© by PSP Volume 23 – No 3a. 2014
Fresenius Environmental Bulletin
EFFECTS OF POTASSIUM PERMANGANATE,
POTASSIUM DICHROMATE AND POTASSIUM
PERCHLORATE ON MITOCHONDRIAL DNA: ANOTHER
POSSIBLE MECHANISM OF DICHROMATE TOXICITY
Ayse Gul Mutlu
Mehmet Akif Ersoy University, Department of Biology, Burdur, Turkey
ABSTRACT
Chromium (Cr) is a naturally occurring heavy metal.
It is widely used in industrial processes and as a result is a
common contaminant in many environmental systems.
Perchlorate (ClO -) is an anion commercially available as a
4
salt with many cations. The most common forms of perchlorate include ammonium perchlorate and potassium
perchlorate. Potassium permanganate (KMnO4) is used
worldwide in industrial processes and laboratory analysis
methods, as well as in freshwater pond aquaculture. In
this study, mtDNA damage and copy number in Drosophila in response to exposure to potassium permanganate,
potassium dichromate and potassium perchlorate was
examined. The results demonstrate that potassium dichromate exposure resulted in 22% more mtDNA damage than
that observed in the control group. There is evidence of
carcinogenic activity of dichromate in mice and rats. The
current study indicates that mtDNA damage may be a
possible mechanism of dichromate toxicity.
KEYWORDS:
Potassium permanganate, potassium dichromate, potassium
perchlorate, mtDNA copy number, mtDNA damage, toxicity
1. INTRODUCTION
Chromium (Cr) is a naturally occurring heavy metal
commonly found in the environment in two valence
states: trivalent Cr(III) and hexavalent Cr(VI). It is widely
used in industrial processes and as a result, is a contaminant of many environmental systems [1]. After entering
cells, Cr(VI) undergoes metabolic reduction to Cr(III),
resulting in the formation of ROS, which causes oxidative
tissue damage and a cascade of cellular events [2].
* Corresponding author
Perchlorate (ClO4-) is an anion commercially available as a salt with many cations. The most common forms
of perchlorate include ammonium perchlorate (used as a
solid rocket oxidant and ignitable source in munitions and
fireworks), and potassium perchlorate (used in road flares
and air bag inflation systems, and has been used to treat
Graves’ Disease) [3]. Perchlorate salts have shown organ
toxicity in rats in subchronic and chronic levels [4,5].
Potassium permanganate (KMnO4) is used worldwide in
freshwater pond aquaculture for the treatment and prevention
of waterborne parasitic, bacterial, and fungal diseases. Insufficient information exists, however, for the evaluation of the
environmental risk of KMnO4 exposure [6].
Mitochondrial DNA (mtDNA) damage is more extensive and persists longer than nuclear DNA (nDNA) damage in human cells following oxidative stress [7]. Some
toxic materials generate mtDNA damage [8-10], which
may trigger mitochondrial dysfunction [11]. Damage to
mtDNA could be potentially more important than deletions in nDNA, because the entire mitochondrial genome
codes for genes that are expressed, while nDNA contains
a large amount of non-transcribed sequences [12]. DNA
mutations generated by potassium permanganate, potassium dichromate and potassium perchlorate have been
investigated by some researchers but there is no information in the literature about the effects of these substances
on mtDNA. The aim of the current study is to examine the
effects of potassium permanganate, potassium dichromate
and potassium perchlorate exposure on mtDNA damage.
2. MATERIALS AND METHODS
Two-day-old, wild type (Oregon) Drosophila melanogaster were used. Drosophila (fruit flies) are useful model
organisms because of their small size and short generation
time, and are commonly used to facilitate experimental
laboratory research [13]. Flies were fed corn meal, which
contained water, corn flour, sugar, yeast, agar and propi-
920
© by PSP Volume 23 – No 3a. 2014
Fresenius Environmental Bulletin
onic acid as an antifungal agent. Flies were housed in glass
bottles and incubated at 24 ±1 °C for 48 hours (12-hour
day-night cycles). The treatments applied were: 0.01 g potassium perchlorate / 100 ml corn meal; 0.01g potassium
dichromate / 100 ml corn meal; and 0.01g potassium
permanganate / 100 ml corn meal.
Following the 48-hour application period, DNA isolation of the flies was conducted. Twelve flies were analyzed from each group. SIGMA G1N350 Genomic DNA
kits were used for total DNA isolation using the methods
indicated in the technical bulletin. Invitrogen (Molecular
Probes) Pico Green dsDNA quantitation dye and QUBIT
2.0 fluorometer were used for template DNA quantitation
and for the fluorometric analysis of PCR products. A
crucial step of the QPCR method is the concentration of
the DNA sample. The accuracy of the assay relies on initial
template quantity because all of the samples must have
exactly the same amount of DNA. The Pico Green dye has
not only proven to be an efficient method for template quantitation but also for PCR product analysis [14]. DMSO (in a
volume equivalen to 4% of total volume) was added to 5 ng
of template total DNA in each PCR tube. Thermostabil polymerase used was Thermo Phire hot start II DNA polymerase.
Primers for Drosophila mtDNA small fragment
(100 bp) were:
11426 5’- TAAGAAAATTCCGAGGGATTCA - 3’
11525 5’- GGTCGAGCTCCAATTCAAGTTA - 3’
Primers for large fragment (10629 bp) were:
1880
5’- ATGGTGGAGCTTCAGTTGATTT - 3’
12508 5’- CAACCTTTTTGTGATGCGATTA - 3’
[9,10,15]
For long fragment PCR amplification, DNA was denatured initially at 98°C for 1 minute; the material then
underwent 21 PCR cycles of 98°C for 10 seconds, 52°C
for 45 seconds, and 68°C for 5 minutes. Final extension
was allowed to proceed at 68°C for 5 minutes.
For small fragment PCR amplification, DNA was denatured initially at 98°C for 1 minute; the material then
underwent 21 PCR cycles of 98°C for 10 seconds, 55°C
for 45 seconds, and 72°C for 10 seconds. Final extension
was allowed to proceed at 72°C for 2 minutes.
The QPCR method was used to measure mtDNA damage. The lesion present in the DNA blocked the progression
of any thermostable polymerase on the template, so a decrease in DNA amplification was observed in damaged
templates. The QPCR method is highly sensitive to measurements of DNA damage and repair. mtDNA damage was
quantified by comparing the relative efficiency of amplification of long fragments of DNA and normalizing this to
gene copy numbers by the amplification of smaller fragments, which have a statistically negligible likelihood of
containing damaged bases [7, 14,1 6]. To calculate normalized amplification, the long QPCR values were divided by
the corresponding short QPCR results to account for potential copy number differences between samples (the mtDNA/
total DNA value may be different in the 5-ng template of
total DNA in each PCR tube). The copy number results do
not indicate damage.
Minitab Release 13.0 software was used for statistical
analysis. The results were analyzed using the Mann–
Whitney Test.
3. RESULTS AND DISCUSSION
mtDNA damage and mtDNA copy number of fruit
flies in response to the potassium permanganate, potassium dichromate and potassium perchlorate treatments are
shown in Table 1. mtDNA damage of the dichromate group
was significantly greater than that observed in the control
group (Figure 1 and Table 1). In the permanganate and
perchlorate groups, mtDNA damage was slightly greater
than damage in the control group, but the difference was
not statistically significant. There were no significant
differences in mtDNA copy number among the groups.
Potassium dichromate is widely used in industrial
processes and as a result is present as a contaminant in
many environmental systems [1]. There is clear evidence
of carcinogenic activity of sodium dichromate in mice and
rats [17]. There is some evidence of dichromate toxicity
on DNA but there are no data on the effects of dichromate
on mtDNA specifically. Patlolla et al. [2] demonstrated
that potassium dichromate induced genotoxicity in Hepatoma G2 cells. According to the authors, this cytotoxicity
seems to be mediated by oxidative stress. DNA damage
induced by potassium dichromates, which are strong oxi-
TABLE 1 - mtDNA damage (as indicated by relative amplification) and mtDNA copy number of Drosophila in treatment groups
Groups
Control
Potassium Perchlorate
Potassium Dichromate
Potassium Permanganate
mtDNA damage
(relative amplification±SE)
1.035±0.098
0.989±0.105
a
0.804±0.044
0.951±0.087
a
values statistically different from control group (p<0.05)
SE: standard error of the mean
921
mtDNA copy number
(small fragment amplification ±SE)
410.86±19.48
409.78±12.96
409±12.76
405.72±18.53
© by PSP Volume 23 – No 3a. 2014
Fresenius Environmental Bulletin
In the current study, mtDNA damage observed in the
dichromate application group was significantly higher than
that of the control group. These results indicate that mtDNA
damage may be a possible mechanism of dichromate toxicity. mtDNA damage may be caused by ROS mediated
mechanisms. After entering cells, Cr(VI) undergoes metabolic reduction to Cr(III), resulting in the formation of
ROS, causing oxidative tissue damage and a cascade of
cellular events [2].
FIGURE 1 - mtDNA damage of Drosophila in treatment groups as
measured by QPCR relative amplification results. A reduction in
relative amplification indicates the occurrence of DNA damage.
Insufficient information exists on the risk of lowdosage KMnO4 exposures in various organisms. KMnO4
is commonly used as an oxidizing agent [6] and it is used
worldwide in freshwater pond aquaculture for the treatment
and prevention of waterborne parasitic, bacterial, and fungal diseases. However, studies have demonstrated its toxic
effects on some aquatic organisms [6, 21-23]. In this study,
permanganate exposure caused mtDNA damage that was
greater than that observed in the control group, but the difference was not statistically significant. Similarly, potassium perchlorate did not result in significant damage of
mtDNA.
In summary, the results of this study demonstrate that
potassium dichromate leads to substantial mtDNA damage. Potassium dichromate caused 22% more damage than
the control group; there were no significant differences
among the other groups in terms of mtDNA damage or
copy number. It is remarkable that even over a short time
frame (48 hours) and a low-dose application (0.01g Potassium dichromate / 100 ml corn meal), potassium dichromate
is toxic to mtDNA. This study shows that mtDNA damage
may be a possible mechanism of dichromate toxicity.
The author has declared no conflict of interest.
REFERENCES
[1]
Cohen, M.D., Kargacin, B., Klein, C.B., Costa, M. (1993)
Mechanisms of chromium carcinogenicity and toxicity. Critical Reviews in Toxicology, 23, 255-281.
[2]
Patlolla, A.K., Barnes, C., Hackett, D., Tchounwou, P.B.
(2009) Potassium dichromate induced cytotoxicity genotoxicity and oxidative stres in human liver carcinoma (Hep G2)
cells. Int J Environ Res Public Health, 6, 643-653.
[3]
Clark, J.J. (2000) Toxicology of Perchlorate. Environ Sci
Res, 57, 15-29.
[4]
Siglin, J.C., Mattie, D.R., Dodd, D.E., Hildebrandts, P.K.,
Baker, W.H. (2000) A 90-day drinking water toxicity study
in rats of the environmental contaminant ammonium perchlorate. Toxicol Sci, 57, 61-74.
[5]
York, R.G., Brown, W.R., Girand, M.F., Dollarhide, J.S.
(2001) Oral (drinking water) developmental toxicity study of
ammonium perchlorate in New Zealand white rabbits. Intl J
Toxicol, 20, 199-205.
[6]
Hobbs, M.S., Grippo, R.S., Farris, J.L., Griffin, B.R., Harding, L.L. (2006) Comparative acute toxicity of potassium
permanganate to nontarget aquatic organisms. Environ Toxicol Chem, 25, 3046-3052.
FIGURE 2 - mtDNA copy number in treatment groups as indicated
by QPCR small fragment amplification results.
dizers, was demonstrated by some researchers using comet
assays [2, 18, 19]. Epidemiologic studies, supported by animal and in vitro data, suggest that Cr(VI) compounds are
carcinogenic; the IARC has classified Cr(VI) as a group I
carcinogen. Additionally, Cr(VI) compounds are genotoxic
and cause DNA damage in vitro. The application of sodium dichromate was found to cause a reduction in activity of some DNA repair enzymes [20]. Lee et al. [21] also
indicated dichromate-induced oxidative DNA damage. They
hypothesized that this is related to the reduced repair activity of the OGG1 protein.
922
© by PSP Volume 23 – No 3a. 2014
Fresenius Environmental Bulletin
[7]
Yakes, F.M., Van Houten, B. (1997) Mitochondrial DNA
damage is more extensive and persists longer than nuclear
DNA damage in human cells following oxidative stres. Proc
Natl Acad Sci USA, 94, 514-519.
[8]
Mutlu, A.G., Fiskin, K. (2009) Can Vitamin E and Selenium
Prevent Cigarette Smoke-Derived Oxidative mtDNA Damage? Turk J Biochem, 34, 167-172.
[9]
Mutlu, A.G. (2012 A) Measuring of DNA damage by Quantitative PCR. In: Hernandez-Rodriguez P and Gomez APR
(ed), Polymerase Chain Reaction. InTech, Rijeka, Croatia, p
283-292.
[23] Xu, X.R., Li, H.B., Wang, W.H., Gu, J.D. (2005)
Decolorization of dyes and textile wastewater by potassium
permanganate. Chemosphere, 59, 893-898.
[24] Tucker, C.S. (1987) Acute toxicity of potassium permanganate to channel catfish fingerlings. Aquaculture, 60, 93-98.
[10] Mutlu, A.G. (2012 B) Increase in Mitochondrial DNA Copy
Number in Response to Ochratoxin A and Methanol-Induced
Mitochondrial DNA Damage in Drosophila. Bull Environ
Contam Toxicol, 89, 1129-1132.
[11] Lesnefsky, E.J., Moghaddas, S., Tandler, B., Kerner, J., Hoppel, C.L. (2001) Mitochondrial dysfunction in cardiac disease: ischemia –reperfusion, aging and heart failure. J Mol
Cell Cardiol, 33, 1065-1089.
[12] Liang, F-Q., Godley, B.F. (2003) Oxidative stress induced
mtDNA damage in human retinal pigment epithelial cells: a
possible mechanism for RPE aging and ge-related macular
degeneration. Exp Eye Res, 76, 397-403.
[13] Hedges, S.B. (2002) The origin and evolution of model organisms. Nat Rev, 3, 838-849.
[14] Santos, J.H., Mandavilli, B.S., Van Houten, B. (2002) Measuring oxidative mtDNA damage and repair using QPCR. In:
Copeland WC (ed) Mitochondrial DNA Methods and Protocols. Humana Pres Inc, Totawa NJ, p 159-176.
[15] Mutlu, A.G. (2013) The effects of a wheat germ rich diet on
oxidative mtDNA damage, mtDNA copy number and antioxidant enzyme activities in aging Drosophila. ACTA
Biologica Hungarica, 64, 1-9.
[16] Venkatraman, A., Landar, A., Davis, A.J., Chamlee, L.,
Sandersoni, T., Kim, H., Page, G., Pompilius, M., Ballinger,
S., Darley-Usmar, V., Bailey, S.M. (2004) Modification of
the mitochondrial proteome in response to the stres of ethanol-dependent hepatoxicity. J Biol Chem, 279, 22092-22101.
[17] National Toxicology Program. (2008) Toxicology and carcinogenesis studies of sodium dichromate dihydrate (Cas No.
7789-12-0) in F344/N rats and B6C3F1 mice (drinking water
studies). Natl Toxicol Progr Tech Rep Ser, 456, 1-192.
[18] Blasiak, J., Kovalik, J. (2000) A comparison of the in vitro
genotoxicity of tri and hexavalent chromium. Mutat Res/ Gen
Tox and En Mutagen, 469, 135-145.
[19] Dana Devi, K., Rozati, R., Saleha Banu, B., Jamil, K.,
Grover, B. (2001) In vivo genotoxic effect of potassium dichromate in mice leukocytes using comet assay. Food
Chemic Toxicol, 39, 859-865.
[20] Hodges, N.J., Chipman, J.K. (2001) Down-regulation of the
DNA-repair endonuclease 8-oxo-guanine DNA glycosylase 1
(hOGG1) by sodium dichromate in cultured human A549
lung carcinoma cells. Carcinog, 23, 55-60.
[21] Lee, A.J., Hodges, N.J., Chipman, J.K. (2005) Interindividual
variability in response to sodium dichromate-induced oxidative DNA damage: role of the Ser326Cys polymorphism in the
DNA-repair protein of 8-oxo-7,8-dihydro-2'-deoxyguanosine
DNA glycosylase 1. Cancer Epidemiol Biomark Prev, 14,
497-505.
[22] Jamall, I.S., Brown, I. (2006) Oxidative remediation of diphenylamine in wastewater. Bull Environ Contam Toxicol,
76, 740-744.
923
Received: August 14, 2013
Accepted: October 01, 2013
CORRESPONDING AUTHOR
Ayse Gul Mutlu
Mehmet Akif Ersoy University
Department of Biology
Burdur
TURKEY
Phone: +905362625341;
Fax: +902482133099
E-mail: [email protected]
[email protected]
FEB/ Vol 23/ No 3a/ 2014 – pages 920 - 923