FEMS Microbiology Ecology, 91, 2015, fiv090
doi: 10.1093/femsec/fiv090
Advance Access Publication Date: 23 July 2015
Research Article
RESEARCH ARTICLE
Detection of the macrolide-lincosamide-streptogramin
B resistance gene erm(44) and a novel erm(44) variant
in staphylococci from aquatic environments
Sarah Wendlandt1,† , Stefanie Heß2,† , Jun Li3,† , Andrea T. Feßler1 ,
Yang Wang3 , Kristina Kadlec1 , Claudia Gallert4,∗ and Stefan Schwarz1
1
Institute of Farm Animal Genetics, Friedrich-Loeffler-Institut (FLI), 31535 Neustadt-Mariensee, Germany,
Institute of Biology for Engineers and Biotechnology of Wastewater Treatment, Karlsruhe Institute of
Technology KIT, 76131 Karlsruhe, Germany, 3 Beijing Key Laboratory of Detection Technology for
Animal-Derived Food Safety, College of Veterinary Medicine, China Agricultural University, 100083 Beijing,
China and 4 Department of Microbiology - Biotechnology, Faculty of Technology, University of Applied Science,
Hochschule Emden/Leer, D-26723 Emden, Germany
2
∗ Corresponding author: Department of Microbiology - Biotechnology, Faculty of Technology, University of Applied Science, Hochschule Emden/Leer
Constantiaplatz 4, D-26723 Emden, Germany. Tel: 04921/807-1586; Fax: 04921/807-1593; E-mail: [email protected]
†
These authors contributed equally to this study.
One sentence summary: The sequence and genetic context of erm(44) differs from that of the novel erm(44) variant, and erm(44) is present in strains
from different environments.
Editor: Kornelia Smalla
ABSTRACT
Resistance to macrolides, lincosamides and streptogramin B antibiotics (MLSB ) is not restricted to staphylococci from
clinical samples but can also be present in staphylococci from the aquatic environment. Two coagulase-negative
staphylococci—Staphylococcus xylosus and S. saprophyticus were obtained from sewage and receiving river water samples and
were investigated for the genetic basis of inducible MLSB resistance by whole-genome sequencing. Two rRNA methylases
encoded by erm(44) and a novel erm(44) variant were identified, which had only 84% amino acid identity. While fragments of
phage DNA were found in the vicinity of the erm(44) gene of S. xylosus, no relics of mobile genetic elements were detected in
the sequences flanking the erm(44) variant gene in the S. saprophyticus strain. The functionality of the erm genes was
confirmed by cloning and transformation experiments. Based on the obtained sequences, specific PCR assays for both erm
genes were developed and used to identify erm(44) in another 7 S. xylosus and 17 S. saprophyticus isolates from aquatic
environments.
Keywords: antimicrobial multiresistance; rRNA methylases; cross-resistance; water samples; erm genes
INTRODUCTION
Resistance to macrolides, lincosamides and streptogramin B antibiotics (MLSB ) is not restricted to clinical isolates of staphylococci but can also be observed in those from the aquatic
environment (Heß and Gallert 2014a). MLSB resistance is based
on the presence of one or more erythromycin ribosome methylase (erm) genes, whose products modify the bacterial target site in the 23S rRNA by adding one or two methyl
Received: 22 April 2015; Accepted: 20 July 2015
C FEMS 2015. All rights reserved. For permissions, please e-mail: [email protected]
1
2
FEMS Microbiology Ecology, 2015, Vol. 91, No. 8
groups to A2058 (Escherichia coli numbering; Hansen, Mauvais
and Douthwaite 1999) which apparently inhibit binding of
MLSB compounds to the ribosome (Weisblum 1995a; Wendlandt et al. 2013). In addition to 10 MLSB resistance genes
[erm(A), erm(B), erm(C), erm(F), erm(G), erm(Q), erm(T), erm(Y),
erm(33) and erm(43)] previously known to occur in staphylococci
(http://faculty.washington.edu/marilynr/ermweb4.pdf), another
two erm genes, erm(44) (Wipf, Schwendener and Perreten 2014)
and erm(45) (Wipf et al. 2015), have been detected recently.
Among these erm genes, erm(A), erm(B), erm(C) and erm(T) are
most frequently detected in staphylococci of human and animal
origin (Perreten et al. 2010; Monecke et al. 2013; Entorf et al. 2014).
The diversity of erm genes in the aquatic environment seems
to be broader (Heß and Gallert 2014a) than reported for clinical
staphylococci (Fiebelkorn et al. 2003; Gherardi et al. 2009;). Most
erm genes are located on mobile genetic elements which might
explain their wide dissemination. While the genes erm(A) and
erm(B) are most often located on transposons in the chromosomal DNA, the genes erm(C) and erm(T) are commonly located on
plasmids (Schwarz et al. 2011; Kadlec et al. 2012; Wendlandt et al.
2013). The erm(44) gene is associated with a prophage in Staphylococcus xylosus (Wipf, Schwendener and Perreten 2014), whereas
the erm(45) gene is located within a genomic island in S. fleurettii
(Wipf et al. 2015).
In previous studies on inducible and constitutive MLSB resistance in staphylococci from sewage and river water (Heß and
Gallert 2014a), several macrolide-resistant isolates, which did
not carry any of the known macrolide resistance genes, were
identified. To investigate the genetic basis of their macrolide resistance, two isolates with different phenotypes were sequenced
and analyzed for the presence of macrolide resistance genes.
MATERIALS AND METHODS
Bacterial isolates, species identification and
susceptibility testing
Chapman-Stone Agar containing 0.05 g L−1 sodium azide was
used for determination of staphylococcal cell count and isolation of 2259 Staphylococcus strains from 20 raw and 62 treated
sewage samples of the sewage treatment plants Eriskirch,
Ravensburg-Langwiese and Merklingen, the sewage overflow
basin Mariatal as well as from the receiving rivers Schussen
and Argen (40 samples from overall five sampling points upstream and downstream of treated sewage discharge points)
during May 2012 and July 2014 (Heß and Gallert 2014a). Among
these randomly selected isolates, 61 macrolide-resistant strains
did not harbor any of the 10 erm genes, known at the beginning of this study, and were analyzed. Two isolates were investigated in more detail: isolate L0-6 was obtained from the
river Schussen, a tributary of Lake Constance in Germany in
July 2012, whereas isolate A ER Ab-7 originated from the effluent of the sewage treatment plant in Eriskirch/Germany in August 2012. The isolates were identified at species level by their
R
physiological reactions on Micronaut-Staph-microtitre
plates
(MERLIN, Bornheim, Germany). Identification was confirmed by
the ID32 Staph system (bioMérieux, Nürtingen, Germany) and
16S rDNA sequencing (Weiss et al. 2013). For determination of
erythromycin and clindamycin MICs, Etest strips (bioMérieux,
Marcy-L’Etoile, France) were used according to manufacturer’s
R
instructions and Staphylococcus aureus ATCC
29213 served as
quality control strain. In addition, the two isolates were tested
for their susceptibility to 30 antimicrobial agents by broth microdilution using custom-made microtiter plates (MCS Diagnos-
tics, Swalmen, the Netherlands). Antimicrobial agents tested
and test ranges were the same as described previously (Monecke
et al. 2013). Performance and evaluation as well as D-tests for inducible clindamycin resistance followed the recommendations
given in the documents VET01-A4 and VET01-S2 of the Clinical
and Laboratory Standards Institute (CLSI) (2013a,b). StaphylococR
cus aureus ATCC
29213 served as quality control strain in the
broth microdilution tests.
Molecular analyses
Plasmid isolation and transfer experiments were conducted as
described by Weiß et al. (2014). To analyze the two isolates for the
presence of novel macrolide resistance genes, whole-genome
sequencing was performed as previously described (Wendlandt
et al. 2014). Genomic DNA of isolates L0-6 and A ER Ab-7 served
for the construction of a shotgun library using Illumina Hiseq
2000, which produced 100-bp paired-end reads (Berry Genomics
Company, Beijing, China). A draft assembly of the sequences was
conducted using CLC Genomics Workbench 5 (CLC Bio, Aarhus,
Denmark). Both sequences were then compared with the nucleotide sequences deposited in the National Center for Biotechnology Information (NCBI) database using the BLASTN function.
Sequence analysis for potential macrolide resistance genes was
conducted using the ORF Finder and the BLASTP functions at
NCBI.
PCR assays were designed to amplify the erm gene from isolate L0-6, including 344 bp in the upstream region and 155 bp in
the downstream region and the erm gene of isolate A ER Ab-7,
including 328 bp upstream and 145 bp downstream of the gene
(Table 1). Both amplicons of 1231 bp and 1205 bp, respectively,
R
R
were first cloned in the pCR
2.1-TOPO
vector and transformed
R
R
into the E. coli TOP10 strain using the TOPO
TA Cloning
Kit
(Life Technologies GmbH, Darmstadt, Germany). In a second
step, the inserts were cut from this vector by either EcoRI (isolate L0-6) or SacI/XbaI (isolate A ER Ab-7) digestion and inserted
in the E. coli–S. aureus shuttle vector pLI50 (Lee, Buranen and Ye
1991). The recombinant shuttle vectors were first transferred by
electrotransformation into E. coli TOP10 and subsequently into
the recipient S. aureus strain RN4220. Susceptibility testing of the
transformants was conducted as described (CLSI 2013a,b).
To specifically detect each of the two erm genes in staphylococcal isolates, two internal PCR assays were developed which
amplified internal segments of 556 bp (isolate L0-6) and 260 bp
(isolate A ER Ab-7), respectively (Table 1).
The nucleotide sequences of the erm-containing contigs of
isolates L0-6 and A ER Ab-7 were deposited in the European
Molecular Biology Laboratory (EMBL) database under accession
numbers KJ728534.1 and KJ728533.1, respectively.
RESULTS AND DISCUSSION
Characterization of the staphylococcal isolates L0-6
and A ER Ab-7
The two Staphylococcus isolates L0-6 and A ER Ab-7 were identified as S. xylosus and S. saprophyticus, respectively. While A ER
Ab-7 showed an MIC against erythromycin of ≥256 μg mL−1 ,
L0-6 revealed an erythromycin MIC of only 4 μg mL−1 (Table 2).
After induction by a subinhibitory erythromycin concentration
(0.1 μg mL−1 erythromycin in cation-adjusted Mueller-Hinton
broth), the MIC of erythromycin of isolate L0-6 increased up to
≥64 μg mL−1 (data not shown). Both isolates were susceptible
to the lincosamides clindamycin and pirlimycin and showed
low MICs against the 16-membered macrolides tilmicosin and
3
Wendlandt et al.
Table 1. Primers used to detect the MLSB resistance gene erm(44) and its variant.
Purpose
erm(44)
Cloning of erm(44) and its
flanking regions
Detection of erm(44)
erm(44) variant
Cloning of the erm(44)
variant and its flanking regions
Detection of the erm(44) variant
erm(44)L0-6
erm(44)L0-6
erm(44)L0-6
erm(44)L0-6
Annealing
temperature (◦ C)
Amplicon
size (bp)
AGGGAGGGCTTTAAGCATGA
CCTCAATGAAGGCCTCAACA
TTGGAACTGGAAAAGGACACTT
TGTACCTTTGCATGTTTTAACG
57
1231
58
556
TTGATGTGAAAGCGCCTAGA
TGGAATCATATAATCACCTCATGAAT
TGGATTATCAATTCCCTGAGC
TGCCGATTCCACTTTAGGTT
54
1205
57
260
Nucleotide sequence (5 to 3 )
Primer
fw
rv
int fw
int rv
erm(44)A ER Ab-7
erm(44)A ER Ab-7
erm(44)A ER Ab-7
erm(44)A ER Ab-7
fw
rv
int fw
int rv
Table 2. Phenotypic and genotypic characteristics of erm(44)-positive Staphylococcus isolates.
Species (number of isolates)
erm gene
MIC [μg mL−1 ]
Erythromycin
High erythromycin MICs
S. saprophyticus A ER Ab-7 (1)
S. saprophyticus (1)
S. saprophyticus (9)
erm(44) variant
erm(44)
erm(44)
≥256
≥256
≥256 (heterologous
expression1 )
0.06
0.06
≥256
erm(44)
erm(44)
erm(44)
erm(44)
erm(44)
erm(44)
4
4
4–8
8–16
32
64, 128
0.12
0.25
1
≥256
≥256
≥256
Lower erythromycin MICs
S. xylosus L0-6 (1)
S. xylosus (2)
S. xylosus (4)
S. saprophyticus (5)
S. xylosus (1)
S. saprophyticus (2)
1
Clindamycin
Detectable by single colonies growing in the inhibition ellipse.
tylosin. Plasmid transfer experiments with subsequent selection of transformants on erythromycin-containing media
(15 μg mL−1 ) were repeatedly unsuccessful, suggesting that
the genes in question might be located in the genomic
DNA.
Identification and genetic environment of the erm(44)
genes
For both isolates, rRNA methylase gene-carrying contigs were
obtained during whole-genome sequencing, which had sizes of
368 204 bp (S. xylosus L0-6) and 52 788 bp (S. saprophyticus A ER
Ab-7), respectively. Subsequent search for erm genes and
comparison with the nucleotide sequences deposited in the
database revealed two different open reading frames coding for
rRNA methylases, one on each contig of S. xylosus L0-6 and S.
saprophyticus A ER Ab-7, respectively.
The functionality as an erm gene was confirmed by cloning
and expression of the respective genes. In both cases, the S. aureus RN4220 transformants, carrying each of the recombinant
shuttle vectors, revealed MICs for erythromycin of ≥64 μg mL−1 ,
which corresponded to a ≥256-fold increase, as compared to the
recipient S. aureus RN4220. Moreover, an inducible clindamycin
phenotype was confirmed by the D-test in both isolates as well
as in the corresponding S. aureus RN4220 transformants. This ob-
servation was supported by the presence of translational attenuators upstream of the respective erm genes. They included two
reading frames for peptides of 17 and 8 amino acids (aa) (S. xylosus L0-6) and 20 and 8 aa (S. saprophyticus A ER Ab-7), as well as
three pairs of inverted repeated sequences, which are believed to
form different mRNA secondary structures in the presence and
absence of inducing macrolides (Weisblum 1995b).
Sequence analysis of the contig originating from S. xylosus
L0-6 identified a 732-bp gene, encoding for an rRNA methylase of 243 aa. An alignment of the protein with all currently known Erm proteins revealed 100% identity to the recently published Erm(44) protein of S. xylosus JW4341 (Wipf,
Schwendener and Perreten 2014). A comparison based on
a nucleotide sequence alignment between the contig of S.
xylosus L0-6 and the database entry of S. xylosus JW4341
(GenBank accession no. HG796218) revealed a 58 663 bp
erm(44)-carrying insert in S. xylosus L0-6, which was 5849 bp
larger than the insert of S. xylosus JW4341. Both inserts revealed high similarities in their sequences and the same
specific 19 bp core integration sites, located between the two
housekeeping genes whiA and clpP (Fig. 1a).
The contig of S. saprophyticus A ER Ab-7 also contained a gene
for an rRNA methylase of 243 aa. However, in a multisequence
alignment, it had only 84.0% aa identity with Erm(44) of S. xylosus
isolates JW4341 and L0-6, and 82.3% aa identity with the Erm(44)
4
FEMS Microbiology Ecology, 2015, Vol. 91, No. 8
Figure 1. (a) Schematic presentation of the 65 047 bp genetic environment of the erm(44) gene of S. xylosus L0-6 (EMBL accession no. KJ728534.1) and structural comparison with the corresponding 56033 bp region identified in S. xylosus JW4341 (GenBank accession no. HG796218). Open reading frames 1–53 (o1-o53) are presented as
arrows with the arrowhead indicating the direction of transcription. The color coding of the arrows is adapted from fig. 2 of Wipf, Schwendener and Perreten (2014):
Prophage genes are color coded as follows: lysogeny, red; DNA replication, yellow; DNA packaging and capsid morphogenesis, orange; tail morphogenesis, green; host
cell lysis, blue; unattributed, gray; the erm(44) gene is shown in pink. Dotted lined arrows indicate existing open reading frames, which are not shown in fig. 2 by
Wipf, Schwendener and Perreten (2014). Open reading frames indicated as h1–h25 may encode hypothetical proteins detected in the L0–6 sequence. The 19-bp core
integration sites of the erm(44)-containing bacteriophage at both sides of the insert are designated as attL and attR. The three 29-bp direct repeats (DR) are indicated
by upward-pointing black arrows. Regions of ≥99% identity are marked by dark gray shading. Light gray areas represent high identity of >80 to <99%. A distance scale
in kb is given below the maps. The dotted lines connect the different parts of the sequences. (b) Schematic presentation of the 52 788 bp genetic environment of the
erm(44) gene from S. saprophyticus A ER Ab-7 (EMBL accession no. KJ728533.1). Open reading frames are indicated as o1–o60 and may encode proteins with no specified
functions. All open reading frames are presented as arrows with the arrowhead indicating the direction of transcription. The variant of the MLSB resistance gene
R
erm(44) is shown in pink. The dark gray shaded area from base 23 216 to base 40 806 indicates 99.0% identity to S. saprophyticus ATCC
15305 (GenBank accession no.
AP008934). The light gray shaded area from base 43 580 to base 47 378 indicates 84.5% identity to S. xylosus HKUOPL8 (GenBank accession no. CP007208). A distance
scale in kb is given below the map. The dotted line connects the different parts of the sequence.
Wendlandt et al.
5
Figure 2. Abundance of erm(44) gene-carrying staphylococci in the aquatic environment. erm(44) could be detected in isolates from 10 out of 20 raw sewage samples,
6 out of 62 treated sewage samples and from 7 out of 40 river water samples.
variant of S. xylosus JW3659 (GenBank accession no. LK392593)
(Wipf, Schwendener and Perreten 2014). The erm(44)-carrying
segment of the contig of S. saprophyticus A ER Ab-7 had a size of
52 788 bp, including 51 911 bp in the upstream region of erm(44)
and 145 bp in the downstream region. A comparison based on
a multisequence alignment between the inserts of JW4341 or
L0-6, respectively, and the contig of A ER Ab-7 revealed no similarities, except for the erm(44)-related gene. Similarity searches
on nucleotide sequence level revealed that a 17.6-kb segment of
the contig of S. saprophyticus A ER Ab-7 exhibited 99.0% identity
R
to the whole-genome sequence of S. saprophyticus ATCC
15305
(GenBank accession no. AP008934) and another 3.8-kb segment
exhibited 84.5% identity to the whole-genome sequence of S. xylosus HKUOPL8 (GenBank accession no. CP007208) (Fig. 1b). None
of these two segments carried the erm(44)-related gene.
Detection of erm(44)
The erm(44) gene was detected in 9 S. xylosus and 17 S. saprophyticus isolates. The MLSB -resistant Staphylococcus isolates, which
carry the erm(44) gene, or its variant could be divided into isolates with high erythromycin MICs of ≥256 μg mL−1 and isolates
with significantly lower erythromycin MICs (Table 2). Apart from
the S. saprophyticus isolates N1W-16 and A ER Ab-7, all tested
erm(44)-carrying isolates, which displayed an inducible MLSB resistance phenotype, showed low erythromycin MICs of 4 or 8
μg mL−1 . The erm(44)-positive staphylococci with MICs for clindamycin of ≥256 μg mL−1 did not behave uniformly concerning their MICs for erythromycin and partially displayed a heterologous expression, observable by single colonies growing in
the inhibition ellipse, possibly due to a high mutation rate, as
previously described for erm(A) (Table 2; Heß and Gallert 2014b).
The erm(44) variant harboring inducible MLSB -resistant S. saprophyticus revealed an MIC for erythromycin of ≥256 μg mL−1 .
Wipf, Schwendener and Perreten (2014) reported MICs for erythromycin ranging between 16 and 128 μg mL−1 for their erm(44)positive S. xylosus isolates, obtained from bovine milk samples.
Spread of the erm(44) genes
While the genetic environment of S. xylosus L0-6 displayed DNA
fragments of a phage (Fig. 1a), in the parts flanking the erm(44)
gene of A ER Ab-7, no structures were identified that might
explain how the erm(44) variant gene was integrated into the
chromosomal DNA. Moreover, no insertion sequences, transposases, phage-related or plasmid-associated genes were found
that might give hints towards the location of the erm(44) variant
gene on a formerly mobile genetic element.
Although the effectiveness of the spread of antibiotic resistance genes by phages is not quantified and the transfer mechanism for erm(44) variant is unknown, erm(44) seemed to be
spread in the aquatic environment: it was detected in 50% (n =
20) of the raw sewage samples with cell numbers between 4.3 ×
102 and 2.5 × 103 CFU per 100 mL, in 9.7% of the treated sewage
samples (n = 62) with cell numbers between 0.2 × 100 and 4.3 ×
102 CFU per 100 mL as well as in 17.5% of the river water samples (n = 40) where the numbers of colony forming units varied
between 0.9 × 100 and 6.3 × 100 CFU per 100 mL (Fig. 2). In addition, the detection of erm(44) in S. xylosus isolated from bovine
milk by Wipf, Schwendener and Perreten (2014) demonstrates its
spread in different environments and in different staphylococcal species.
CONCLUSIONS
1. erm(44) can be frequently detected in raw and treated sewage
as well as in river water samples in relatively high cell numbers.
6
FEMS Microbiology Ecology, 2015, Vol. 91, No. 8
2. The aa sequences of Erm(44) are variable and isolates harboring erm(44) differ in their erythromycin and clindamycin
MICs.
3. The genetic environment of the erm(44) variant differs from
that of erm(44) and contains no fragments of phage DNA.
ACKNOWLEDGEMENTS
We thank Ute Beermann, Vivian Hensel and Regina Ronge for
excellent technical assistance.
FUNDING
This study was financially supported by the German Federal
Ministry of Education and Research (BMBF) via the projects
SchussenAktivplus [grant number 02WRS1281I], and MedVetStaph 2 [grant number 01KI1301D], as well as by the Major State
Basic Research Development Program of China [973 Program,
grant number 2013CB127200]. SW was supported by an internal
scholarship of the Friedrich-Loeffler-Institut (FLI).
Conflict of interest. None declared.
REFERENCES
Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for
Bacteria Isolated From Animals - Fourth Edition: Approved Standard VET01-A4. Wayne, PA, USA: CLSI, 2013a.
Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for
Bacteria Isolated from Animals; Second Informational Supplement
VET01-S2. Wayne, PA, USA: CLSI, 2013b.
Entorf M, Feßler AT, Kadlec K, et al. Tylosin susceptibility of staphylococci from bovine mastitis. Vet Microbiol
2014;171:368–73.
Fiebelkorn KR, Crawford SA, McElmeel ML, et al. Practical disk
diffusion method for detection of inducible clindamycin
resistance in Staphylococcus aureus and coagulase-negative
staphylococci. J Clin Microbiol 2003;41:4740–4.
Gherardi G, De Florio L, Lorino G, et al. Macrolide resistance genotypes and phenotypes among erythromycin-resistant clinical isolates of Staphylococcus aureus and coagulase-negative
staphylococci, Italy. FEMS Immunol Med Micr 2009;55:62–7.
Hansen LH, Mauvais P, Douthwaite S. The macrolide-ketolide
antibiotic binding site is formed by structures in domains
II and V of 23S ribosomal RNA. Mol Microbiol 1999;31:
623–31.
Heß S, Gallert C. Demonstration of staphylococci with inducible
macrolide-lincosamide-streptogramin B (MLSB ) resistance in
sewage and river water and of the capacity of anhydroerythromycin to induce MLSB . FEMS Microbiol Ecol 2014a;88:
48–59.
Heß S, Gallert C. Resistance behaviour of inducible clindamycinresistant staphylococci from clinical samples and aquatic
environments. J Med Microbiol 2014b;63:1446–53.
Kadlec K, Feßler AT, Hauschild T, et al. Novel and uncommon antimicrobial resistance genes in livestock-associated
methicillin-resistant Staphylococcus aureus. Clin Microbiol Infect 2012;18:745–55.
Lee CY, Buranen SL, Ye Z-H. Construction of single-copy integration vectors for Staphylococcus aureus. Gene 1991;103:101–5.
Monecke S, Ruppelt A, Wendlandt S, et al. Genotyping of Staphylococcus aureus isolates from diseased poultry. Vet Microbiol
2013;162:806–12.
Perreten V, Kadlec K, Schwarz S, et al. Clonal spread of
methicillin-resistant Staphylococcus pseudintermedius in Europe and North America: an international multicentre study.
J Antimicrob Chemoth 2010;65:1145–54.
Schwarz S, Feßler AT, Hauschild T, et al. Plasmid-mediated resistance to protein biosynthesis inhibitors in staphylococci.
Ann NY Acad Sci 2011;1241:82–103.
Weisblum B. Erythromycin resistance by ribosome modification.
Antimicrob Agents Ch 1995a;39:577–85.
Weisblum B. Insights into erythromycin action from studies of
its activity as inducer of resistance. Antimicrob Agents Ch
1995b;39:797–805.
Weiss S, Kadlec K, Feßler AT, et al. Identification and characterization of methicillin-resistant Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus and Staphylococcus pettenkoferi from a small animal clinic. Vet Microbiol
2013;167:680–5.
Weiß S, Kadlec K, Feßler AT, et al. Complete sequence of a multiresistance plasmid from a methicillin-resistant Staphylococcus epidermidis ST5 isolated in a small animal clinic. J Antimicrob Chemoth 2014;69:847–59.
Wendlandt S, Feßler AT, Monecke S, et al. The diversity of antimicrobial resistance genes among staphylococci of animal
origin. Int J Med Microbiol 2013;303:338–49.
Wendlandt S, Li J, Ho J, et al. Enterococcal multiresistance
gene cluster in methicillin-resistant Staphylococcus aureus
from various origins and geographical locations. J Antimicrob
Chemoth 2014;69:2573–5.
Wipf JR, Schwendener S, Nielsen JB, et al. The new MLSB resistance gene erm(45) is located within a genomic island in
Staphylococcus fleurettii. Antimicrob Agents Ch 2015;59:3578–81.
Wipf JR, Schwendener S, Perreten V. The novel macrolidelincosamide-streptogramin B resistance gene erm(44) is associated with a prophage in Staphylococcus xylosus. Antimicrob
Agents Ch 2014;58:6133–8.