Molecular Genetics and Metabolism 101 (2010) 273–278
Contents lists available at ScienceDirect
Molecular Genetics and Metabolism
j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / y m g m e
Weight gain induced by an isocaloric pair-fed high fat diet: A nutriepigenetic study
on FASN and NDUFB6 gene promoters
Almudena Lomba, J. Alfredo Martínez ⁎, Diego F. García-Díaz, Laura Paternain, Amelia Marti,
Javier Campión, Fermín I. Milagro
Department of Nutrition and Food Sciences, Physiology and Toxicology. University of Navarra, Irunlarrea 1, 31008 Pamplona, Navarra, Spain
a r t i c l e
i n f o
Article history:
Received 28 July 2010
Accepted 28 July 2010
Available online 3 August 2010
Keywords:
DNA methylation
FASN
High fat diet
NDUFB6
Obesity
a b s t r a c t
Experimental studies have demonstrated that dietary macronutrient distribution plays an important role in
insulin regulation, a risk factor associated to obesity, diabetes and other metabolic disorders. To assess
whether the macronutrient composition of the diet could be related to obesity onset by affecting the
epigenetic regulation of gene expression, we investigated in rats the metabolic effects of two pair-fed
isocaloric diets: control (rich in carbohydrates) and high fat diet (rich in fat; HFD). Compared to controls,
HFD induced higher weight gain and adiposity and impaired glucose tolerance, which was accompanied by a
slight increase in adiponectin levels and liver steatosis. Epididymal adipose tissue expression of the fatty acid
synthase (FASN) gene and NADH dehydrogenase (ubiquinone) 1β-subcomplex 6 (NDUFB6) were
significantly reduced in HFD group. These variations in mRNA levels were accompanied by changes in the
methylation patterns of several CpG islands located in the promoter region of these genes. However, no
correlations were found between gene expression and the methylation status. These results suggest that
high fat intake produces overweighted rats independently of total energy intake. These diets could also
induce some epigenetic changes in the promoters of key genes that could influence gene expression and may
be behind metabolic alterations.
© 2010 Elsevier Inc. All rights reserved.
1. Introduction
Unbalanced feeding is one of the most determinant factors that can
induce a metabolic disorder [1]. In this context, a number of experimental
studies have demonstrated that not only the energy intake, but also the
macronutrient composition of the diet may play an important role in
insulin homeostasis, and that the inadequate distribution of macronutrients may constitute a risk factor associated with obesity, diabetes,
hypertension and other metabolic disorders [2,3]. Thus, the overconsumption of carbohydrates, fats, or both, may play a role in the
development of hepatic steatosis and lipid disturbances associated with
obesity and insulin resistance [4].
Diets with very low carbohydrate, but with a high fat content, are
commercially advertised to the public and through the mass media for
losing body weight and improving the health status [5]. Although high
fat–low carbohydrate diets have been claimed to lower risk factors for
cardiovascular disease and type 2 diabetes [6], the American Diabetes
Association currently recommends low fat and high complex carbohy-
Abbreviations: C, control; FASN, fatty acid synthase; FFA, Free fatty acids; HADHB,
hydroxyacyl-coenzyme A dehydrogenase; HFD, high fat diet; HS, high-sucrose diet;
NAFLD, non-alcoholic fatty liver disease; NDUFB6, NADH dehydrogenase (ubiquinone)
1β-subcomplex, 6; MDA, malondialdehyde; WAT, white adipose tissue.
⁎ Corresponding author. Fax: + 34 948 425649.
E-mail address: [email protected] (J.A. Martínez).
1096-7192/$ – see front matter © 2010 Elsevier Inc. All rights reserved.
doi:10.1016/j.ymgme.2010.07.017
drate intakes [7]. On the other hand, reducing the number of calories
consumed from a high fat diet (HFD) attenuated but did not prevent the
development of insulin resistance and obesity in mice [8], indicating a
role for the macronutrient distribution and content in the occurrence of
such disturbances. Additionally, high fat diets usually contain a high
proportion of saturated fat and a small amount of polyunsaturated fat, as
it is often found in the diets consumed by obese and non-alcoholic fatty
liver disease (NAFLD) patients [9].
On the other hand, adipose tissue is now considered an active
endocrine gland that affects all aspects of body homeostasis [10]. Thus,
some adipose tissue-derived molecules have been shown to regulate
energy homeostasis, dietary behavior as well as insulin sensitivity and
immunity, while diverse metabolic alterations in adipose tissue can affect
the expression of proteins involved in the control of lipid metabolism.
Nutritional, chemical and physical factors have the potential to alter
gene expression and modify adult disease susceptibility in various ways
through changes in the epigenome such as DNA methylation [11]. The
genomic targets contain regions that are rich in CpG dinucleotide
sequences, which can be differentially methylated and determine the
levels of gene expression. Moreover, if the environmentally induced
epigenetic adaptations occur at crucial stages of life, they can potentially
change behavior, disease susceptibility and survival [12]. Recent studies
indicate that environmental factors and diet can perturb the way genes
are controlled by DNA methylation and covalent histone modifications
[13]. Thus, in a previous study, our group has reported that ad libitum HFD
274
A. Lomba et al. / Molecular Genetics and Metabolism 101 (2010) 273–278
diets are able to alter the DNA methylation pattern of the leptin promoter
[14], although it was not clear whether it was caused by differences in
energy intake or by the macronutrient composition of the diet.
In this article, we examine the effects of two diets varying the
macronutrient composition, but with similar energy supply, on
obesity onset, by focusing attention on the epigenetic and transcriptomic regulation of key metabolic genes for de novo lipogenesis (fatty
acid synthase; FASN), mitochondrial oxidation (NADH dehydrogenase
(ubiquinone) 1β-subcomplex 6; NDUFB6) and β-oxidation (hydroxyacyl-coenzyme A dehydrogenase; HADHB). We specifically wondered whether diets with different macronutrient composition could
induce epigenetic changes that may be involved in the regulation of
the expression of these genes.
2. Material and methods
quantified with a NEFA C kit (Wako Chemicals, Neuss, Germany). For
liver malondialdehyde (MDA) determinations, a colorimetric assay
for lipid peroxidation was used (TBARS Assay Kit, Cayman Chemical
Company, USA) after sonicating for 15 s at 40 V in RIPA buffer with
protease inhibitors and centrifugating at 1,600 × g for 10 min at 4 °C.
The levels of liver triglycerides were determined by a colorimetric
assay (Triglycerides MR, Cromatest; Linear Chemicals, Spain) after
15 s sonication at 40 V in Tris–Cl buffer. Serum adiponectin (Linco
Research, St. Charles, MO, USA) and insulin levels (Mercodia AB,
Uppsala, Sweden) were measured by ELISA in an automated
TRITURUS equipment (Grifols International S.A., Barcelona, Spain).
The homeostasis model assessment (HOMA IR), as an index that
estimates the insulin resistance based on the relationship between the
fasting plasma insulin concentration and the glucose concentration,
was calculated as fasting plasma glucose times fasting serum insulin
divided by 22.5, as described elsewhere [17].
2.1. Animals and diets
2.4. Gene expression analysis
Eight-week-old male Wistar rats (initial body weight 257 g ± 11)
supplied by the Applied Pharmacobiology Center (CIFA, Pamplona,
Spain), were individually housed at 21–23 °C and controlled (50 ±
10%) humidity under a 12 h artificial light cycle (8 am to 8 pm) The
animals were randomly assigned to two different dietary groups:
control (C) and high fat (HFD). The control animals (n = 12) were fed
a standard pelleted diet (2014 Teklad Global 14% Protein Rodent
Maintenance Diet, Harlan Iberica, Barcelona, Spain) containing 18% of
energy as protein, 71% of energy as total carbohydrates (5.5% sugars,
65.5% starch) and 11% of energy as fat by dry weight, while the HFD
group (n = 11) was fed a high fat diet (D12330, Research Diets, New
Brunswick, NJ, USA) containing 16.4% of energy content as protein,
25.5% of energy as total carbohydrates (0% sucrose, 12.6% maltodextrin 10, 12.9% starch) and 58% of energy as fat (54% saturated fat, 4%
unsaturated fat) by dry weight.
During the experimental trial, all rats were isocalorically fed with
the same kcal/[g body weight] of the group that ate less (pair-fed
model). The HFD group received a diet restricted to the amount of
calories that the C group had consumed the day before as described
elsewhere [15]. Body weight and food intake were daily recorded.
2.2. In vivo experiments
At week 5, two gas exchange determinations were performed
(Oxygen [O2] consumption and carbon dioxide [CO2] production) by
using an Oxylet 00 O2/CO2 indirect calorimeter (Panlab SL, Barcelona,
Spain) as previously detailed [16]. Also, after a fasting period of 12 h,
rats fed the HFD and C diets were intraperitoneally administered with
a solution of 30% glucose at 1 g/kg body weight. To measure blood
glucose levels, blood from tail veins at 0, 15, 30, 60, and 120 min after
glucose administration was collected and glycemia levels were
determined by a Glucosemeter device (Roche Diagnostic, Mannheim,
Deutschland).
At the end of the experimental period (69 days), after a fasting
period of 12 h, rats were sacrificed by decapitation. Blood and tissue
samples were immediately collected and stored at −80 °C for further
analyses. All the procedures were performed according to national
and institutional guidelines of the Animal Care and Use Committee at
the University of Navarra.
Total RNA was isolated from epididymal adipose tissue and liver
according to Tri® manufacturer's instructions (Sigma-Aldrich, Missouri,
USA). DNase treatment was performed with a DNA-free™ kit (Applied
Biosystems, Austin, TX, USA), and cDNA synthesized using M-MLV
reverse transcriptase (Invitrogen, Carlsbad, CA, USA) as described by the
suppliers. Quantitative Real-Time PCR assays were performed following
the manufacturer's recommendations using an ABI PRISM 7000 HT
Sequence Detection System and Taqman probes for rat HADHB
(Rn00592435_m1), FASN (Rn01463550_m1) and NDUFB6
(Rn03416136_m1). The gene expression levels were normalized with
ubiquitin (Rn01789812_g1) and GAPDH (Rn 99999916_s1) mRNAs as
internal controls (Applied Biosystems, Austin, TX, USA) and using the
Genorm software [18], given that the expression of such genes are not
regulated by the diet [18,19]. Fold change between HFD and control rats
was calculated using the 2−ΔΔCt method.
2.5. DNA methylation analysis
The quantitative analysis of DNA methylation in the promoter
region of HADHB, FASN and NDUFB6 was determined after bisulfite
treatment by using the MassARRAY system (San Diego, CA, USA),
which combines base specific enzymatic cleavage with MALDITOF
Sequenom mass spectrometry technology [20]. Primers used are
reported in Table 1.
2.6. Statistical analysis
Results are presented as means ± SD of the means. Statistical
analyses were performed using SPSS 15.0 software package for
Windows (Chicago, IL, USA). Most variables were normally distributed as assessed by Shapiro–Wilk test. Variables that did not show a
normal distribution were logarithmically modified and normality
tests were then applied. In those variables (respiratory quotient,
energy expenditure and FASN expression) that failed to meet
conditions of normality after conversion, the non-parametric Mann–
Whitney U test was performed. The remaining data were analyzed by
the Student T test. Correlation analysis was performed using the
Pearson correlation coefficient or Spearman when appropriate.
Statistical significance was set-up at the p b 0.05 level.
2.3. Serum and liver analysis
3. Results
Circulating total and HDL-cholesterol and glucose were measured
with Cholesterol CP, HDL direct CP and HK-CP kits (ABX diagnostic,
Montpellier, France), respectively, in a COBAS MIRA equipment
(Rochel, Basel, Switzerland). Serum triglycerides and lactate were
measured with a Randox kit and a L-Lactate kit, respectively (Randox,
Ltd. Laboratories, Ardmore Road, UK). Free fatty acids (FFA) were
3.1. Metabolic effects
As designed, the total energy consumed during the trial was
similar in both groups (C and HFD). At the end of the 69 days, the
animals fed a HFD diet increased their weights up to 208.9 ± 45 g,
A. Lomba et al. / Molecular Genetics and Metabolism 101 (2010) 273–278
275
Table 1
Primer sequences for quantitative analysis of the degree of DNA methylation using the MassARRAY system.
Gene
Forward primer (5′ → 3′)
Reverse primer (3′ → 5′)
FASN
NDUFB6
HADHB
GGGTTGATAAGTAAGGTTTTGAGGTTTTGGTTT
TTTTAGGTTAAGAAGGTGGGAATTT
TTTTTTTATTAGTAGGAAAAGGGTAGT
GTTATAGAAAGGGTGGGTGTTTGAG
TGGTTGAAGGATTAAGAGTTGAGTT
GGGTTGATTTTTGAATAAGATTTGA
whereas the control group only gained 158.5 ± 25 g, the difference
being statistically significant (p b 0.01). However, the HFD group
showed higher body weight since day 6 until the end of the dietary
treatment (Fig. 1). Moreover, energy expenditure was slightly,
although not statistically significant, increased in animals fed a HFD
diet without affecting the respiratory quotient (Table 2).
A statistically significant increase in liver triglyceride levels were
observed in the HFD group compared to C animals (Table 3),
suggesting an impairment in liver metabolism as well as hepatic
steatosis. No differences between both dietary groups in total and
HDL-cholesterol, FFA, lactate, insulin, adiponectin and liver malondialdehyde (MDA) were found.
During the experimental trial (at week 5) an intraperitoneal
glucose overload was performed. Its suggested an early impairment of
insulin sensitivity in the HFD animals (Fig. 2).
The adiposity was higher in the HFD group as compared to C
animals (Fig. 3), as indicated by the weight of several adipose tissue
depots: subcutaneous, retroperitoneal, mesenteric and epididymal.
3.2. Gene expression
Additionally, the epididymal adipose tissue expression (mRNA
levels) of three genes was analyzed: HADHB, FASN and NDUFB6.
Interestingly, both FASN and NDUFB6 expression were downregulated (p b 0.05) in the group fed a HFD diet as compared to C group. A
marginal decrease in mRNA levels (p = 0.08) was found in the other
analyzed gene, HADHB (Fig. 4). The mRNA levels of FASN, NDUFB6
and HADHB were also assessed in liver, although no differences were
noted between both dietary groups (data not shown).
3.3. DNA methylation
When analyzing DNA methylation patterns at the promoter level
of HADHB, FASN and NDUFB6 in epididymal fat, some changes in the
last two genes were observed. Given that HADHB mRNA levels and the
methylation levels in selected CpGs islands of this gene were not
statistically affected (data not shown), we focused on the study of
NDUFB6 and FASN genes (Fig. 5). Regarding the FASN gene promoter,
there was a significant reduction (p = 0.015) of methylation at
positions −833/−829 in the HFD (34.5 ± 2.3%) with respect to the
C group (46.8 ± 6.4%; Fig. 5). Correlation analyses between FASN
expression and methylation levels were also performed, although no
relevant correlations were found (not shown).
In relation to the NDUFB6 methylation pattern, we observed a
statistically significant hypermethylation (p = 0.049) in the HFD
group at positions +143/+158 (70.5 ± 17.4% in C group vs.84.8 ±
11% in HFD group), while the gene was found significantly
hypomethylated (p = 0.045) at positions −7/+3/+14 (8.3 ± 4.3% in
C group vs. 4.9 ± 2.3% in HFD group) and +34 (8.7 ± 3.9% in C group
vs. 5.1 ± 2.3% in HFD group; p = 0.027) and showed a trend to
decrease (p = 0.08) in positions + 36/+46/+58 (5.6 ± 1.6% in C
group vs.4.2 ± 1.7% in HFD group) as compared to C group (Fig. 5). No
statistical correlations were found between the methylation levels
and the expression of the gene (data not shown).
Finally, the methylation patterns of the same sequences were
measured in the liver, but no differences were observed in any of the
genes when comparing the two dietary treatments (data not shown).
4. Discussion
The consumption of a HFD diet induced a higher weight gain and
fat mass than the control diet despite their isocaloric intake. Other
authors have reported comparable results in rodents fed a HFD ad
libitum model [21]. A similar effect on weight gain and adipose
deposition has also been found after isocalorically feeding with a
high-sucrose diet (HS) [22] and a high fat sucrose diet (HFS) in Wistar
rats [19]. However, a pair-fed model with high fat feeding in C57BL/6J
mice did not produce statistically significant changes in body weight
gain [15]. These data indicate that not only the amount of energy, but
also the dietary macronutrient composition may be involved in
obesity and fat accumulation. The compositions of the diet are not
exactly the same, with putative small different amounts of micronutrients, carbohydrates and proteins in both diets. Also, probably the
species differences could be important, given that mice show higher
basal metabolic rates and physical activity than rats, which may imply
that the obesogenic effect of a high-energy isocaloric diet could be
more difficult to observe.
Our HFD diet supplied a 58% of energy from fat, of which 54% was
provided in the form of saturated fatty acids. This fact, coupled with
the low proportion of carbohydrates, may play an important role in
the development of obesity and insulin resistance. Thus, saturated
fatty acids may promote endoplasmatic reticulum stress and
hepatocyte injury resulting in hepatic dysfunction in rodents [23]. In
addition, a saturated fat intake exceeding 10% of total energy may
promote insulin resistance in humans and therefore may not be
suitable for NAFLD patients [9]. Moreover, diets rich in saturated fatty
acids induce a decrease in glucose tolerance in Zucker rats [24].
Table 2
Weight gain, food intake, respiratory quotient and energy expenditure in both
experimental pair-fed groups (C and HFD).
Weight gain (g)
Food intake at the end of the
treatment (Kcal/d)
Respiratory quotient (ratio)#
Energy expenditure (Kcal/d/bw 3/4)#
Fig. 1. Growth curve of animals during dietary treatment (69 days). All results are
expressed as mean ± SD. Control vs. HFD: *p b 0.05; **p b 0.01.
Control
HFD
T test
158.5 ± 25
75.1 ± 6.2
208.9 ± 45
76.7 ± 12.5
p b 0.01
NS
0.73 ± 0.03
116.6 ± 9.4
0.71 ± 0.02
124.5 ± 13.6
NS#
NS#
NS: not statistically significant; d: day; bw: body weight.
Data are given as mean ± standard deviation.
#
Statistical analysis of the variables identified with # were performed with the
Mann–Whitney U test for not fulfilling the conditions of normality.
276
A. Lomba et al. / Molecular Genetics and Metabolism 101 (2010) 273–278
Table 3
Serum and liver measurements in both experimental pair-fed groups (C and HFD).
Cholesterol (mmol/L)
HDL-C (mmol/L)
FFA (mmol/L)
Lactate (mmol/L)
Serum triglycerides (mmol/L)
Adiponectin (mg/mL)
Liver MDA (mM MDA/g liver)
Liver triglycerides (mmol/L)
HOMA IR
Control
HFD
T test
5.91 ± 0.42
0.66 ± 0.09
0.7 ± 0.2
1.98 ± 0.44
1.12 ± 0.23
8.84 ± 2.48
0.95 ± 0.31
2.52 ± 0.71
3.94 ± 2.57
5.53 ± 0.43
0.67 ± 0.06
0.8 ± 0.2
2.48 ± 0.99
1.00 ± 0.36
10.44 ± 1.09
1.08 ± 0.70
6.24 ± 2.82
4.53 ± 2.33
NS
NS
NS
NS
NS
p = 0.06
NS
p b 0.001
NS
NS: not statistically significant; MDA: malondialdehyde.
Data are given as mean ± standard deviation.
Several studies in humans suggested that diets low in saturated fat
and high in carbohydrates and dietary fiber significantly improve
overall health by increasing insulin sensitivity and lowering the risk of
cardiovascular disease [25]. With regard to this, when the intraperitoneal glucose overload was performed, the curve of glucose
tolerance was higher and prolonged in time in the HFD group,
which has been described by other authors in ad libitum HFD [26],
high fat sucrose [27], and HS dietary models [28]. In this context,
probably at the time of performing the intraperitoneal glucose
overload (5 weeks) the HFD group was developing an early state of
insulin resistance characterized by a lower insulin sensitivity to
compensate the glucose overloads.
A slight increase in adiponectin levels was observed in the HFD
with respect to C group. This adipokine is only expressed in mature
adipocytes [29,30] and has been widely described as an insulin
sensitizing factor with antidiabetic and antiatherogenic effects [30]. In
this sense, adiponectin expression is usually reduced in obese and
insulin-resistant rodent models, while plasma adiponectin levels have
been reported to be reduced in obese humans, particularly those with
visceral obesity [30]. However, there are reports of HFD inducing
adiponectin expression in rodent adipocytes at the early [31] or late
[32] stages of high fat feeding. It is likely that the slight increase
observed in the HFD group may be related with a compensatory
mechanism to avoid future adiponectin resistance [32].
On the other hand, although this research focuses on the study of
adipose tissue, we also measured if there was some liver damage. In
this sense, marked higher levels of liver triglycerides in the HFD group
were found, which is in agreement with studies reporting that the
consumption of one-third more calories in the form of dietary fat but
not carbohydrates produces steatosis in rats [33]. In this context,
Ahmed et al. [33] indicated that the delivery and utilization of this
extra fat by the liver in the ad libitum HFD group provides the first hit
in the development of NAFLD in Sprague–Dawley rats.
Regarding mRNA studies in white adipose tissue (WAT), the FASN
gene was significantly downregulated in the HFD group as compared
Fig. 2. Intraperitoneal glucose tolerance test performed in HFD and C groups. After
glucose administration (1 g/kg bw), the blood glucose levels were measured at 0, 15,
30, 60, and 120 min. All results are expressed as mean ± SD. Control vs. HFD: *p b 0.05;
**p b 0.01.
Fig. 3. Weight of various organs and tissues after sacrifice. Results are expressed as
mean ± SD. Control vs. HFD: *p b 0.05; ***p b 0.001.
to C. This enzyme (FASN) catalyzes the synthesis of long-chain fatty
acids from acetyl-CoA and malonyl-CoA and is one of the rate-limiting
steps in de novo lipogenesis [10]. Energy balance is physiologically
important in FASN regulation, and high-carbohydrate/low fat diets
usually upregulate it [34]. In our case, the HFD diet has the opposite
composition, being high in fat and low in carbohydrates, and therefore
FASN was downregulated.
Concerning NDUFB6, it is a subunit of the multisubunit NADH
(ubiquinone oxidoreductase complex I), that is located at the
mitochondrial inner membrane with NADH dehydrogenase and
oxidoreductase activities, being involved in transferring electrons
from NADH to the respiratory chain [35]. Dysfunctions in mitochondrial processes have been related to several pathophysiological
processes in which the cell suffers an oxidative imbalance [36].
Thus, in obesity, an overproduction of reactive oxygen species due to
mitochondrial dysfunction has been reported, as well as an association between oxidative stress and insulin resistance [37]. Thus, Ling et
al. reported that NDUFB6 expression was lower in human skeletal
muscle from diabetic subjects, being probably associated to insulin
resistance by regulating oxidative phosphorylation [38]. This finding
linked the downregulation of NDUFB6 with the development of
insulin resistance. In our case, NDUFB6 is downregulated in the
epididymal WAT of the group fed HFD diet, similarly to that observed
in previous studies conducted by our research group in rats fed a pairfed HS diet [22]. Although we have not found statistical differences in
circulating insulin levels, this hormone was slightly higher in the HFD
group. These results suggest an impairment in adipocyte mitochondrial oxidative phosphorylation that seems to be specific of rats fed
the HFD diet.
Regarding HADHB, a subunit of the mitochondrial trifunctional
protein, which catalyzes several reactions in fatty acid beta oxidation
[39], a slight downregulation in the epididymal WAT of the group fed
the HFD diet was found. This finding suggests that the capacity of this
tissue for oxidizing triglycerides is impaired, probably contributing to
the HFD diet-induced adiposity.
Also, we investigated the promoter methylation pattern of these
three genes. Apparently, this is the first study to address the
methylation pattern of FASN in relation to obesity. However, the
expression and methylation patterns of this gene have been studied as
a predictor for various tumors [40]. In these studies, variations in
Fig. 4. HADHB, FASN and NDUFB6 mRNA expression values measured by RT-PCR in
epididymal adipose tissue from control and HFD groups. All results are expressed as fold
change as compared to controls (control set at unity), and shown as mean ± SD.
Statistic analysis of the FASN mRNA levels was performed with the Mann–Whitney U
test for not fulfilling the conditions of normality (identified with #). Control vs. HFD:
#
p b 0.05; *p b 0.05.
A. Lomba et al. / Molecular Genetics and Metabolism 101 (2010) 273–278
277
Fig. 5. (A) Quantitative DNA methylation analysis obtained using the MassARRAY system, for FASN (above) and NDUFB6 (below) in epididymal adipose tissue. The results are shown
in percentages of methylation; white circles: b 6% methylation, gray circles: 6–25% methylation, medium gray circles: 25–40% methylation, dark gray circles: 40–80%, black circles:
N 80% methylation. (B) CpG sites with statistically significant differences in the two studied genes, FASN (above) and NDUFB6 (below) using the MassARRAY system. All results are
expressed as mean ± SD. C vs. HFD: * p b 0.05.
methylation levels of this gene have been associated with increased
susceptibility to different cancers [40] [41]. In relation to NDUFB6, at
this time, no study has apparently related the methylation levels of
this gene with obesity. In fact, only one work has analyzed the
methylation pattern of NDUFB6, reporting that hypermethylation in
this gene correlated with reduced expression in muscle of elderly
subjects [38]. Finally, no studies have previously tackled the study of
HADHB methylation status. So, we are the first to analyze the
epigenetic regulation of this gene in response to dietary or metabolic
factors, although no differences were found either in WAT or in liver.
Anyway, as the changes in gene expression did not apparently
correlate with the methylation levels in the investigated promoter
regions, more studies should be carried out to verify the importance of
diet-induced epigenetic mechanisms on the regulation of energy
homeostasis. Also, it should be kept in mind that the expression of the
three genes analyzed in this study is not only regulated by the DNA
methylation of their promoter regions, but also may be controlled by
other post-transcriptional mechanisms (i.e., histone covalent modifications). In summary, the main conclusion of this experiment is that
the different macronutrient distribution supplied by two isocaloric
pair-fed diets, with no differences in terms of energy intake, may play
an important role in the development of obesity and associated
diseases. The chronic intake of an isocaloric high fat diet affects the
expression of key genes regulating energy metabolism in WAT,
including lipogenesis and mitochondrial functions. The continued
consumption of a high fat diet, which can lead to obesity, is able to
modify epigenetic marks such as the DNA methylation patterns of
some of these genes.
Acknowledgments
The authors thank Línea Especial (LE/97) from the University of
Navarra (Spain) for financial support, as well as the Education
Department of the Government of Navarra and the Comunidad de
Trabajo de los Pirineos (CTP). Almudena Lomba is the recipient of a
pre-doctoral grant from Ibercaja. Also, we wish to acknowledge
Enrique Busó, from the UCIM, University of Valencia, Spain; Paúl
Cordero, for his valuable help in the design of primers; and to Chloé
Neirynck, for technical support.
References
[1] M. Sumiyoshi, M. Sakanaka, Y. Kimura, Chronic intake of high-fat and highsucrose diets differentially affects glucose intolerance in mice, J. Nutr. 136 (2006)
582–587.
[2] K.V. Axen, A. Dikeakos, A. Sclafani, High dietary fat promotes syndrome X in
nonobese rats, J. Nutr. 133 (2003) 2244–2249.
[3] L.H. Storlien, E.W. Kraegen, A.B. Jenkins, D.J. Chisholm, Effects of sucrose vs. starch
diets on in vivo insulin action, thermogenesis, and obesity in rats, Am. J. Clin. Nutr.
47 (1988) 420–427.
[4] A. Koteish, A.M. Diehl, Animal models of steatosis, Semin. Liver Dis. 21 (2001)
89–104.
278
A. Lomba et al. / Molecular Genetics and Metabolism 101 (2010) 273–278
[5] I. Abete, M.D. Parra, M.A. Zulet, J.A. Martinez, Different dietary strategies for
weight loss in obesity: role of energy and macronutrient content, Nutr. Res. Rev.
19 (2006) 5–17.
[6] M.R. Freedman, J. King, E. Kennedy, Popular diets: a scientific review, Obes. Res. 9
(Suppl 1) (2001) 1S–40S.
[7] American Diabetes Association, Evidence-based nutrition principles and recommendations for the treatment and prevention of diabetes and related complications, Diabetes Care 25 (2002) 202–212.
[8] A.E. Petro, J. Cotter, D.A. Cooper, J.C. Peters, S.J. Surwit, R.S. Surwit, Fat,
carbohydrate, and calories in the development of diabetes and obesity in the
C57BL/6J mouse, Metabolism 53 (2004) 454–457.
[9] G. Musso, R. Gambino, F. De Michieli, M. Cassader, M. Rizzetto, M. Durazzo, E. Faga, B.
Silli, G. Pagano, Dietary habits and their relations to insulin resistance and postprandial
lipemia in nonalcoholic steatohepatitis, Hepatology 37 (2003) 909–916.
[10] T. Ronti, G. Lupattelli, E. Mannarino, The endocrine function of adipose tissue: an
update, Clin. Endocrinol. (Oxf) 64 (2006) 355–365.
[11] C. Junien, P. Nathanielsz, Report on the IASO Stock Conference 2006: early and
lifelong environmental epigenomic programming of metabolic syndrome, obesity
and type II diabetes, Obes. Rev. 8 (2007) 487–502.
[12] R.L. Jirtle, M.K. Skinner, Environmental epigenomics and disease susceptibility,
Nat. Rev. Genet. 8 (2007) 253–262.
[13] J. Campion, F.I. Milagro, J.A. Martinez, Individuality and epigenetics in obesity,
Obes. Rev. 10 (2009) 383–392.
[14] F.I. Milagro, J. Campion, D.F. Garcia-Diaz, E. Goyenechea, L. Paternain, J.A.
Martinez, High fat diet-induced obesity modifies the methylation pattern of
leptin promoter in rats, J. Physiol. Biochem. 65 (2009) 1–9.
[15] V.E. de Meijer, H.D. Le, J.A. Meisel, M.R. Sharif, A. Pan, V. Nose, M. Puder, Dietary fat
intake promotes the development of hepatic steatosis independently from excess
caloric consumption in a murine model, Metabolism 59 (2010) 1092–1105.
[16] D.F. Garcia-Diaz, J. Campion, F.I. Milagro, A. Lomba, F. Marzo, J.A. Martinez, Chronic
mild stress induces variations in locomotive behavior and metabolic rates in high
fat fed rats, J. Physiol. Biochem. 63 (2007) 337–346.
[17] L.C. Pickavance, C.L. Brand, K. Wassermann, J.P. Wilding, The dual PPARalpha/
gamma agonist, ragaglitazar, improves insulin sensitivity and metabolic profile
equally with pioglitazone in diabetic and dietary obese ZDF rats, Br. J. Pharmacol.
144 (2005) 308–316.
[18] D. Garcia-Diaz, J. Campion, F.I. Milagro, J.A. Martinez, Adiposity dependent apelin
gene expression: relationships with oxidative and inflammation markers, Mol.
Cell. Biochem. 305 (2007) 87–94.
[19] A. Lomba, F.I. Milagro, D.F. Garcia-Diaz, A. Marti, J. Campion, J.A. Martinez, Obesity
induced by a pair-fed high fat sucrose diet: methylation and expression pattern of
genes related to energy homeostasis, Lipids Health Dis. 9 (2010) 60.
[20] F. Song, S. Mahmood, S. Ghosh, P. Liang, D.J. Smiraglia, H. Nagase, W.A. Held, Tissue
specific differentially methylated regions (TDMR): changes in DNA methylation
during development, Genomics 93 (2009) 130–139.
[21] N. Boqué, J. Campión, L. Paternain, D.F. García-Díaz, M. Galarraga, M.P. Portillo, F.I.
Milagro, C. Ortiz de Solórzano, J.A. Martínez, Influence of dietary macronutrient
composition on adiposity and cellularity of different fat depots in Wistar rats,
J. Physiol. Biochem. 65 (4) (2009) 387–396.
[22] A. Lomba, F.I. Milagro, D.F. Garcia-Diaz, J. Campion, F. Marzo, J.A. Martinez, A highsucrose isocaloric pair-fed model induces obesity and impairs NDUFB6 gene
function in rat adipose tissue, J. Nutrigenet Nutrigenomics 2 (2009) 267–272.
[23] D. Wang, Y. Wei, M.J. Pagliassotti, Saturated fatty acids promote endoplasmic reticulum
stress and liver injury in rats with hepatic steatosis, Endocrinology 147 (2006) 943–951.
[24] M. Beylot, C. Pinteur, O. Peroni, Expression of the adiponectin receptors AdipoR1
and AdipoR2 in lean rats and in obese Zucker rats, Metabolism 55 (2006)
396–401.
[25] J.W. Anderson, E.C. Konz, D.J. Jenkins, Health advantages and disadvantages of
weight-reducing diets: a computer analysis and critical review, J. Am. Coll. Nutr.
19 (2000) 578–590.
[26] Y. Kirino, T. Kamimoto, Y. Sato, K. Kawazoe, K. Minakuchi, Y. Nakahori, Increased
plasma dipeptidyl peptidase IV (DPP IV) activity and decreased DPP IV activity of
visceral but not subcutaneous adipose tissue in impaired glucose tolerance rats
induced by high-fat or high-sucrose diet, Biol. Pharm. Bull. 32 (2009) 463–467.
[27] A. Hattori, K. Mawatari, S. Tsuzuki, E. Yoshioka, S. Toda, M. Yoshida, S. Yasui, H.
Furukawa, M. Morishima, K. Ono, T. Ohnishi, M. Nakano, N. Harada, A. Takahashi,
Y. Nakaya, Beta-adrenergic-AMPK pathway phosphorylates acetyl-CoA carboxylase in a high-epinephrine rat model, SPORTS, Obesity (Silver Spring) 18 (2009)
48–54.
[28] M. Kergoat, D. Bailbe, B. Portha, Effect of high sucrose diet on insulin secretion and
insulin action: a study in the normal rat, Diabetologia 30 (1987) 252–258.
[29] R.S. Ahima, Metabolic actions of adipocyte hormones: focus on adiponectin,
Obesity (Silver Spring) 14 (Suppl 1) (2006) 9S–15S.
[30] T. Kadowaki, T. Yamauchi, N. Kubota, K. Hara, K. Ueki, K. Tobe, Adiponectin and
adiponectin receptors in insulin resistance, diabetes, and the metabolic syndrome,
J. Clin. Invest. 116 (2006) 1784–1792.
[31] J. Li, X. Yu, W. Pan, R.H. Unger, Gene expression profile of rat adipose tissue at the
onset of high-fat-diet obesity, Am. J. Physiol. Endocrinol. Metab. 282 (2002)
E1334–E1341.
[32] T. Stroubini, A. Perelas, C. Liapi, D. Perrea, I. Dontas, C. Tzavara, P. Galanopoulou,
Serum adiponectin and resistin in rats under three isocaloric diets: the effect of
sibutramine, Cytokine 46 (2009) 171–175.
[33] U. Ahmed, T.G. Redgrave, P.S. Oates, Effect of dietary fat to produce non-alcoholic
fatty liver in the rat, J. Gastroenterol. Hepatol. 24 (2009) 1463–1471.
[34] C.F. Semenkovich, Regulation of fatty acid synthase (FAS), Prog. Lipid Res. 36
(1997) 43–53.
[35] P.H. Willems, J.A. Smeitink, W.J. Koopman, Mitochondrial dynamics in human
NADH:ubiquinone oxidoreductase deficiency, Int. J. Biochem. Cell Biol. 41 (2009)
1773–1782.
[36] P. Cordero, A. Solomon, J.A. Martinez, Efficiency and mitochondrial metabolism:
an etiological axis for obesity? Rev. Med. Univ. Navarra 51 (2007) 13–18.
[37] J.A. Martinez, Mitochondrial oxidative stress and inflammation: an slalom to
obesity and insulin resistance, J. Physiol. Biochem. 62 (2006) 303–306.
[38] C. Ling, P. Poulsen, S. Simonsson, T. Ronn, J. Holmkvist, P. Almgren, P. Hagert, E.
Nilsson, A.G. Mabey, P. Nilsson, A. Vaag, L. Groop, Genetic and epigenetic factors
are associated with expression of respiratory chain component NDUFB6 in human
skeletal muscle, J. Clin. Invest. 117 (2007) 3427–3435.
[39] K.E. Orii, K.O. Orii, M. Souri, T. Orii, N. Kondo, T. Hashimoto, T. Aoyama, Genes for
the human mitochondrial trifunctional protein alpha- and beta-subunits are
divergently transcribed from a common promoter region, J. Biol. Chem. 274
(1999) 8077–8084.
[40] S. Ogino, T. Kawasaki, A. Ogawa, G.J. Kirkner, M. Loda, C.S. Fuchs, Fatty acid
synthase overexpression in colorectal cancer is associated with microsatellite
instability, independent of CpG island methylator phenotype, Hum. Pathol. 38
(2007) 842–849.
[41] K. Nosho, T. Kawasaki, M. Ohnishi, Y. Suemoto, G.J. Kirkner, D. Zepf, L. Yan, J.A.
Longtine, C.S. Fuchs, S. Ogino, PIK3CA mutation in colorectal cancer: relationship
with genetic and epigenetic alterations, Neoplasia 10 (2008) 534–541.