation of b-amyloid (55), eventually ending
up in the CSF to control ongoing inflammation in the MS
brain by functioning as a complement inhibitor. Together, the
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
strong association of CgA and CLU expression with MS brain
pathology supports future research into their role as neuroinflammatory mediators and CSF biomarkers for disease development in MS.
ACKNOWLEDGMENTS
The authors acknowledge Dr Inge Huitinga (Netherlands Brain Bank, Amsterdam, The Netherlands) for providing input on our immunohistochemical analyses of cortical
brain sections. The authors thank Alex Nigg (Erasmus Optical Imaging Centre, Rotterdam, The Netherlands) for technical assistance with confocal microscopy. The authors also
thank Dr Liesbeth Bakker-Jonges (Reinier de Graaf Gasthuis,
Delft, The Netherlands) for the human pancreas sections.
REFERENCES
1. Compston A, Coles A. Multiple sclerosis. Lancet 2008;372:1502–17
2. Stys PK, Zamponi GW, van Minnen J, et al. Will the real multiple sclerosis please stand up? Nat Rev Neurosci 2012;13:507–14
3. Comabella M, Fernandez M, Martin R, et al. Cerebrospinal fluid chitinase 3-like 1 levels are associated with conversion to multiple sclerosis.
Brain 2010;133:1082–93
4. Irani DN, Anderson C, Gundry R, et al. Cleavage of cystatin C in the cerebrospinal fluid of patients with multiple sclerosis. Ann Neurol 2006;
59:237–47
5. Komori M, Matsuyama Y, Nirasawa T, et al. Proteomic pattern analysis
discriminates among multiple sclerosis-related disorders. Ann Neurol
2012;71:614–23
6. Stangel M, Fredrikson S, Meinl E, et al. The utility of cerebrospinal fluid
analysis in patients with multiple sclerosis. Nat Rev Neurol 2013;9:267–
76
7. Stoop MP, Singh V, Stingl C, et al. Effects of natalizumab treatment on
the cerebrospinal fluid proteome of multiple sclerosis patients. J Proteome Res 2013;12:1101–7
8. Stoop MP, Dekker LJ, Titulaer MK, et al. Multiple sclerosis-related proteins identified in cerebrospinal fluid by advanced mass spectrometry.
Proteomics 2008;8:1576–85
9. Corti A. Chromogranin A and the tumor microenvironment. Cell Mol
Neurobiol 2010;30:1163–70
10. Hooper C, Pocock JM. Chromogranin A activates diverse pathways mediating inducible nitric oxide expression and apoptosis in primary microglia. Neurosci Lett 2007;413:227–32
11. Wu Z, Sun L, Hashioka S, et al. Differential pathways for interleukin1beta production activated by chromogranin A and amyloid beta in
microglia. Neurobiol Aging 2013;34:2715–25
12. Lassmann H, Weiler R, Fischer P, et al. Synaptic pathology in Alzheimer’s disease: Immunological data for markers of synaptic and large
dense-core vesicles. Neuroscience 1992;46:1–8
13. Yasuhara O, Kawamata T, Aimi Y, et al. Expression of chromogranin A
in lesions in the central nervous system from patients with neurological
diseases. Neurosci Lett 1994;170:13–6
14. de Silva HV, Harmony JA, Stuart WD, et al. Apolipoprotein J: Structure
and tissue distribution. Biochemistry 1990;29:5380–9
15. Pasinetti GM, Johnson SA, Oda T, et al. Clusterin (SGP-2): A multifunctional glycoprotein with regional expression in astrocytes and neurons of
the adult rat brain. J Comp Neurol 1994;339:387–400
16. Harold D, Abraham R, Hollingworth P, et al. Genome-wide association
study identifies variants at CLU and PICALM associated with Alzheimer’s disease. Nat Genet 2009;41:1088–93
17. Lambert JC, Heath S, Even G, et al. Genome-wide association study
identifies variants at CLU and CR1 associated with Alzheimer’s disease.
Nat Genet 2009;41:1094–9
18. Yu JT, Tan L. The role of clusterin in Alzheimer’s disease: Pathways,
pathogenesis, and therapy. Mol Neurobiol 2012;45:314–26
19. Bustin SA, Benes V, Garson JA, et al. The MIQE guidelines: minimum
information for publication of quantitative real-time PCR experiments.
Clin Chem 2009;55:611–22
CgA and CLU Expression in MS White Matter
20. Bö L, Geurts JJ, Mörk SJ, et al. Grey matter pathology in multiple sclerosis. Acta Neurol Scand Suppl 2006;183:48–50
21. van der Valk P, de Groot CJ. Staging of multiple sclerosis (MS) lesions:
Pathology of the time frame of MS. Neuropathol Appl Neurobiol
2000;26:2–10
22. Kreft KL, van Meurs M, Wierenga-Wolf AF, et al. Abundant kif21b is
associated with accelerated progression in neurodegenerative diseases.
Acta Neuropathol Commun 2014;2:144
23. Kroksveen AC, Aasebo E, Vethe H, et al. Discovery and initial verification of differentially abundant proteins between multiple sclerosis patients and controls using iTRAQ and SID-SRM. J Proteomics
2013;78:312–25
24. Stoop MP, Dekker LJ, Titulaer MK, et al. Quantitative matrix-assisted laser desorption ionization-fourier transform ion cyclotron resonance
(MALDI-FT-ICR) peptide profiling and identification of multiple-sclerosis-related proteins. J Proteome Res 2009;8:1404–14
25. Urushitani M, Sik A, Sakurai T, et al. Chromogranin-mediated secretion
of mutant superoxide dismutase proteins linked to amyotrophic lateral
sclerosis. Nat Neurosci 2006;9:108–18
26. Lechner T, Adlassnig C, Humpel C, et al. Chromogranin peptides in Alzheimer’s disease. Exp Gerontol 2004;39:101–13
27. Kingham PJ, Cuzner ML, Pocock JM. Apoptotic pathways mobilized in
microglia and neurones as a consequence of chromogranin A-induced
microglial activation. J Neurochem 1999;73:538–47
28. Ciesielski-Treska J, Ulrich G, Taupenot L, et al. Chromogranin A induces a neurotoxic phenotype in brain microglial cells. J Biol Chem
1998;273:14339–46
29. Terada K, Yamada J, Hayashi Y, et al. Involvement of cathepsin B in the
processing and secretion of interleukin-1beta in chromogranin A-stimulated microglia. Glia 2010;58:114–24
30. Ludigs K, Parfenov V, Du Pasquier RA, et al. Type I IFN-mediated regulation of IL-1 production in inflammatory disorders. Cell Mol Life Sci
2012;69:3395–418
31. Strub JM, Goumon Y, Lugardon K, et al. Antibacterial activity of glycosylated and phosphorylated chromogranin A-derived peptide 173-194
from bovine adrenal medullary chromaffin granules. J Biol Chem 1996;
271:28533–40
32. Heneka MT, Kummer MP, Latz E. Innate immune activation in neurodegenerative disease. Nat Rev Immunol 2014;14:463–77
33. Kirszbaum L, Bozas SE, Walker ID. SP-40,40, a protein involved in the
control of the complement pathway, possesses a unique array of disulphide bridges. FEBS Lett 1992;297:70–6
34. Fluiter K, Opperhuizen AL, Morgan BP, et al. Inhibition of the membrane attack complex of the complement system reduces secondary neuroaxonal loss and promotes neurologic recovery after traumatic brain
injury in mice. J Immunol 2014;192:2339–48
35. Wyss-Coray T, Yan F, Lin AH, et al. Prominent neurodegeneration and
increased plaque formation in complement-inhibited Alzheimer’s mice.
Proc Natl Acad Sci U S A 2002;99:10837–42
36. Nizard P, Tetley S, Le Dréan Y, et al. Stress-induced retrotranslocation
of clusterin/ApoJ into the cytosol. Traffic 2007;8:554–65
37. Zhang H, Kim JK, Edwards CA, et al. Clusterin inhibits apoptosis by interacting with activated Bax. Nat Cell Biol 2005;7:909–15
38. Leskov KS, Klokov DY, Li J, et al. Synthesis and functional analyses
of nuclear clusterin, a cell death protein. J Biol Chem 2003;278:11590–
600
39. Yang CR, Leskov K, Hosley-Eberlein K, et al. Nuclear clusterin/XIP8,
an x-ray-induced Ku70-binding protein that signals cell death. Proc Natl
Acad Sci U S A 2000;97:5907–12
40. Han BH, DeMattos RB, Dugan LL, et al. Clusterin contributes to caspase-3-independent brain injury following neonatal hypoxia-ischemia.
Nat Med 2001;7:338–43
41. Prochnow H, Gollan R, Rohne P, et al. Non-secreted clusterin isoforms
are translated in rare amounts from distinct human mRNA variants and
do not affect Bax-mediated apoptosis or the NF-kappaB signaling pathway. PLoS One 2013;8:e75303
42. Lidstrom AM, Hesse C, Rosengren L, et al. Normal levels of clusterin in
cerebrospinal fluid in Alzheimer’s disease, and no change after acute ischemic stroke. J Alzheimers Dis 2001;3:435–42
43. O’Connor DT, Kailasam MT, Thal LJ. Cerebrospinal fluid chromogranin A is unchanged in Alzheimer dementia. Neurobiol Aging
1993;14:267–9
97
van Luijn et al
J Neuropathol Exp Neurol Volume 75, Number 1, January 2016
44. Axelsson M, Malmestrom C, Nilsson S, et al. Glial fibrillary acidic protein: a potential biomarker for progression in multiple sclerosis. J Neurol
2011;258:882–8
45. Takano R, Misu T, Takahashi T, et al. Astrocytic damage is far more severe than demyelination in NMO: A clinical CSF biomarker study. Neurology 2010;75:208–16
46. Petzold A, Eikelenboom MJ, Gveric D, et al. Markers for different glial
cell responses in multiple sclerosis: Clinical and pathological correlations. Brain 2002;125:1462–73
47. Stoop MP, Rosenling T, Attali A, et al. Minocycline effects on the cerebrospinal fluid proteome of experimental autoimmune encephalomyelitis
rats. J Proteome Res 2012;11:4315–25
48. Rosenling T, Stoop MP, Attali A, et al. Profiling and identification of
cerebrospinal fluid proteins in a rat EAE model of multiple sclerosis.
J Proteome Res 2012;11:2048–60
49. Meeson AP, Piddlesden S, Morgan BP, et al. The distribution of inflammatory demyelinated lesions in the central nervous system of rats with
antibody-augmented demyelinating experimental allergic encephalomyelitis. Exp Neurol 1994;129:299–310
98
50. Stoop MP, Singh V, Stingl C, et al. Effects of natalizumab treatment on
the cerebrospinal fluid proteome of multiple sclerosis patients. J Proteome Res 2013;12:1101–7
51. Corti A, Ferrero E. Chromogranin A and the endothelial barrier function.
Curr Med Chem 2012;19:4051–8
52. Ghiso J, Matsubara E, Koudinov A, et al. The cerebrospinal-fluid soluble
form of Alzheimer’s amyloid beta is complexed to SP-40,40 (apolipoprotein J), an inhibitor of the complement membrane-attack complex. Biochem J 1993;293(Pt 1):27–30
53. Zlokovic BV, Martel CL, Matsubara E, et al. Glycoprotein 330/megalin:
Probable role in receptor-mediated transport of apolipoprotein J alone
and in a complex with Alzheimer disease amyloid beta at the blood-brain
and blood-cerebrospinal fluid barriers. Proc Natl Acad Sci U S A
1996;93:4229–34
54. Ferguson B, Matyszak MK, Esiri MM, et al. Axonal damage in acute
multiple sclerosis lesions. Brain 1997;120(Pt 3):393–9
55. Li X, Ma Y, Wei X, et al. Clusterin in Alzheimer’s disease: A player in
the biological behavior of amyloid-beta. Neurosci Bull 2014;30:162–8