MOLECULAR AND CELLULAR BIOLOGY, Mar. 1994, p. 1893-1900
Vol. 14, No. 3
0270-7306/94/$04.00+0
Copyright © 1994, American Society for Microbiology
The Deadenylation Conferred by the 3' Untranslated Region of
a Developmentally Controlled mRNA in Xenopus Embryos Is
Switched to Polyadenylation by Deletion of a
Short Sequence Element
PHILIPPE BOUVET,t FRANCIS
OMILLI, YANNICK ARLOT-BONNEMAINS, VINCENT LEGAGNEUX,
CHRISTIAN ROGHI, THERESE BASSEZ, AND H. BEVERLEY OSBORNE*
Departement de Biologie et Genetique du Developpement, URA 256 CNRS, Universite de Rennes 1,
Campus de Beaulieu, 35042 Rennes Cedex, France
Received 21 September 1993/Returned for modification 22 November 1993/Accepted 8 December 1993
The maternal Xenopus Eg mRNAs are adenylated and translated in the mature oocyte and then, after
fertilization, are deadenylated and released from polysomes. Therefore, after fertilization, a change occurs in
the cellular mechanisms that control mRNA adenylation. In the study reported here, we show that the 3'
untranslated region of Eg2 mRNA contains a cis-acting element that is required for the deadenylation of
chimeric RNAs after fertilization. This cis-acting element is contained within a single 17-nucleotide portion of
the Eg2 mRNA. Disruption of this deadenylation element allows adenylation of the chimeric transcripts in the
embryo. Therefore, this cis-acting element is part of the sequence information required for the developmental
switch from adenylation to deadenylation of the maternal Eg2 mRNA in Xenopus embryos.
Most mRNAs have at their 3' ends a polyadenylate tract that
is added to the primary transcript by a nuclear polyadenylation
complex (reviewed in reference 31). At least two aspects of the
cytoplasmic posttranscriptional control of gene expression are
associated with changes in the length of this 3' poly(A) tail.
First, the degradation of several short-lived mRNAs that
encode proto-oncogenes or cytokines is immediately preceded
by a shortening of the 3' poly(A) tract (2, 15, 26, 28, 34).
Second, the 3' poly(A) tract of an mRNA can act as a
translational enhancer (11, 20).
Modulation of poly(A) tail length as a means to control
translation in the amphibian Xenopus laevis has been extensively described. Poly(A)+ RNAs injected into oocytes are
recruited more efficiently onto polysomes than are their
poly(A)- counterparts (7). During maturation of the fully
grown Xenopus oocyte into a fertilizable egg and in early
embryos, the recruitment of an mRNA onto polysomes is
coupled with an elongation of its poly(A) tail; conversely, the
release of a mRNA from polysomes is associated with its
deadenylation (10, 18, 25). This same coupling also occurs
during the meiotic maturation of mouse oocytes (30) and
possibly in Drosophila oocytes (32). In X laevis, this cytoplasmic polyadenylation of stored maternal mRNAs is required for
oocyte maturation, showing the biological importance of this
process (13).
During oocyte maturation in X. laevis, the specificity of the
cytoplasmic poly(A) elongation process, as well as that which
maintains a poly(A) tail on a maternal mRNA, is directed by
cis-acting elements situated in the 3' untranslated region
(UTR) of the mRNA (5, 18), called cytoplasmic polyadenylation elements (CPEs) (19) or adenylation control elements (1).
Therefore, CPE-containing maternal mRNAs are polyadeny-
lated in the mature oocyte. Concomitantly, other maternal
mRNAs are deadenylated and released from polysomes (10).
This deadenylation occurs by a default process in that it does
not require any cis-acting sequence (6, 29).
After fertilization, the specificity of the cellular machinery
involved in the adenylation-elongation and deadenylation processes changes. Certain maternal mRNAs that are poly(A)+ in
the mature oocyte, for instance, those identified by Dworkin et
al. (4) and ornithine decarboxylase (ODC) (22), remain adenylated in the embryo. Another class of maternal mRNAs
that are also adenylated in the mature oocyte but are rapidly
deadenylated after fertilization has been identified and given
the generic designation Eg mRNAs (24, 25). The deadenylation of Eg mRNAs is uncoupled from their degradation, which
occurs several hours later, after the mid-blastula transition (3).
Like other maternal mRNAs that are poly(A)+ in the
mature oocyte, the 3' UTRs of the Eg mRNAs sequenced so
far contain one or several CPE motifs (17, 23). Therefore, in
mechanistic terms, the postfertilization switch in the adenylation behavior of Eg mRNAs can be explained in several ways.
For instance, the CPEs in these mRNAs may no longer
activate the polyadenylation pathway after fertilization, allowing deadenylation by a default process. Alternatively, these
mRNAs could contain cis-acting elements that specifically
direct them to be deadenylated in the embryo.
We have previously shown (16) that hybrid mRNAs containing at their 3' ends the distal portion of the 3' UTR of Eg2
mRNA (Eg2-410) are deadenylated in embryos, whereas those
with either no additional sequence or containing the 497nucleotide (nt) proximal portion (Eg2-497) are not (see Fig.
1A for the relative positions of Eg2-410 and Eg2-497). Furthermore, two factors (p53 and p55) that specifically associate
with the distal half of the Eg2 3' UTR and also with the 3'
UTRs of other Eg mRNAs were identified (16). These observations are in favor of the hypothesis that Eg mRNAs are
targeted for deadenylation in the embryo by specific cis-acting
elements possibly recognized by the p53/p55 Eg-specific factors. We reasoned, therefore, that localizing the sequence
*
Corresponding author. Phone: (33) 99 28 61 15. Fax: (33) 99 28 16
49.
t Present address: Laboratory of Molecular Embryology, National
Institute of Child Health and Human Development, Bethesda, MD
20892.
1893
1894
MOL. CELL. BIOL.
BOUVET ET AL.
motifs with which the p53/p55 Eg-specific factors associate may
concomitantly allow us to demonstrate the presence of cisacting elements that target a maternal mRNA to be deadenylated after fertilization.
MATERUILS AND METHODS
cDNA sequencing and plasmid constructions. The Eg2
cDNA (25), corresponding to the last 239 nt of the coding
region and the complete 3' UTR, was sequenced on both
strands by the dideoxy chain termination method. The cDNA
used to construct the Eg2-410-containing templates and derivatives thereof had a BamHI linker inserted 3' to the Klenow
enzyme-treated HindlIl site situated immediately 3' to the
nuclear polyadenylation signal (16). The Eg2-410, Eg2-497,
and 3' ODC clones have been previously described (16). The
Eg2-410a (StuI-BstNI) fragment was cloned into the EcoRV
site of Bluescript KS phagemid (Stratagene) after Klenow
enzyme treatment. The Eg2-410b (BstNI-HindIII linker) fragment of Eg2-410 cDNA was cloned into the EcoRV site of
Bluescript KS phagemid after Klenow enzyme treatment. All
constructions destined for making in vitro transcripts for
injection into embryos were made in a Bluescribe (Stratagene)based vector, BSDP1400H-A65, that contains the 19-nt DraIBamHI (linker) fragment of Eg2 cDNA (this fragment contains the nuclear polyadenylation signal) immediately followed
by the 3' SspI-HindIII fragment of a cdk2-Egl cDNA terminating with 65 adenosine residues. This polyadenylation signalBamHI-A65 insert is preceded by the XbaI site of the Bluescribe vector and followed by EcoRI, EcoRV, and HindlIl
sites, in that order. The Bluescribe T3 promoter is immediately
3' to the Hindlll site.
The GbEg2-497 chimeric gene was constructed by first
cloning the Klenow enzyme-treated EcoRI-XhoI fragment of
Eg2-497 into BstEII-SalI-digested and Klenow-treated plasmid
pSP64T (12). This placed the Eg2-497 fragment 3' to the
,B-globin 5' UTR and eliminated the 3-globin 3' UTR present
in plasmid pSP64T. After the orientation of the inserted
Eg2-497 fragment was verified, the Hindlll (blunt-ended)XbaI fragment was isolated from this intermediate construction and cloned between the SmaI and XbaI sites of the
BSDPI400H - A65 vector. The GbEg2-410 chimeric genes had
the same general structure except that the BamHI-BamHI
fragment of the Eg2-410 cDNA in the Bluescript vector was
inserted between the BglII site from pSP64T, which is just 3'
to the ,-globin 5' UTR, and the BamHI site in
BSDP1400H-A65. All constructions were confirmed by sequencing from both the 5' T7 and 3' T3 promoters.
Mutagenesis. Oligonucleotide-directed mutagenesis was
performed by the method of Kunkel (14). The oligonucleotides
used to produce the indicated deletion mutants were Al
(5'ggacatacgaaattaatacagaatattgtacggtgacagc3'), LA2 (5'cttagaa
cagattttttgcctttttaaaaatgtatttacattcgttc3'), A3 (5'cagaagaagaaaa
aaaaaaaaaagggtgttacatataaaagg3'), A2-1 (5'ggacatacgaaattatg
tatttacattcgttc3'), A2-2 (5'gttacatataaaaggacaatacagaatatgtattt
ac3'), A2-3 (5'gcctttttaaaaagtgttacatatacgaaattaatacag3'), A2-4
(5 'cagattttttgcctttttaaaaataaaaggacatacg3'), A2-3A (5'ttacat
ataaaaggtacgaaattaatacag3'), and A2-4C (5'cagattttttgccttttta
aaaattacatataaaagg3').
The U-to-G substitution in the nuclear polyadenylation
signal was produced with the oligonucleotide M660 U/G
(5'tccgagctttcttttaaaacatttaaac3'). All mutations were verified
by restriction analysis and confirmed by sequencing.
Biological methods. Mature oocytes were obtained and
fertilized by standard procedures and incubated in Fl solution
(24). Embryo extracts were prepared essentially as described
by Murray and Kirschner (21), and two-cell embryos were
injected with 20 nl of in vitro transcripts (0.5 to 1 fmol) as
described by Legagneux et al. (16).
Analytical methods. In vitro transcripts, capped or uncapped, were made by using the Promega kit as previously
described (16). Poly(A)- and poly(A)+ RNAs for injection
into embryos were made by linearizing the same constructions
with BamHI and EcoRV, respectively, and transcribing from
the T7 promoter of the Bluescribe-based vector. RNA was
extracted from injected embryos (8) and analyzed by electrophoresis on 4% polyacrylamide-urea gels and autoradiography. The analysis of proteins cross-linked by UV irradiation to
2P-labelled transcripts was performed as previously described
(16).
Nucleotide sequence accession number. The EMBL/GenBank accession number of the Eg2 cDNA sequence is Z24453.
RESULTS
Localization of the p53/p55 binding sites in the Eg2 3' UTR.
Cross-linking experiments were performed with in vitro transcripts of the Eg2 distal portion (Eg2-410) that confers postfertilization deadenylation (16), from which various parts had
been deleted. Initially, the cross-linking pattern obtained with
the whole 410-nt region was compared with that obtained with
the first or second half of this region (Fig. IA). The data in Fig.
1B reconfirm our previous observations, namely, that the
Eg2-410 transcript associates with four major factors, p35, p40,
p53/p55, and p60 (lane 7); the 3' UTR of ODC mRNA, which
remains adenylated in the embryo, associates with the p35 and
p40 factors but not with the Eg-specific p53/p55 factors (lane
1), and none of these factors associated with the proximal 497
nt of the Eg2 3' UTR (Eg2-497; lanes 4 to 6). The specificity of
the p53/p55 factors for the Eg2 transcript is illustrated by the
use of nonradiolabelled RNAs as competitors. In the presence
of excess Eg2-410 transcript (homologous competitor; lane 8),
no cross-linking of the p53/p55 factors to the 32P-labelled
Eg2-410 RNA was observed, and that of the p35 and p40
factors was markedly decreased. When the 3' UTR of ODC
mRNA was used as a competitor (lane 9), only the signals for
the p35 and p40 factors were decreased. As expected, competition with either the ODC (lane 2) or Eg2-410 (lane 3) RNA
decreased the signal for both p35 and p40 association with the
3' UTR of ODC mRNA.
Deleting the first 200 nt from the Eg2-410 transcript,
yielding transcript Eg2-410b, did not change the cross-linking
pattern (Fig. IB, lanes 10 to 12) or the competition hierarchy,
showing that these factors all associate with sequence motifs
situated within the last 200 nt of the 3' UTR of Eg2 mRNA.
This was confirmed by directly comparing the cross-linking
patterns obtained with the 32P-labelled transcripts corresponding to the full-length Eg2-410 RNA, the first 200 nt (Eg2-410a),
and the last 200 nt (Eg2-410b) (Fig. IB, lanes 13 to 15). Again,
all factors that associated with the full-length 410-nt transcript
also bound to the distal 200-nt portion (Eg2-410b). The
p53/p55, p40, and p35 factors did not bind to the proximal
200-nt portion (Eg2-410a), whereas a small signal in the region
of p60 was observed with this transcript.
The binding sites for these factors were further delimited by
synthesizing several in vitro transcripts that were shortened to
different extents from the 3' end of the Eg2-410b portion. This
was achieved by synthesizing RNAs from plasmids linearized
with the restriction enzymes DraI, DdeI, and RsaI (Fig. 2A).
The 3'-shortened 32P-labelled transcripts synthesized from
these templates were then used in cross-linking experiments,
VOL. 14, 1994
SPECIFIC DEADENYLATION IN XENOPUS OOCYTES
1895
A
Stop
E
Eg2 3'UTR
Hx Ba
_
-239
658 66E
257
E
Stop
S
-239
I
257
Eg2-497
BS
S
Eg2-410
R
Dd
D
Hx Bo
I
257
460
499 517
588
658
668
Eg2-41 Oa
Eg2-410b
B
32 P RNA
ODC
cmp.oi
8
p60
E92-4197
E92-410
t
IF
us
o
o 8
00
.
P RNA
Eg2-410b
0
..
-
**-v
pS3-pB
p.5-
4
a
p35 -
id4
%*
p10
1
2
3
7
4
6
7
9
8
9
1
*1
10
11
12
1
13
14
15
and the patterns obtained were compared with that from the
full-length Eg2-410b RNA (plasmid linearized at the BamHI
site) (Fig. 2B).
Linearizing with DraI produced a 3'-truncated transcript in
which the Eg2-410b sequence was shortened by 80 nt. No
signal for the p35 factors was observed with this transcript,
indicating that sequence information within the last 80 nt of
the Eg2-410b region is required for the binding of p35 to the
RNA (Fig. 2B, lane 2). The signals for the p40 and p60 factors
were also greatly reduced, but those for the p53/p55 factors
were not noticeably affected. Removing a further 69 nt from
the 3' end of the Eg2-410b transcript by linearizing with DdeI
caused the cross-linking signal from the p53/p55 factors to
almost completely disappear (lane 3). Therefore, association of
the p53/p55 factors with the Eg2-410b transcript requires
sequence
cDNA.
information between the DdeI and DraI sites in the
FIG. 1. Eg-specific RNA-binding factors associate with the distal
200 nt of the Eg2 3' UTR. (A) Diagram showing the positions of the
different portions of the Eg2 3' cDNA clone included in the 32p_
labelled in vitro transcripts used for UV cross-linking. The numbering
of the Eg2 3' UTR is relative to the first base of the stop codon. Hx
indicates the nuclear polyadenylation signal (AAUAAA). Restriction
sites: E, EcoRI; S, StuI; Bs, BstNI; R, RsaI; Dd, DdeI; D, DraI; Ba,
BamHI. The EcoRI site corresponds to the 5' end of the cDNA clone
and is a site endogenous to the full-length cDNA. The BamHI site is
a linker sequence introduced immediately 3' to the polyadenylation
signal (see Materials and Methods). (B) Analysis of protein crosslinking to different portions of the 3' UTRs of Eg2 and ODC mRNAs.
32P-labelled transcripts corresponding to the 3' UTR of ODC mRNA
(lanes 1 to 3) and the EcoRI-StuI fragment (Eg2-497; lanes 4 to 6),
StuI-BamHI fragment (Eg2-410; lanes 7 to 9 and 13); StuI-BstNI
(Eg2-410a; lane 14), and BstNI-BamHI fragment (Eg2-410b; lanes 10
to 12 and 15) of Eg2 mRNA were incubated in extracts made from 4-h
Xenopus embryos, irradiated with UV light, and digested with RNase
A. The proteins rendered radioactive by cross-linking to the labelled
transcripts were analyzed by electrophoresis on a 10% polyacrylamide
gel in the presence of sodium dodecyl sulfate. The positions of the
major cross-linked proteins are indicated on the left. Where indicated,
10-fold molar excesses of unlabelled transcripts (competitors) of the
indicated sequences were mixed with the radiolabelled transcripts.
Deletions within the Eg2 3' UTR eliminates p53/p55 binding
and reverses the adenylation behavior of chimeric mRNAs in
embryos. To confirm the localization of the p53/p55 binding
sites achieved with the 3'-shortened Eg2-410b RNAs and to
produce transcripts whose adenylation-deadenylation behavior
could be tested, we made a series of deletion mutants which
covered the region between the DdeI and Dral restriction sites
in the cDNA and the adjoining flanking regions. The positions
of these deletions relative to the restriction sites used in the
experiment described above are depicted in Fig. 3A. Deletions
A1 and A2, together, span all but 5 nt of the region of the
cDNA delimited by the DdeI and DraI sites. The A3 mutant, in
contrast, is a deletion extending 30 nt 3' to the Dral site and
was included to serve as a control deletion outside the expected region required for the association of the p53/p55
factors. To produce transcripts that could be analyzed with
respect to both the UV-cross-linked proteins and the adenyla-
1896
MOL. CELL. BIOL.
BOUVET ET AL.
.......
..
B
na
Restrlctlon sltes
60-
-eAf
p53-PSS p40-40- i At
-A.
p35-
1
2 3 4
FIG. 2. Localization of p53/p55 binding site, using 3'-shortened in
vitro transcripts. The plasmid containing the Eg2-410b sequence was
linearized with the restriction enzymes indicated, and 32P-labelled
RNAs were generated by in vitro transcription from the T7 promoter.
These radiolabelled transcripts were incubated in Xenopus embryo
extracts, and the factors cross-linked by UV irradiation were analyzed
as described in the legend to Fig. 1.
tion-deadenylation behavior, the Eg2-410 unmutated (wildtype [wt]) cDNA fragment and the cDNA fragments of the
Eg2-410 Al to A3 mutants were cloned between the 5' UTR of
Xenopus 3-globin and a 65-adenosine poly(A) tail. Poly(A)+
transcripts were synthesized by linearizing the plasmids at the
EcoRV site 3' to the poly(A) tract. The unique BamHI site
between the cloned 3' UTR and the cloned poly(A) tail
allowed the synthesis of poly(A) - transcripts from the same
plasmid construction.
The UV-cross-linking patterns obtained with the 32P-labelled poly(A)+ transcripts synthesized from these deletion
mutants compared with that of the unmutated sequence are
shown in Fig. 3B. The pattern of proteins cross-linked to the
RNA containing the Eg2-410 wt sequence was not affected by
the presence of either the globin 5' UTR in the transcript
(compare data in Fig. 1B and 3B) or a poly(A) tail (data not
shown). As expected, the cross-linking pattern for the A3
mutant was the same as that for the wt sequence. The
cross-linking pattern for the Al mutant was also almost
identical to that of the wt sequence. For the A2 deletion
mutant, however, the signals for the p53/p55 factors were
absent, showing that the 40 nt removed in this mutant were
required for the association of the p53/p55 factors with the 3'
UTR of Eg2 mRNA. Interestingly, the cross-linking signal for
p60 was almost completely eliminated and those for p40 and
p35 were reduced. This has been systematically observed and is
not due to a loss of 32P-labelled RNA in this sample. This
observation suggests that the A2 region may contain sequence
information involved in the binding of these factors.
The effects of deletions Al to A3 on RNA deadenylation
were determined by injecting the different RNAs as 32p_
labelled poly(A)+ transcripts into two-cell embryos. As a
control, similarly labelled transcripts in which the Eg2-410
sequence was replaced by the proximal Eg2-497 sequence were
coinjected. We have previously shown (16) that this proximal
portion of the Eg2 3' UTR (Eg2-497) does not confer a
postfertilization deadenylation on hybrid transcripts. Electrophoretic analysis on acrylamide-urea gels of the RNA extracted from these various samples (Fig. 3C) showed that
within 90 min of their injection into two-cell embryos, the
transcripts containing the Eg-410 wt sequence underwent a
shortening to a discrete size. We have previously shown that
this shortening is due to a deadenylation of these transcripts
(16). The transcripts containing the Eg2-497 sequence did not
change in size, confirming our previous observations that RNA
containing this sequence was not deadenylated in the early
embryo. The GbEg2-410-Al(A)+ and GbEg2-410-A3(A)+
transcripts, like the GbEg2-410(A)+ RNA, were deadenylated
after injection into the embryo. The rate of this deadenylation
appeared to be similar if not identical with that of the
unmutated RNA. On the contrary, when the GbEg2-410A2(A)+ transcripts were injected into two-cell embryos, they
were not deadenylated during the 3-h period studied. Therefore, the portion of sequence that was deleted in making the
GbEg2-410-A2 mutant contains information necessary for the
postfertilization deadenylation of these transcripts.
The Eg2-410-containing mRNAs were also injected as
poly(A) - transcripts into the two-cell embryo (Fig. 3D). The
poly(A) - transcripts containing either the unmutated Eg2-410
or the GbEg2-410-A1 and GbEg2-410-A3 RNAs were not
adenylated after injection into the embryo. However, the
poly(A) - GbEg2-410-A2 transcripts increased in size, indicating that these RNAs were adenylated in the embryo. In these
experiments, the Eg2-410-derived transcripts were coinjected
with the poly(A) - GbEg2-497. Although the latter RNA
contains the nuclear polyadenylation signal (AAUAAA),
which was engineered into the chimeric gene during its construction, it is not adenylated in embryos, indicating that this
RNA does not contain a functional CPE. Therefore, sequence
information in the 40-nt stretch deleted in the A2 mutation is
required for the postfertilization deadenylation of these transcripts; furthermore, deleting this sequence from the Eg2-410
region causes a reversal of the postfertilization adenylation
behavior of this transcript.
In several of the experiments shown in Fig. 3C and D, the
amount of 32P-labelled RNA recovered from the embryos was
significantly less than the amount injected. However in these
experiments, and in others described elsewhere in this report,
this behavior was neither sequence nor poly(A) dependent.
Therefore, this effect is probably due to a variability in the
efficiency of RNA extraction from the embryos.
The cis-acting deadenylation element in the Eg2 3' UTR is
contained within a 17-nt fragment and does not require an
AAUAAA nuclear polyadenylation signal. The 40 nt of sequence deleted in mutant A2 were scanned by four additional
deletion mutants, A2-1 to A2-4. Each of these second-generation mutants removed 10 nt from the transcript (Fig. 4A).
Hybrid transcripts of the same general structure as those
described above were made, and the changes in the postfertilization deadenylation-adenylation behavior caused by these
deletions were analyzed.
The data in Fig. 4B show that neither the A2-1 nor the A2-2
mutation affected the postfertilization deadenylation of the
GbEg2-410 transcript. However, A2-3 and A2-4 mutations
inhibited the deadenylation of these RNAs. When these
transcripts were injected as poly(A) - RNAs, a perfect reciprocal behavior was again observed (Fig. 4B). Mutants A2-1 and
A2-2, like the Eg2-410 wt-containing RNA, remained
poly(A) -, whereas mutants A2-3 and A2-4 became adenylated.
The cross-linking pattern of the proteins associated with these
transcripts (Fig. 4C) confirmed the aforementioned correlation
SPECIFIC DEADENYLATION IN XENOPUS OOCYTES
VOL. 14, 1994
1897
A
Deleted
Name of transcript
nucleotides
{3s
R
Dd
D
HX a
588
658 668
Gb_
GbEg2-410
EV
6
499 517
460
257
D
GbEg2-410A1
EGb
504- 543
GbEg2-410A2
I Gb
544- 583
GbEg2-410A3
_Gb
584- 618
C
B
dc
wI
AlI
A2
A3
0)
c - p*
GbEg2-497-A
*w
_
a
GbE92-410-At
p60 p53-pM5
a.
-
D
p40-
p*
GbEg2-497-A
GbEg2-410-A7
p35-
a
*
X
*
PI
+,,
#I
0
FIG. 3. Effects of internal deletions on p53/p55 binding, deadenylation, and polyadenylation in Xenopus embryos. (A) Schematic diagram of the
chimeric transcript GbEg2-410 and the positions of deletions Al, A2, and A3. Names of the transcripts are indicated on the left, and the deleted
nucleotides are shown on the right. The Xenopus P-globin 5' UTR and the poly(A) track are indicated by the boxed Gb and A65, respectively.
Sequence numbering and abbreviations for restriction sites in the cDNA sequence are as indicated in the legend to Fig. 1, with the addition of EV
(EcoRV). (B) The 3AP-labelled transcripts containing either the unmutated Eg2-410 sequence (wt) or deletions Al, A2, and A3, depicted in panel
A, were incubated in Xenopus embryo extracts, and the radiolabelled proteins generated by UV irradiation were analyzed as described in the legend
to Fig. 1. The positions of the major cross-linked proteins are indicated on the left. (C and D) Analyses of the deadenylation/adenylation behavior
in Xenopus embryos of 32P-labelled transcripts containing either the Eg2-410 wt sequence, or deletions Al, A2, and A3, depicted in panel A, or
the proximal EcoRI-StuI fragment (GbEg2-497). Capped chimeric RNAs (0.5 to 1 fmol) were injected into two-cell embryos as either poly(A)+
transcripts (C) or poly(A) - transcripts (D). RNA was extracted from batches of five embryos just after injection (0) or after 90 or 180 min. Half
of each RNA sample was analyzed by electrophoresis on denaturing 4% polyacrylamide-urea gels, and the dried gels were subjected to
autoradiography.
of the postfertilization deadenylation and p53/p55 association.
Mutants A2-1 and A2-2 did not significantly change the pattern
of associated proteins relative to the Eg2-410 wt transcript.
However, the signal for the p53/p55 factors was markedly
reduced for mutant A2-4 and almost completely abolished for
mutant A2-3. Comparison of the data in Fig. 4C with those in
Fig. 3C and D shows that the effects of these 10-nt deletions on
p53/p55 binding were much more specific than the effect of the
A2 deletion of 40 nt.
Therefore, the postfertilization deadenylation and the correlated association of the p53/p55 Eg-specific factors requires
sequence information contained within the 10 nt removed
in the A2-3 mutation but possibly not all of that removed
in the A2-4 mutation. This was confirmed by removing (i)
only the first 3 nt of the A2-3 region (mutant A2-3A) and (ii)
the last 3 nt of the A2-4 region (mutant A2-4C). The data in
Fig. 5A show that removing the first 3 nt of the A2-3 region
considerably reduces the rate of the postfertilization deadeny-
lation of the GbEg2-410 transcript. The last 3 nt of the A2-4
region, however, are not required for this process. These
effects of the A2-3A and A2-4C deletions on the deadenylation
behavior of the injected transcripts were directly correlated
with the association of the p53/p55 factors (Fig. 5B). The
A&2-4C mutation did not affect the cross-linking pattern observed with the Eg2-410 wt sequence, whereas the A2-3A
mutation caused a significant decrease in the cross-linking of
these factors.
Lastly, we verified that the nuclear polyadenylation signal
was not required for the deadenylation of the GbEg2-410
RNA. The deadenylation of the GbEg2-410 M660 U/G RNA,
in which the AAUAAA motif is mutated to AAGAAA, was
indistinguishable from that of the unmutated transcript
(Fig. 5A). In addition, this mutation did not change the
cross-linking of the p53/p55 factors to the 32P-labelled transcript (Fig. SB).
1898
MOL. CELL. BIOL.
BOUVET ET AL.
A
Deleted
nucleotides
Name of transcript
Bs
R
Dd
A2
lGb.I.1
GbEg2-41 0
Hx Ba
588
658 668
EV
-
499
460
257
D
517
i.
GbEg2-410A2-1
E|i
GbEg2-41 0 A 2-2
/
554-563
//~~~~~/
GbEg2-4100 2-3
544-553
.01 N
1,mo
I
I
Gb
GbEg2-41 OA 2-4
574-583
B
1:
0
GbEg2-497-A
564-573
90 0 90 0
ea *
GbEg2-410-A+
4b@
*
V'
900
900
t*
*
*w
4.6
s
C
17
v
90
p40
*
'L,
P60
p53-p55-
F'
**
4
p35-
GbEg2-410A-A
v
FIG. 4. The cis-acting element required for targeted deadenylation and p53/p55 binding is contained within a 20-nt fragment. (A) Schematic
diagram of the chimeric transcript GbEg2-410 and the positions of deletions A2-1, A2-2, A2-3, and A2-4. The position of deletion A2 is indicated
above the GbEg2-410 transcript. Names of the transcripts are indicated on the left, and the deleted nucleotides are shown on the right. The
Xenopus 3-globin 5' UTR and the poly(A) track are indicated by the boxed Gb and A65, respectively. Sequence numbering and abbreviations for
restriction sites in the cDNA sequence are as indicated in the legend to Fig. 1, with the addition of Ev (EcoRV). (B) 32P-labelled capped chimeric
RNAs (0.5 to 1 fmol) containing either the Eg2-410 wt sequence or deletions A2-1, A2-2, A2-3, and A2-4, depicted in panel A, were injected into
two-cell embryos as either poly(A)+ transcripts (top) or poly(A)- transcripts (bottom). The GbEg2-497(A)+ RNA was coinjected with the
polyadenylated GbEg2-410-containing RNAs as a control. RNA was extracted from batches of five embryos just after injection (0) and after 90
min. Half of each RNA sample was analyzed by electrophoresis on denaturating 4% polyacrylamide-urea gels, and the dried gels were subjected
to autoradiography. (C) The 32P-labelled transcripts analyzed in panel B were incubated in Xenopus embryo extracts, and the radiolabelled proteins
generated by UV irradiation were analyzed as described in the legend to Fig. 1. The positions of the major cross-linked proteins are indicated on
the left.
DISCUSSION
Maternal mRNAs that are adenylated during oocyte maturation and deadenylated in embryos, such as the Eg mRNAs,
must possess some characteristic to distinguish them from the
maternal mRNAs that were also adenylated during oocyte
maturation but remain so in the embryo. The data presented
here show that the maternal mRNA Eg2 contains a cis-acting
element that is required for the deadenylation in embryos of
chimeric poly(A)+ transcripts containing the Xenopus ,B-globin
5' UTR and the last 410 nt of the Eg2 3' UTR (GbEg2-410).
This cis-acting deadenylation element is contained within a
17-nt portion corresponding to the 10 nt of the A2-3 deletion
(UGUCCUUUUA) and the first 7 nt of the A2-4 deletion
(UAUGUAA). When the GbEg2-410 chimeric RNAs were
injected as poly(A) - transcripts, they remained nonadenylated
except when the 17 nt containing the cis-acting deadenylation
element was disrupted. Hence, these transcripts contain a
CPE, outside the A2 region, that is functional in the embryo,
leading to the adenylation of the RNA in the absence of the
cis-acting deadenylation element.
Huarte et al. (9) previously identified an AU-rich region of
the tissue-type plasminogen activator mRNA that is required
for the deadenylation of this transcript in primary mouse
oocytes. This region of the mouse RNA contains several
repetitions of the motifs AUUUUAAU and AUUUUA. Neither of these motifs is present in the 17-nt portion of Eg2
mRNA containing the cis-acting deadenylation element, although a closely related motif, UUUUAU, is present. The
SPECIFIC DEADENYLATION IN XENOPUS OOCYTES
VOL. 14, 1994
A
Tr
0 90
GbEg2-497-A
* *
GbEg2-410-A+
*
Cs
C,\
.I_r 0
t' .¢ 8 4~
~'
B
"I,% A
090
0 90
p- *
p53-p55
-
&
I
..
0.
£
p
X
^*
FIG. 5. The cis-acting deadenylation element iin the Eg2 3' UTR
can be limited to 17 nt and does not require an A. AUAAA motif. (A)
32P-labelled capped chimeric RNAs (0.5 to 1 fnnol) containing the
Eg2-410 sequence from which the first 3 nt of the rn ,gion defined by the
A2-3 deletion had been removed (A2-3A), the las 3 nt of the region
defined by the A2-4 deletion (A2-4C), or a U-to
AAUAAA nuclear polyadenylation signal (M660 U/G) were injected
into two-cell embryos as poly(A)+ transcripts. T1 he GbEg2-497(A)+
RNA was coinjected with the polyadenylated Eg2-410-containing
RNAs as a control. RNA was extracted from batc hes of five embryos
just after injection (0) and after 90 min. Half of eac:h RNA sample was
analyzed as described in the legend to Fig. 3. (1 3) The 32P-labelled
transcripts analyzed in panel A were incubated iin Xenopus embryo
extracts, and the radiolabelled proteins generated by UV irradiation
were analyzed as described in the legend to Fig. 1. 'The positions of the
major cross-linked proteins are indicated on the h(
Gt
eft*
cis-acting deadenylation element in Eg2 mR NA cannot, however, be simply reduced to this U-rich m4otif. Deletion of
nucleotides UGU, two bases 5' to the UJUUUAU motif,
negatively affected deadenylation. In addiltion, this U-rich
motif is present in mRNAs that are not deaidenylated. Comparison of the sequences of the 3' UTRs of several other Eg
mRNAs did not identify the 17-nt region ofF the Eg2 mRNA
that contains the cis-acting deadenylation ele ment as a strictly
conserved sequence motif. Therefore, the definition of a
consensus sequence for this element must a,wait the localization of the cis-acting deadenylation elemr ent in other Eg
mRNAs.
The deletions both 5' and 3' to the regic n containing the
Eg2 deadenylation motif show that in the chimeric RNAs
made with the Eg2-410 portion of the mat(ernal mRNA, no
additional unique sequence element in the vicuinity of this motif
is required for the reversal of their adenyL ation behavior in
embryos. Functionally, however, this moti f appears to be
sensitive to context in as much as the simple i]nsertion of the 17
nt containing the deadenylation motif into the 3' UTR of
Gb-ODC chimeric RNA does not lead to the deadenylation of
this RNA in embryos (unpublished data). D)espite this as yet
undefined context effect, the data presented here show that a
cis-acting element is required for the rapid deadenylation of
RNAs in Xenopus embryos.
The binding of the two Eg-specific factors, p53 and p55, to
the different mutant transcripts was directly c()rrelated with the
rate of deadenylation of these RNAs. This fin4ding supports our
original hypothesis that p53 and p55 ma)y be trans-acting
factors involved in transcript-specific deaderiylation. Purification of these two factors is being undertaken as a first step in
determining the functions of these two RNA--binding proteins.
During oocyte maturation, a CPE can be kept functionally
silent by the presence in the RNA of a mask;ing element (27).
This would make the RNA a substrate for tthe default deadenylation process. Therefore, the cis-acting dleadenylation element in Eg2 mRNA could operate in th[e embryo in an
1899
analogous manner by masking the CPE or inhibiting its
function. This mRNA, then devoid of a functional CPE, could
be deadenylated via a default process similar to that shown to
function during oocyte maturation (6, 29). Deadenylation by a
default process does occur in Xenopus embryos. The GbEg2497 chimeric RNA, when injected as a poly(A) - transcript, is
not adenylated either in embryos (Fig. 3C and D) or during
oocyte maturation (unpublished data), indicating that it does
not possess a functional CPE. When this same RNA is injected
as a poly(A)+ transcript into embryos, it undergoes a slow
deadenylation indicated by a slight downward smearing on the
autoradiograms, which is especially evident with long incubation times (unpublished data). In embryos, however, this
default deadenylation is much slower than that which operates
on chimeric mRNAs containing the Eg2 cis-acting deadenylation element, and alone, it could not account for the almost
complete deadenylation of these RNAs in less than 3 h after
their injection into two-cell embryos. Therefore, the cis-acting
deadenylation element might also act autonomously. This
would be similar to the push-pull type of mechanism previously
proposed by Wickens (33) for the control of poly(A) tail length
during Xenopus oocyte maturation, in which elongation was
controlled by the CPE whereas deadenylation was the default
process.
The results presented here indicate that in the context of
such
a
a
model, deadenylation in embryos
can
be stimulated by
cis-acting element. A refinement of the push-pull model that
takes into account the presence of the two regulatory elements
can therefore be proposed. Two types of CPE motifs have been
identified in Xenopus mRNAs (5, 18, 27). At least for one of
these, dodecauridine, the rate of polyadenylation is modulated
by the distance between the CPE and the AAUAAA polyadenylation signal (27). The cis-acting deadenylation element,
although not dependent on a polyadenylation signal, also
appears to be sensitive to context within the RNA, and, as for
the CPEs, more than one sequence motif may exist in Xenopus
mRNAs. Therefore, the sequence type of the CPE and/or the
deadenylation element and their contexts within the 3' UTR
could be the parameters that define either the efficiency of the
functional interaction between these two motifs or their autonomous activities. This would potentially allow a modulation
of the changes in poly(A) tail length between a rapid deadenylation to just a slowing of the rate of polyadenylation.
ACKNOWLEDGMENTS
We thank the members of the Departement de Biologie et Genetique du Developpement for constructive discussions and Chris Ford
for his comments on the manuscript.
This work was supported by grants from the Institut National de la
Sante et de la Recherche Medicale (CRE 91-0112), European Economic Community (SCI*-CT91-0677), Association pour la Recherche
sur le Cancer, and Fondation pour la Recherche Medicale. P.B. was
supported in part by grant from the Ligue Departementale-Cotes
d'Armor-de Lutte contre le Cancer. V.L. is a staff member of the
Institut National de la Sante et de la Recherche Medicale.
REFERENCES
1. Bachvarova, R. F. 1992. A maternal tail of poly(A): the long and
the short of it. Cell 69:895-897.
2. Brewer, G., and J. Ross. 1988. Poly(A) shortening and degradation
of the 3' A+U-rich sequences of human c-myc mRNA in a
cell-free system. Mol. Cell. Biol. 8:1697-1708.
3. Duval, C., P. Bouvet, F. Omilli, C. Roghi, C. Dorel, R. LeGuellec,
J. Paris, and H. B. Osborne. 1990. Stability of maternal mRNA in
Xenopus embryos: role of transcription and translation. Mol. Cell.
Biol. 10:4123-4129.
4. Dworkin, M. B., A. Shrutkowski, and E. Dworkin-Rastl. 1985.
1900
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
MOL. CELL. BIOL.
BOUVET ET AL.
Mobilization of specific maternal RNA species into polysomes
after fertilization in Xenopus laevis. Proc. Natl. Acad. Sci. USA
82:7636-7640.
Fox, C. A., M. D. Sheets, and M. Wickens. 1989. Poly(A) addition
during maturation of frog oocytes: distinct nuclear and cytoplasmic activities and regulation by the sequence UUUUUAU. Genes
Dev. 3:2151-2162.
Fox, C. A., and M. Wickens. 1990. Poly(A) removal during oocyte
maturation: a default reaction selectively prevented by specific
sequences in the 3' UTR of certain maternal mRNAs. Genes Dev.
4:2287-2298.
Galili, G., E. E. Kawata, L. D. Smith, and B. A. Larkins. 1988.
Role of the 3'-poly(A) sequence in translational regulation of
mRNAs in Xenopus laevis oocytes. J. Biol. Chem. 263:5764-5770.
Harland, R., and L. Misher. 1988. Stability of RNA in developing
Xenopus embryos and identification of a destabilization sequence
in TFIIA messenger RNA. Development 102:837-852.
Huarte, J., A. Stutz, M. L. O'Connell, P. Gubler, D. Belin, A. L.
Darrow, S. Strickland, and J.-D. Vassalli. 1992. Transient translational silencing by reversible mRNA deadenylation. Cell 69:
1021-1030.
Hyman, L. E., and W. M. Wormington. 1988. Translational
inactivation of ribosomal protein mRNAs during Xenopus oocyte
maturation. Genes Dev. 2:598-605.
Jackson, R. J., and N. Standart. 1990. Do the poly(A) tail and 3'
untranslated region control mRNA translation. Cell 62:15-24.
Krieg, P. A., and D. A. Melton. 1984. Functional messenger RNAs
are produced by SP6 in vitro transcription of cloned cDNAs.
Nucleic Acids Res. 12:7057-7070.
Kuge, H., and A. Inoue. 1992. Maturation of Xenopus laevis oocyte
by progesterone requires poly(A) tail elongation of mRNA. Exp.
Cell Res. 202:52-58.
Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis
without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488492.
Laird-Offringa, I. A., C. L. De Wit, P. Elfferich, and A. J. van der
Eb. 1990. Poly(A) tail shortening is the translation-dependent step
in c-myc mRNA degradation. Mol. Cell. Biol. 10:6132-6140.
Legagneux, V., P. Bouvet, F. Omilli, S. Chevalier, and H. B.
Osborne. 1992. Identification of RNA-binding proteins specific to
Xenopus Eg maternal mRNAs: association with the portion of Eg2
mRNA that promotes deadenylation in embryos. Development
116:1193-1202.
LeGuellec, R., J. Paris, A. Couturier, C. Roghi, and M. Philippe.
1991. Cloning by differential screening of a Xenopus cDNA that
encodes a kinesin-related protein. Mol. Cell. Biol. 11:3395-3398.
McGrew, L. L., E. Dworkin-Rastl, M. B. Dworkin, and J. D.
Richter. 1989. Poly(A) elongation during Xenopus oocyte maturation is required for translational recruitment and is mediated by a
short sequence element. Genes Dev. 3:803-815.
McGrew, L. L., and J. D. Richter. 1990. Translational control by
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
cytoplasmic polyadenylation during Xenopus oocyte maturation:
characterization of cis and trans elements and regulation by
cyclin/MPF. EMBO J. 9:3743-3751.
Munroe, D., and A. Jacobson. 1990. Tales of poly(A): a review.
Gene 91:151-158.
Murray, A. W., and M. W. Kirschner. 1989. Cyclin synthesis drives
the early embryonic cell cycle. Nature (London) 339:275-280.
Osborne, H. B., C. Duval, L. Ghoda, F. Omilli, T. Bassez, and P.
Coffino. 1991. Expression and post-transcriptional regulation of
ornithine decarboxylase during early Xenopus development. Eur.
J. Biochem. 202:575-581.
Paris, J., R. LeGuellec, A. Couturier, K. LeGuellec, F. Omilli, J.
Camonis, S. MacNeil, and M. Philippe. 1991. Cloning by differential screening of a Xenopus cDNA coding for a protein highly
homologous to cdc2. Proc. Natl. Acad. Sci. USA 88:1039-1043.
Paris, J., H. B. Osborne, A. Couturier, R. LeGuellec, and M.
Philippe. 1988. Changes in the polyadenylation of specific stable
RNAs during the early development of Xenopus laevis. Gene
72:169-176.
Paris, J., and M. Philippe. 1990. Poly(A) metabolism and polysomal recruitment of maternal mRNAs during early Xenopus development. Dev. Biol. 140:221-224.
Peppel, K., and C. Baglioni. 1991. Deadenylation and turnover of
interferon-n mRNA. J. Biol. Chem. 266:6663-6666.
Simon, R., J.-P. Tassan, and J. D. Richter. 1992. Translational
control by poly(A) elongation during Xenopus development: differential repression and enhancement by a novel cytoplasmic
polyadenylation element. Genes Dev. 6:2580-2591.
Stoeckle, M. Y., and L. Guan. 1993. High-resolution analysis of
groo mRNA poly(A) shortening: regulation by interleukin-1,B.
Nucleic Acids Res. 21:1613-1617.
Varnum, S. M., and W. M. Wormington. 1990. Deadenylation of
maternal mRNAs during Xenopus oocyte maturation does not
require specific cis-sequences: a default mechanism for translational control. Genes Dev. 4:2278-2286.
Vassalli, J. D., J. Huarte, D. Belin, P. Gubler, A. Vassalli, M. L.
O'Connell, L. A. Parton, R. J. Rickles, and S. Strickland. 1989.
Regulated polyadenylation controls mRNA translation during
meiotic maturation of mouse oocytes. Genes Dev. 3:2163-2171.
Wahle, E. 1992. The end of the message: 3'-end processing leading
to polyadenylated messenger RNA. Bioessays 14:113-118.
Wharton, R. P., and G. Struhl. 1991. RNA regulatory elements
mediate control of Drosophila body pattern by the posterior
morphogen nanos. Cell 67:955-967.
Wickens, M. 1990. In the beginning is the end: regulation of
poly(A) addition and removal during early development. Trends
Biochem. Sci. 15:320-324.
Wilson, T., and R. Treisman. 1988. Removal of poly(A) and
consequent degradation of c-fos mRNA facilitated by 3' AU-rich
sequences. Nature (London) 336:396-399.