Journal of General Virology (1993), 74, 1255-1260. Printed in Great Britain
1255
Efficient production of human gamma interferon in tobacco protoplasts by
genetically engineered brome mosaic virus RNAs
M a s a s h i Mori,* G u o - H u a Zhang, Masanori Kaido, Tetsuro O k u n o and Iwao Furusawa
Laboratory o f Plant Pathology, Faculty o f Agriculture, Kyoto University, S a k y o - k u 606, Japan
We succeeded in producing human gamma interferon
(IFN-?) in tobacco protoplasts in quantity using genetically engineered brome mosaic virus (BMV strain
ATCC66). This strain of BMV produces two types of
coat protein, a full-length coat protein (20K) and a
truncated coat protein (19K) which are translated from
the first and second initiation codons, respectively. We
replaced the truncated coat protein gene with the IFNy gene and synthesized BMV-IFN- 7 chimera RNAs
using an in vitro transcription system. The BMV-IFN-y
chimera RNAs were used to inoculate tobacco protoplasts together with BMV RNA 1 and R N A 2 and
produced IFN-y to a level of 5 to 10 % of total extracted
proteins per infected protoplast after 24 h of incubation.
The efficient production of IFN-? was attributed to the
Introduction
from the first and second initiation codons, respectively
(Mise et al., 1992). We replaced viral genes for la, 2a, 3a,
CP1 and CP2 with a human interferon gamma (IFN-y)
gene using biologically active c D N A clones of BMV and
obtained various B M V - I F N - y chimera RNAs using the
in vitro transcription system. These B M V - I F N - y chimera
RNAs were tested in tobacco protoplasts for their ability
to be replicated and to produce IFN- 7 by inoculation
with R N A 1 and R N A 2. We found that a chimera R N A
with the CP2 gene replaced by a foreign gene is replicated
most efficiently and produced the foreign protein. We
also discuss the post-translational modification and
biological activity of IFN-y produced in tobacco protoplasts.
The potential use of plant viral RNAs as expression
vectors for foreign genes has been reported for brome
mosaic virus (BMV) (French et al., 1986), tobacco
mosaic virus (TMV) (Takamatsu et al., 1987; Donson et
al., 1991) and barley stripe mosaic virus (BSMV) (Joshi
et al., 1990) using reporter genes such as chloramphenicol
acetyltransferase (CAT), neomycin phosphotransferase
and firefly luciferase. In those systems, however, the level
of protein production from foreign genes is low compared with that from the intrinsic viral genes for which
the foreign genes are substituted.
The BMV genome consists o f three separate RNAs
(Lane, 1981). R N A 1 (3.2kb) and R N A 2 (2.9kb)
encoding proteins la and 2a respectively are required for
R N A replication (French et al., 1986; Kiberstis et al.,
1981). Neither the putative movement protein 3a
encoded by R N A 3 (2.1 kb) nor the coat protein encoded
by subgenomic R N A 4 (0"9 kb) transcribed from R N A 3
(Miller et al., 1985) are required for viral R N A
replication. So any viral R N A segment, including
chimeric RNAs bearing a foreign gene, should be
amplified by co-inoculation with R N A 1 and R N A 2
providing the R N A contains sequences required for
replication (French & Ahlquist, 1987, 1988; Marsh et al.,
1988).
The strain ATCC66 of BMV used in this study
produces two types of coat protein: a full-length coat
protein (20K), designated CP1, and a truncated coat
protein (19K), designated CP2, which are translated
0001-1389 © 1993 SGM
high translation activity of the BMV-IFN-y chimera
RNA. We demonstrate that 24 nucleotides coding for
the N-terminal amino acids of the full-length coat
protein were probably involved in the high translation
activity of the BMV-IFN-y chimera RNA.
Methods
Construction of transcriptional vectors for BMV-IFN-y chimera
RNAs. Plasmids pBTF1, -2 and -3 which contain BMV full-length
cDNA1, -2 and -3 linked to the T7 promoter (Moil et al., 1991)were
used for construction of transcriptional vectors for BMV IFN-?
chimera RNAs. To replace viral genes encoding la, 2a, 3a and coat
proteins CP1 and CP2 with the IFN-y gene, a NsiI site was introduced
into initiation codons in each of the coding regions of BMV cDNAs
and the IFN-y gene by the method of Kunkel et al. (1987) using
oligonucleotides 5' pd GTTTTTCACCAACAAAATGCATAGTTCTATCGATTTGC for the la gene in pBTF1, 5' pd CACCAAGATGCATTCGAAAACCfor the 2a genein pBTF2, 5' pd GTTCCCGATGCATAACATAGTTT for the 3a gene in pBTF3, 5' pd
GTATTTAATGCATACTTCAGGAACfor the CP1 gene in pBTF3,
5' pd TGGTAAGATGCATCGCGCGCAGC for the CP2 gene in
pBTF3 and 5' pdTCTCTCGGAATGCATGCATGAAATATACfor
the IFN-y gene in pMKC-15 (kindly provided by Dai-ichi Pharma-
1256
M . M o r i and others
ceutical), creating pBTF 1a, pBTF2a, pBTF3a, pBTFpCP 1, pBTFpCP2
and pUCplFN-Nsi, respectively.
Immediately downstream from a termination codon in pUCplFNNsi, a SacI site was introduced using oligonucleotide 5' pd
CCCAGTAATGGAGCTCCTGCCTGC, creating pUCIFN-Nsi.
pBTF3a was cut with Clal [nucleotide (nt) 600] and StuI (nt 1776),
made blunt-ended with T4 DNA polymerase and then ligated with SacI
linkers. The plasmid was cut with SacI and self-ligated, thereby
removing intercistronic sequences and introducing a SacI site at the
ClaI (nt 600) site, creating pBTF3al, pBTF3 was cut with SacI (nt
1473) and Stul (nt 1776), made blunt-ended with T4 DNA polymerase,
and then self-ligated, thus removing a NsiI (nt 1717) site, creating
pBTF3a2, pBTF3a2 was cut with Clal (nt 600), made blunt-ended with
T4 DNA polymerase and then ligated with SacI linkers. The plasmid
was cut with SacI and self-iigated, thus introducing a SacI site at the
ClaI site, creating pBTF3a3, pBTFpCP 1 and pBTFpCP2 were cut with
StuI (nt 1776) and ligated with SaeI linkers. The plasmids were cut with
SacI and self-ligated, thus introducing a SacI site at the StuI site (nt
1776), creating pBTFCP1 and pBTFCP2, respectively. The larger
fragments of NsiI/SacI-cut pBTF2a, pBTF3al, pBTF3a3, pBTFCP1
and pBTFCP2 were ligated with the Nsil/SacI fragment of the IFN- 7
gene from pUCIFN-Nsi, creating pBTF2apIFN, pBTF3alpIFN,
pBTF3a3pIFN, pBTFCPlpIFN and pBTFCP2pIFN, respectively.
The large fragment of NruI- (nt 2626)/NsiI-cut pBTFla was ligated
with a SacI/NsiI-cut fragment of PUCIFN-Nsi in which the SacI site
had been made blunt-ended with T4 DNA polymerase before NsiI
treatment, creating pBTFlapIFN, pBTFlapIFN, pBTF2apIFN,
pBTF3alpIFN, pBTF3a3pIFN, pBTFCPlpIFN and pBTFCP2pIFN
were cut with NsiI, made blunt-ended with T4 DNA polymerase and
self-ligated, creating pBTFlaIFN, pBTF2aIFN, pBTF3alIFN,
pBTF3a3IFN, pBTFCPIIFN and pBTFCP2IFN. The larger fragments of BglII/EcoRI-cut pBTF3a3IFN were ligated with a smaller
fragment of BglII- (nt 1220)/EcoRI-cut pBTF3, creating pBTF3a4IFN.
pBTF3a4 was cut with BssHI (nt 1279), made blunt-ended with T4
DNA polymerase and self-ligated, thus introducing a frameshift into
the BMV coat protein gene, creating pBTF3a5IFN.
Construction of transcriptional vectors for BMV-fl-glucuronidase
(GUS) chimera RNAs. We replaced CP1 and CP2 genes with the GUS
gene by the same method used for the construction of BMV-IFN-7
chimera RNAs. A NsiI site and a SacI site were introduced at the
initiation and termination codons of the GU S gene in pBI 101 (Clontech
Laboratories) using oligonucleotides 5' pd GTGGTCAGTCATGCATGTTACGTC and 5' pd AATGAATCAAGAGCTCTCCTGGCG,
respectively, creating pUCGUS-Nsi. Transcriptional vectors
pBTFCP1GUS and pBTFCP2GUS were constructed by the same
method for pBTFCPIIFN and PBTFCP2IFN except that pUCGUSNsi was used instead of pUCIFN-Nsi.
Construction of transcriptional vectors for RNA 4 and CP2 genereplaced B M V IFN-? chimera RNA 4. Plasmid pBTF4 which contains
BMV full-length cDNA 4 linked to the T7 promoter (Mise et aL, 1992)
was used for the construction of a transcriptional vector for BMV-IFN7 chimera RNA 4. The large fragment of Sall/EcoRI-cut pBTF4 was
ligated with a small fragment of SalI/EcoRI-cut pBTFCP2IFN,
creating pBTFsCP2IFN.
In vitro transcription and protoplast inoculation. Plasmids carrying
the full-length BMV cDNA derivatives were linearized at an EcoRI site
immediately downstream from the BMV sequence and used as
templates for in vitro run-off transcription from the T7 promoter as
described (Mori et al. 1991). Protoplasts isolated from Nicotiana
tabacum cv. Petit Habana (SR1) were inoculated with in vitro transcripts
as described (Mori et al., 1992). Approximately 105 protoplasts were
collected after 24 h of incubation and used for further analysis.
RNA isolation and Northern blot analysis. RNA was isolated from
protoplasts as described (Chomczynski & Sacchi, 1987). The RNA was
denatured in formaldehyde/formamide and fractionated on a 1.5 %
agarose gel containing 1.8% formaldehyde and transferred to a
Biodyne membrane. BMV RNAs and BMV-IFN-7 chimera RNAs
were detected by a 32P-labelled SP6 transcript obtained from a subclone
containing the 200 base HindIII (nt 1914)/EcoRI 3'-terminal fragment
of BMV RNA 3 cDNA, which is conserved among all BMV RNAs. To
detect BMV-GUS chimera RNAs we used a 32P-labelled SP6 transcript
obtained from a subclone containing the 240-base NsiI (nt 1)/SnaBI (nt
240) fragment of pUCGUS-Nsi.
Protein analysis. Total protein was extracted from protoplasts with
Laemmli's buffer (Laemmli, 1970), and separated on a 15% polyacrylamide gel containing 0.1% SDS. Western blot analysis was carried
out as described (Towbin et al., 1979). Electrophoresed proteins were
transferred to an Immobilon-P transfer membrane (Millipore) and
probed with antiserum against IFN-y. The protein concentration of the
plant extracts was determined by the dye-binding method of Bradford
(1976) with a kit supplied by Bio-Rad Laboratories.
Deglycosylation of IFN- 7. N-Glycanase from Flavobacterium
meningosepticum was used for the digestion of IFN- 7 produced in
tobacco protoplasts. Protoplast extracts (20 gl) were denatured at
100 °C for 5 min in 0.05 M-Tri~HC1 buffer pH 7.5, containing 0.5 %
SDS, 50 mm-2-mercaptoethanol, 50 mM-EDTA. After cooling, 20 ~tl of
7.5 % NP40, 2.4 ~tl (0-6 unit) of N-glycanase and 27.6 ~tl of distilled
water were added to the solution and incubated at 37 °C for 16 h.
Samples were analysed on a 15 % SDS-polyacrylamide gel in parallel
with an undigested control.
IFN- 7 assay. The antiviral activity of IFN-)~ was assayed by
measuring the inhibition of cytopathic effects caused by Sindbis virus
in human FL cells as described (Miyata et al., 1986).
In vitro translation. In vitro translation of BMV-IFN- 7 chimera
RNA 4 was performed using wheatgerm extract (Amersham) as
described (Mise et al., 1992). Radiolabelled polypeptides were separated
on a 15% SDS-polyacrylamide gel. The gel was treated with
ENLIGHTNING (Du Pont) for fluorography and exposed to a Fuji
New RX film at - 7 0 °C.
Results
BMV-IFN- 7 and BMV-GUS
chimera R N A s
Various BMV-IFN- 7 or BMV-GUS chimera cDNAs
w e r e c o n s t r u c t e d b y r e p l a c i n g t h e l a , 2a, 3a, CP1 a n d
C P 2 g e n e s w i t h the I F N - 7 o r G U S g e n e (Fig. 1).
BMV-IFN-?
chimera RNAs
transcribed from the
EcoRI-cut pBTFlaIFN,
pBTF2aIFN,
pBTF3alIFN,
pBTF3a4IFN,
pBTF3a5IFN,
pBTFCPIIFN
and
pBTFCP2IFN by T7 RNA polymerase were designated
F l a I F N , F 2 a I F N , F 3 a l I F N (an i n t e r c i s t r o n i c s e q u e n c e
d e f i c i e n t m u t a n t ) , F 3 a 4 I F N , F 3 a 5 I F N (a c o a t p r o t e i n
frameshift mutant), FCPIIFN and FCP2IFN, respectively (Fig. 1 b). S i m i l a r l y B M V - G U S
chimera RNAs
obtained from pBTFCP1GUS and pBTFCP2GUS were
d e s i g n a t e d F C P 1 G U S a n d F C P 2 G U S , r e s p e c t i v e l y (Fig.
It,).
Replication o f B M V
IFN-7 chimera RNAs
B M V - I F N - 7 c h i m e r a R N A s w e r e tested f o r t h e i r a b i l i t y
to be r e p l i c a t e d in t o b a c c o p r o t o p l a s t s f o l l o w i n g c o inoculation with RNA 1 and RNA 2 transcripts. Total
Efficient production of IFN-7
1257
(a)
(a)
~ 5' non-coding I ATG. . . . iral coding ~ ~ • * • ~ATG
region
I TAC° ° ° region
~ ° ° ° ~TAC foreigngene
Site-directed
mutagenesis
z z
[ Site-directed
mutagenesis
NsiI
L)
cq
NsiI
t 5' non-coding ATGCAT viralcoding~ ~ A_T___GC___A_TGforeigngene ~
region
TACC,TA region ~ ) TACGTAC
I NsiI
RNA
RNA 2 RNA 3 1
] NsiI
T4 DNA polymerase
T4 DNA polymerase
~5' non-coding
region
IA
-
TG
IAC e°reigngene ~
RNA 4
~ 5 ' non-coding ATG
region
TAC foreign gene
-
5
(b)
(b)
la
~3esx
...... J
2a
s~cx
I
RNA 1
~
FlaIFN
~
RNA 2
o-1
F2alFN
~
RNA 3
----
F3a4IFN
~
L
F3a5IFN
~
,it
F3alIFN
~
.................
RNA3
~,
...... ~
......
..............................
3a
~
CP
,
~,,'
i
i
'
'I
I------
...............
'. .................................
FCP2IFN au,
~
..................... n.,
~.,'~~;~i~C'
:' ~!t~
~: ~il!!~:~::~:~*:~:~:~:~*~:~
[~!ii~!1~
~i~::~
~!!~!~~ ~
FCP1GUS ~,
FCPIlFN ~
RNA4
~'i
";:~':::--,,,
Fig. 2. (a) Replication of B M V - I F N p chimera RNAs in protoplasts.
Total cellular R N A was extracted from protoplasts inoculated with the
BMV-IFN-?~ chimera RNAs or R N A 3 together with R N A 1 and R N A
2. The R N A (1.5~tg) was separated on a 1.5% agarose gel and
hybridized with an R N A probe complementary to the T-terminal
sequences conserved among all BMV RNAs. The positions of RNAs 1,
2, 3 and 4 are indicated. (b) Accumulation of IFN-7 in BMV IFN- 7
chimera RNA-infected protoplasts. Lane I F N contains 50 ng of
purified leukocyte IFN-7 (JCR Pharmaceuticals). The position of IFN7 is indicated in the right margin.
~
CP
[
FsCP2IFN
Fig. 1. Construction of BMV-IFN-?, and GUS chimera RNAs. (a)
Strategy for replacing each BMV gene with foreign genes. (b)
Schematic representation of BMV IFN-7 and GUS chimera RNAs.
~ , Cap structure; - - ,
non-coding region;!
,, viral coding region;
V , four-base insertion.
RNAs extracted from protoplasts were analysed by the
Northern blot method using a probe specific for the 3'
end of the BMV genome. Results in Fig. 2(a) show that
F3a4IFN, F3a5IFN, F C P I I F N and FCP2IFN replicated and directed synthesis of the subgenomic m R N A
whereas FlaIFN, F2aIFN and F3alIFN failed to
replicate. Immunofluorescent staining with antiserum
against IFN-y showed that in 5 to 10 % of the protoplasts
inoculated with FCP2IFN IFN-~ accumulated to a
detectable level (data not shown). The infection level was
similar to that with RNA 3 as assessed by antiserum
against coat protein (data not shown). Subgenomic
mRNA transcribed from FCP2IFN accumulated to
approximately 1% of the total extracted RNA per
infected protoplast (data not shown).
Analysis of IFN- 7 produced in tobacco protoplasts
IFN-7 produced in tobacco protoplasts was analysed by
Western blotting using antiserum against IFN-y. IFN- 7
accumulated in three different fractions with MrS of
approximately 23K, 18K and 14-5K when protoplasts
were inoculated with F3a4IFN, F3a5IFN, F C P I I F N
and FCP2IFN. Among these RNAs FCP2IFN produced
IFN-y to the highest level, approximately six-fold greater
than that produced by FCPIIFN (Fig 2b). The amount
of IFN- 7 produced by FCP2IFN was estimated to be
approximately 0'5 % of the total extracted proteins by
comparing the signal observed with those obtained for
standard IFN- 7 (Fig. 3). This represents 5 to 10 % if the
1258
M. Mori and others
1
2
3
4
5
Fig. 3. The accumulation level of IFN-y produced in FCP21FNtransfected protoplasts. Protoplasts were inoculated with FCP2IFN
together with BMV RNAs 1 and 2, total proteins were extracted after
24 h of incubation and separated on a 15% SDS-polyacrylamidegel.
IFN-7 was identifiedby immunoblotting.Lane 1 contains 50 ng protein
from mock-inoculated protoplasts. Lane 2 contains 25 ng purified
leukocyte IFN-7 (JCR Pharmaceuticals), used as a standard. Lane 3
contains 50 gg protein from FCP2IFN-infected protoplasts. Lanes 4
and 5 contain 10 and 2 gg protein from FCP21FN-infectedprotoplasts,
respectively, supplemented with 40 and 48 gg protein from mockinoculated protoplasts, respectively.
1
2
3
4
25K -
20K -
23K
18K
15K-
14.5K
Fig. 4. Deglycosylationof IFNp produced in tobacco protoplasts.
Leukocytegamma interferon (lane 2) and IFNp produced in tobacco
protoplasts (lane 4) were treated with N-glycanaseand separated on a
15% SDS-polyacrylamidegel in parallel with undigested leukocyte
gamma interferon (lane 1) and IFN-7 produced in protoplasts (lane 3).
IFN-7 was identifiedby immunoblotting. Mrs and positions of IFN-7
are indicated in the margins.
percentage of infected protoplasts is taken into consideration.
Analysis of glycosylation of lFN-)~ in tobacco
protoplasts
IFN-7 produced in animal cells consists of three doublet
components (of approximately 25K, 20K and 15K) when
analysed by S D S - P A G E (Miyata et al., 1986). The 25K
and 20K proteins are glycosylated and the 15K one is a
minor component, probably non-glycosylated. IFN- 7
produced in tobacco protoplasts similarly gave three
doublet bands (of approximately 23K, 18K and 14.5K).
The Mrs of each component were different from those of
IFN-y produced in animal cells (Fig. 2b). To investigate
the glycosylation of IFN-~ produced in tobacco protoplasts, crude protein extracts from protoplasts inoculated
with F C P 2 I F N combined with R N A 1 and R N A 2 were
treated with N-glycanase and analysed by the Western
blot method. Signals corresponding to the 23K, IFN-7
seemed to shift to a 14.5K protein after treatment with
N-glycanase (Fig. 4). This suggested that the 23K IFN7 was deglycosylated, but the 18K and 14.5K proteins
were not deglycosylated. These results revealed that
IFN-7 can be glycosylated in tobacco protoplasts. Posttranslational modification at the N a n d / o r C termini of
the protein seemed to differ between plant and animal
cells.
Analysis of the biological activity of IFN-7 produced in
tobacco protoplasts
Proteins were extracted from FCP2IFN-inoculated protoplasts. The extract containing IFN-~, at a concentration
of approximately 10 ~tg/mg was assayed for the antiviral
activity of IFN- 7 by measuring the inhibition of
cytopathic effects caused by Sindbis virus in human F L
cells as described (Miyata et al., 1986). The protein
extract had an activity of 4 x 104 international units
(IU)/mg, and protein extracts from mock-inoculated
protoplasts had 8 x 102 IU/mg. These results indicate
that IFN-y produced in tobacco protoplasts had an
antiviral activity of approximately 4 x l0 GIU/mg.
Analysis of the replication of B M V - G U S chimera
RNAs and the production of GUS in tobacco protoplasts
The CP1 and CP2 gene-replaced B M V - G U S chimera
RNAs designated F C P 1 G U S and FCP2GUS, respectively, were tested for their ability to replicate and to
produce GUS in tobacco protoplasts co-inoculated with
R N A 1 and R N A 2. Both F C P 1 G U S and F C P 2 G U S
replicated, with subgenomic m R N A being produced to
the same extent (Fig. 5 a). However, G U S was detected
only in protoplasts inoculated with F C P 2 G U S (Fig. 5 b).
A fluorometric assay for GUS using 4-methylumbelliferyl fl-D-glucuronide showed that the amount of GUS
produced from F C P 2 G U S was approximately 30-fold
the level of that produced from F C P 1 G U S (data not
shown).
In vitro translation of B M V - I F N p chimera RNA 4
BMV strain ATCC66 produces two types of coat protein
from the first and second initiation codons of the coat
protein gene (Mise et al., 1992). Therefore F C P 2 I F N was
expected to produce two types of IFN-~, a coat proteinfusion IFN-y and an authentic IFN- 7. We used an in
vitro translation system to study this because the N-
Efficient production of IFN-7
1259
panied by a minor band with lower electrophoretic
mobility (Fig. 6). The alteration of the second AUG to
AUU in FsCP2IFN resulted in an increase in this minor
band, with no product migrating to the position of the
main product from FsCP2IFN (unpublished results).
These results indicate that FsCP2IFN mainly produced
the authentic IFN-y translated from the second initiation
codon, whereas BMV RNA 4 produced approximately
the same amount of CP1 and CP2 (Fig. 6).
1
(a)
<1
Discussion
(b)
1
2
iiiiii
M
i ii
Fig. 5. (a) Replication of B M ~ G U S chimera RNAs in tobacco
protoplasts. Total cellular RNA was extracted from protoplasts
inoculated with FCP 1GUS (lane 1) or FCP2GUS (lane 2) together with
RNA 1 and RNA 2. The RNA (1.5 gg) was fractionated on a 1.2%
agarose gel and hybridized with an RNA probe specific to the GUS
gene. ~I, BMV-GUS chimera RNA 3; <1, BMV-GUS chimera
subgenomic RNA 4. (b) Accumulation of GUS in BMV-GUS chimera
RNA-infected protoplasts. Total proteins were extracted from protoplasts inoculated with FCP1GUS (lane 2) or FCP2GUS (lane 1)
together with RNA 1 and RNA 2. The protein (10 gg) was separated
on a 12.5% SDS-polyacrylamide gel and GUS was identified by
immunoblotting. Lane M contains protein from mock-inoculated
protoplasts. The position of GUS is indicated in the margin.
1
2
Fig. 6. A fluorograph of the in vitro translation products of the CP2
gene-replaced BMV-IFN- 7 chimera RNA 4 (lane 2) and BMV RNA 4
(lane 1) separated on a 15% SDS-polyacrylamide gel. <], Slower
migrating band; ,q, faster migrating band.
terminal signal peptide of the IFN-y is likely to be
processed in vivo thereby making it difficult to determine
the ratio between the two types of IFN-7. BMV R N A 4
with the IFN- 7 gene replacing the CP2 gene (FsCP2IFN,
Fig. 1b) was synthesized in vitro from the transcriptional
vector pBTFsCP2IFN and was tested in a wheatgerm
extract to analyse its translation products. BMV RNA 4
was used as the control. FsCP2IFN mainly produced
I F N p with a faster electrophoretic mobility accom-
The results presented here showed that BMV RNA 3 in
which the CP2 gene was replaced with the I F N p gene
produced IFN- 7 to approximately 10% of total extractable proteins in infected tobacco protoplasts coinoculated with RNAs 1 and 2. A similar approach using
the Russian strain of BMV has been reported for the
expression of the CAT gene (French et al., 1986). It is
difficult to compare the two systems as regards the level
of foreign gene expression and protein production since
the foreign genes and protoplasts used are different and
the accumulated levels of CAT are based only on its
activity.
A major difference between the two systems is that we
used the CP2 gene for expressing a foreign gene instead
of the full-length coat protein (CP1) gene used in the
previous work by French et al. (1987). The production of
IFN-), and GUS from the CP2 gene-replaced chimera
RNA 3 was six- and 30-fold of that from the CP1 genereplaced chimera RNA 3, respectively, although RNA
replication of these chimera RNA 3s did not differ in
transfected tobacco protoplasts. In addition, the translation activity of the CP1 or CP2 gene-replaced GUS or
IFN chimera RNA 4 in wheatgerm extract resembled
that of RNAs in vivo (unpublished results). These results
suggest that 24 nt that code for the N-terminal eight
amino acids of CP1 are required for the efficient
translation of inserted foreign genes in chimera RNA 4
both in vivo and in vitro. However, a BMV mutant with
the N-terminal 24 nt of the coat protein gene deleted
allows translation to start at the initiation codon of the
CP2 gene in the Russian strain of BMV and has normal
infectivity in host plants (Sacher & Ahlquist, 1989).
Therefore it is suggested that nucleotide sequences
encoding the N-terminal region of either the viral coat or
foreign proteins are closely involved in determining the
translation efficiency of BMV RNA 4 and its mutant
derivatives.
It is known that the sequences adjacent to initiation
codons influence the translation efficiency of mRNA
(Kozak, 1991). The translation of CP1 of BMV ATCC66
is influenced by a single nucleotide change in the 3'
flanking position of the first AUG (Mise et al., 1992).
1260
M. Mori and others
However, it should be noted that BMV ATCC66 lacks
two adjacent adenine residues in the leader sequence of
the coat protein gene in R N A 4 (Mise et al., 1992). This
might affect translation of foreign proteins such as IFNand GUS from the first A U G in F C P I l F N and
FCP1GUS.
The comparison of the replication activities of various
chimera RNAs used here provides us with further insight
into the replication properties of each segmented genomic RNA of BMV. FlaIFN, F2aIFN and F 3 a l I F N
failed to replicate and/or accumulate in transfected
protoplasts. This was true for similar types of BMVGUS chimera RNAs (data not shown). Although
accumulation levels of chimera RNAs in protoplasts will
be affected by both the replication activity and the
stability of the RNA, F3alIFN was expected not to
replicate because of the lack of intercistronic sequences
which are required for efficient amplification of RNA 3
(French & Ahlquist, 1987). The replication of F l a I F N
and F2aIFN are likely to be affected by inserted
sequences since protein coding sequences in BMV RNA
2 are thought to be involved in RNA replication (Marsh
et al., 1991) although no information is available for
R N A 1.
The initiation codon of IFN-7, which is the second
initiation codon in FCP2IFN, was predominantly used
for the translation of IFN-y from the subgenomic
chimera RNA 4. This indicates that the majority if IFNy synthesized from FCP2IFN was an authentic IFN- 7
rather than the coat protein-fusion IFN-7. This unexpected feature of FCP2IFN will be useful for practical
applications of this system in the future.
IFN-~ produced in tobacco protoplasts retained its
biological activity, but post-translational modifications
in the N- and/or C-terminal regions of IFN-~, or
glycosylation, seem to vary between plant and animal
cells. The activity of IFN- 7 produced in tobacco
protoplasts (approximately 4 x 10~IU/mg) was low
compared to that of IFN-? in animal cells (4.3 x 107
to 12 x 107 IU/mg (Miyata et al., 1986). This may be due
to infrequent glycosylation of IFN-7 in plant cells (Fig.
4). Further purification of the IFN- 7 produced in plant
cells will be required for making an exact comparison of
these IFN- 7 activities.
We thank Kyoko Kasama (TORAY Biological Research) for kindly
assaying the activity of IFN-y. This work was supported in part by a
Grant-in-Aid for Scientific Research on Priority Areas (03257104) from
the Ministry of Education, Science and Culture, Japan.
References
BRADFORD, M.M. (1976). A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the principle
of protein-dye binding. Analytical Biochemistry 168, 48-53.
CHOMCZYNSKI,P. & SACCHI,N. (1987). Single-step method of RNA
isolation by acid guanidium thiocyanate~henol~zhloroform extraction. Analytical Biochemistry 162, 156-159.
DONSON, J., K~d~NEY, C. M., HILF, M. E. & DAWSON,W. O. (1991).
Systemic expression of a bacterial gene by a tobacco mosaic virusbased vector. Proceedings of the National Academy of Sciences,
U.S.A. 88, 7204.7208.
FRENCH, R. & AHLQUIST,P. (1987). Intercistronic as well as terminal
sequences are required for efficient amplification of brome mosaic
virus RNA 3. Journal of Virology 61, 1457 1465.
FRENCH, R. & AHLQUIST,P. (1988). Characterization and engineering
of sequences controlling in vivo synthesis of brome mosaic virus
subgenomic RNA. Journal of Virology 62, 2411 2420.
FRENCH, R., JANDA,M. & AHLQUIST,P. (1986). Bacterial gene inserted
in an engineered RNA virus: efficient expression in monocotyledonous plant cells. Science 231, 1294-1297.
JosI-n, R. T., Josm, V. & Ow, D. W. (1990). BSMV genome mediated
expression of a foreign gene in dicot and monocot plant cells. EMBO
Journal 9, 2663-2669.
KIBERSTIS, P.A., LOESCH-FRrES, L.S. & HALL, T.C. (1981). Viral
protein synthesis in barley protoplasts inoculated with native and
fractionated brome mosaic virus RNA. Virology 112, 804-808.
KozA~c, M. (1991). A short leader sequence impairs the fidelity of
initiation by eukaryotic ribosome. Gene Expression 1, 111-115.
Ktn~I~L, T. A., ROBERTS,J. D. & ZAKOtm, R. A. (1987). Rapid and
efficient site-specific mutagenesis without phenotypic selection.
Methods in Enzymology 154, 367 382.
L~d~MMLI, U.K. (1970). Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature, London 227,
680-685.
LANE, L.C. (1981). Bromoviruses. In Handbook of Plant Virus
Infection: ComparativeDiagnosis, pp. 333-376. Edited by E. Kurstak.
Amsterdam: Elsevier.
MARSH, L.E., DREI~R, T.W. & HALL, T.C. (1988). Mutational
analysis of the core and modulator sequences of BMV RNA3
subgenomic promoter. Nucleic Acids Research 16, 981-995.
MARSH, L.E., POGUE, G.P., SZYBIAK, U., CONNELL, J.P. & HALL,
T. C. (1991). Non-replicating deletion mutants of brome mosaic virus
RNA-2 interfere with viral replication. Journal of General Virology
72, 2367-2374.
MILLER, W.A., DREAR, T.W. & HALL, T. C. (1985). Synthesis of
brome mosaic virus subgenomic RNA in vitro by internal initiation
on (-)-sense genomic RNA. Nature, London 313, 68-72.
MISE, K., TUGE, S., NAGAO, K., OKUNO, T. & FURUSAWA,I. (1992).
Nucleotide sequence responsible for the synthesis of a truncated coat
protein of brome mosaic virus strain ATCC66. Journal of General
Virology 73, 2543-2551.
MIYATA,K., YAMAMOTO,Y., UEDA,M., KAWADE,Y., MATSUMOTO,K.
& KUBOTA, I. (1986). Purification of natural human interferongamma by antibody affinity chromatography: analysis of constituent
protein species in the dimers. Journal of Biochemistry 99, 1681 1688.
MORI, M., MISE, K., KOBAYASHI,K., OKUNO, T. & FURUSAWA, I.
(1991). Infectivity of plasmids containing brome mosaic virus cDNA
linked to the cauliflower mosaic virus 35S RNA promoter. Journal of
General Virology 72, 243~46.
MORI, M., MISE, K., OKUNO,T. & FURUSAWA,I. (1992). Expression of
brome mosaic virus-encoded replicase genes in transgenic tobacco
plants. Journal of General Virology 73, 169-172.
SACHER,R. & AHLQUIST,P. (1989). Effects of deletion in the N-terminal
basic arm of brome mosaic virus coat protein on RNA packaging
and systemic infection. Journal of Virology 63, 4545~4552.
TAKAMATSU, N., ISHIKAWA, M., MESHI, T. & OKADA, g. (1987).
Expression of bacterial chloramphenicol acetyltransferase gene in
tobacco plants mediated by TMV-RNA. EMBO Journal 6, 307 311.
TOWBIN, H., STAEHELIN,T. & GORDON J. (1979). Electrophoretic
transfer of proteins from polyacrylamide gels to nitrocellulose
sheets: procedure and some applications. Proceedings of the National
Academy of Sciences, U.S.A. 76, 4350M354.
(Received 5 October 1992; Accepted 12 March 1993)