Targeted Gene Sequencing Identifies Variants in the Protein
C and Endothelial Protein C Receptor Genes in Patients
With Unprovoked Venous Thromboembolism
Cynthia Wu,* Dhruva J. Dwivedi,* Laura Pepler, Zakhar Lysov, John Waye, Jim Julian,
Karl Desch, David Ginsburg, Jeffrey I. Weitz, Clive Kearon,† Patricia C. Liaw†
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Objective—The interaction of protein C (PC) with the endothelial PC receptor (EPCR) enhances activated PC generation.
We performed targeted gene sequencing of the PC gene (PROC) and EPCR genes (PROCR) in patients with unprovoked
venous thromboembolism (VTE) to determine whether mutations that impair PC–EPCR interactions are associated with
an increased risk of VTE.
Approach and Results—We sequenced exon 3 of PROC and exons 2 and 3 of PROCR (the exons that encode the protein–
protein binding domains of PC and EPCR) in 653 patients with unprovoked VTE and in 627 healthy controls. Five single
nucleotide variants, each in individual patients, were identified that result in abnormal PC (Arg9Cys, Val34Met, and Arg1Cys) or abnormal EPCR proteins (Arg96Cys and Val170Leu). We did not detect any nonsynonymous coding variants
in the controls. When the PC variants were expressed in human embryonic kidney 293 cells, all exhibited decreased
synthesis, and 2 of the variants had reduced capacity for activated PC generation. When expressed on the surface of
human embryonic kidney 293 cells, the EPCR variants showed reduced affinity for fluorescently labeled PC. In addition,
the previously reported EPCR A3 haplotype, which promotes cellular shedding of EPCR, is over-represented in the
patient group (P=0.001).
Conclusions—This is the first targeted DNA sequencing analysis of PROC and PROCR in a large group of patients with
unprovoked VTE. Our data suggest that mutations that impair PC–EPCR interactions may be associated with an increased
risk of VTE. (Arterioscler Thromb Vasc Biol. 2013;33:2674-2681.)
Key Words: endothelial cell protein C receptor ◼ genes ◼ polymorphism, genetic ◼ protein C
◼ venous thromboembolism
T
he protein C (PC) pathway plays a major role in inhibiting blood coagulation. PC is activated on the surface of
vascular endothelial cells by the thrombin–thrombomodulin
(TM) complex. The endothelial PC receptor (EPCR), a receptor which binds circulating PC and presents it to the thrombin–TM complex, enhances PC activation by ≈8-fold in vitro1
and by ≈20-fold in vivo.2 Activated PC (APC), in conjunction
with its cofactor protein S, degrades coagulation cofactors Va
and VIIIa, thereby attenuating thrombin generation.
Hereditary thrombophilia is identified in about one third
of patients with unprovoked venous thromboembolism
(VTE).3 Most hereditary thrombophilic defects are related
to decreased levels of anticoagulant proteins (eg, deficiencies of PC, protein S, or antithrombin) or gain of function
in procoagulant factors (eg, increased levels of prothrombin, factor VIII, or other coagulation factors).4,5 Family history is a strong risk factor for VTE, suggesting that many
more patients with unprovoked VTE have as yet unidentified
genetic abnormalities that predispose them to thrombosis.
Identification of these abnormalities is important because it
enables more comprehensive counseling of patients and family members, including more vigilant use of VTE prophylaxis
in high-risk situations (eg, prolonged immobility perioperatively) and avoidance of estrogen therapy.4,5 The presence of
thrombophilia, if it were a strong predictor of recurrent VTE,
could also influence the duration of anticoagulation therapy.
PC deficiency is generally subdivided into 2 types. Type
I deficiencies are characterized by decreases in PC antigen,
Received on: June 6, 2013; final version accepted on: September 11, 2013.
From the Department of Clinical Hematology, University of Alberta, Edmonton, Alberta, Canada (C.W.); Departments of Medicine (D.J.D., J.I.W.,
C.K., P.C.L.), Department of Medical Sciences (L.P., Z.L.), Department of Pathology and Molecular Medicine (J.W.), and Oncology (J.J.), Thrombosis and
Atherosclerosis Research Institute (D.J.D., L.P., Z.L., J.I.W., P.C.L.), McMaster University, Hamilton, Ontario, Canada; and Department of Pediatrics and
Communicable Diseases, University of Michigan, Ann Arbor, Michigan (K.D., D.G.).
*These authors are joint first authors.
†These authors are joint senior authors.
The online-only Data Supplement is available with this article at http://atvb.ahajournals.org/lookup/suppl/doi:10.1161/ATVBAHA.113.302137/-/DC1.
Correspondence to Patricia C. Liaw, PhD, Thrombosis and Atherosclerosis Research Institute (TaARI), McMaster University, 237 Barton St E, Room
C5-107, Hamilton, Ontario L8L 2X2, Canada. E-mail [email protected]
© 2013 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
2674
DOI: 10.1161/ATVBAHA.113.302137
Wu et al Sequencing of PC and EPCR Genes in Patients With VTE 2675
Nonstandard Abbreviations and Acronyms
APC
EPCR
HEK
PC
SNV
TM
VTE
WT PC
activated protein C
endothelial PC receptor
human embryonic kidney
protein C
single nucleotide variant
thrombomodulin
venous thromboembolism
wild-type human PC
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
whereas type II deficiencies are characterized by abnormal
biological activity. Abnormal PC activity can be assessed by
amidolytic assays (which can detect abnormalities in the serine protease domain of PC)6 and by coagulation tests, such as
those based on the activated partial thromboplastin time. In
both the amidolytic and the clotting assays, the PC is commonly converted to APC by protac, an activator found in snake
venom.7,8 In vivo, however, the conversion of PC to APC is
accelerated by the binding of PC to EPCR on the vascular
endothelial cell surface.9 Thus, genetic mutations that impair
PC–EPCR interactions would escape detection with currently
available diagnostic assays.
PC contains a Gla domain (which contains 9 γ-carboxylated
glutamic acid residues), a connecting region, 2 EGF-like
domains, an activation peptide, and the serine protease
domain.10,11 According to the crystal structure, the majority
of PC residues contributing to EPCR binding are located on
the ω-loop of the Gla domain12 (which is encoded by exon
3 of the PC gene). EPCR consists of an α1 and α2 domain,
which forms a ligand-binding groove composed of 2 antiparallel α-helices that sit on an 8-stranded β-sheet platform.12
Mutagenesis studies of EPCR and the EPCR crystal structure
have shown that the PC-binding domain is located at the distal
end of the 2 α-helical segments12,13 (encoded by exons 2 and 3
of the EPCR gene).
We hypothesized that mutations that impair PC–EPCR
interactions may be associated with an increased risk of VTE.
To explore this possibility, we sequenced the PC gene (PROC)
and EPCR genes (PROCR) in 657 patients with unprovoked
VTE (from the Extended Low-intensity Anticoagulation for
Thrombo-embolism [ELATE] trial that compared low-intensity and conventional-intensity anticoagulation with warfarin
for the prevention of recurrent VTE)14 and in 627 controls with
no known history of VTE. We focused our DNA sequencing on
the following regions: (1) exon 3 of PROC (which encodes for
the Gla domain of PC, the region of PC that binds to EPCR),
(2) exons 2 and 3 of PROCR (which encode the PC-binding
domain of EPCR), and (3) exon 4 of PROCR (which contains
the previously reported EPCR A3 haplotype polymorphism
site). The EPCR A3 haplotype is associated with reduced
EPCR function because of increased endothelial shedding of
EPCR.15,16 This study is the first targeted DNA gene sequencing analyses of the PROC and PROCR genes in a large group
of patients with unprovoked VTE.
Materials and Methods
Materials and Methods are available in the online-only Supplement.
Results
A total of 653 warfarin-treated patients with unprovoked VTE
were included in this study (mean age, 57±15 years; 45%
women). VTE had occurred once in 27%, twice in 51%, more
than twice in 22%, and the most recent episode of VTE was
proximal deep vein thrombosis only in 66% and pulmonary
embolism (with or without deep vein thrombosis) in 34%.14
The 627 controls who never had VTE (described in the
Materials and Methods in the online-only Data Supplement)
had a mean age of 42±9 years, and 49% were women.
To analyze the EPCR-binding domain of PC, we sequenced
a 650-bp fragment of PROC that codes for the Gla domain of
PC. A list of all single nucleotide variants (SNVs) or single
nucleotide polymorphisms found in this study are summarized in Table 1 according to the Human Genome Variation
Society nomenclature.17 We found 6 SNVs in the 650-bp fragment encompassing the coding region of the Gla domain of
PC (Table 2). The first was a C to T transition at nucleotide
(nt) 2896, which results in substitution of Arg with Cys at residue −1 in the Gla domain of PC (amino acids are numbered
from the N terminus of the mature secreted protein). The second SNV was a C to T transition at nt 2923, which results in
an Arg9Cys substitution in the Gla domain of PC. The third
SNV was a G to A transition at nt 2998, which results in a
Val34Met substitution in the Gla domain of PC. The remaining SNVs were located in intron 2 (C2633G and C2730T).
None of these SNVs was present in the controls. We also
found common single nucleotide polymorphisms in intron 3
of the PC gene in both the patients and the controls.
Using stable transfections, we expressed wild-type
human PC (WT PC) and the 3 PC variants (PCArg-1Cys,
PCArg9Cys, and PCVal34Met) in human embryonic kidney
(HEK) 293 cells. All cell lines contained similar levels of PC
mRNA as assessed by the measurement of real-time polymerase chain reaction (PCR); the PCArg-1Cys, PCArg9Cys,
and PCVal34Met cell lines contained 57%, 172%, and 134%,
respectively, of mRNA relative to the WT PC cell line. The
cell lysates and conditioned medium were then subjected to
Western blot analysis. As shown in Figure 1, WT PC was
detected in the cell lysate and in the conditioned medium.
The 2 PC bands in the conditioned medium are consistent
with the α and β forms of PC, which differ in glycosylation
state at Asn329.18 In contrast, PCArg-1Cys, PCArg9Cys, and
PCVal34Met were detected at lower levels in the cell lysates
and in the conditioned medium.
To determine whether these PROC mutations result in a type
I PC deficiency, we measured PC antigen levels in 21 of the
patients with VTE (3 patients had mutations in the Gla domain
of the PROC gene and 18 did not). We also measured PC antigen levels in 6 healthy volunteers. As shown in Figure 2, the
mean PC antigen level in the VTE patients without the PROC
Gla domain mutations (3.61±0.81 µg/mL) was similar to that
in the healthy volunteers (3.88±0.19 µg/mL; P=0.19). In contrast, the mean PC antigen level in the VTE patients with the
PROC Gla domain mutations (2.52±0.15 µg/mL) was lower
than that in healthy volunteers (P<0.001) and in the VTE
patients without the PROC mutations (P=0.037). The PC antigen levels in the patients harboring the Val34Met, Arg9Cys,
and Arg-1Cys mutations were 66%, 66%, and 58% of normal
2676 Arterioscler Thromb Vasc Biol November 2013
Table 1. Human Genome Variation Society Nomenclature of Single Nucleotide Variants in PROC and PROCR
SNV or Insertion
Consequence
HGVS Designation
Consequence
Mutation Database
Exon 3
C 2896 T
Arg-1Cys
NM_000312.3:c.124C>T
p.Arg42Cys
HGMD CM930604, ProCMD
variant # 13
Exon 3
C 2923 T
Arg9Cys
NM_000312.3:c.151C>T
p.Arg51Cys
HGMD CM950976, ProCMD
variant # 18
Exon 3
G 2998 A
Val34Met
NM_000312.3:c.226G>A
p.Val76Met
HGMD CM920593, ProCMD
variant # 29
Intron 2
C 2633 G
NM_000312.3:c.70+1061C>G
NM_000312.3:c.71-210C>G
Intron 2
C 2730 T
NM_000312.3:c.70+1158C>T
NM_000312.3:c.71-113C>T
Intron 3
G 3310 A
NM_000312.3:c.237+301G>A
PROC
PROCR
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Exon 3
C 6367 T
Arg96Cys
NM_006404.3:c.337C>T
p.Arg113Cys
NCBI SNP database
rs146420040
Exon 3
G 6589 C
Val170Leu
NM_006404.3:c.559G>C
p.Val187Leu
NCBI SNP database
rs61731003
p.Phe163Phe
Silent mutation
Exon 3
C 6519 T
Phe to Phe
NM_006404.3:c.489C>T
Exon 3
23bp insertion at 6367
Insertion codes for 5 amino
acids (YPQFL) followed by a
stop codon
NM_006404.3:c.337_359insTA
TCCACAGTTCCTCTGACCATC
Intron 2
G 5212 A
NM_006404.3:c.322+77G>A
Intron 2
G 5195 A
NM_006404.3:c.322+60G>A
Intron 2
C 5334 A
NM_006404.3:c.322+199C>A
Intron 3
A 6668 T
NM_006404.3:c.601+37A>T
HGVS indicates Human Genome Variation Society; and SNV, single nucleotide variant.
levels, respectively, suggesting that these mutations result in a
heterozygous type 1 deficiency.
Given that the PROC mutations are located in the Gla
domain of PC, it is also possible that these mutations result in
a heterozygous type IIb deficiency because of impaired ability
to bind to EPCR (ie. normal amidolytic activity but reduced
APC anticoagulant activity). To explore this possibility, the
PC variants were purified from the conditioned medium of
the stable cell lines and subjected to PC activation assays. As
shown in Figure 3, the activation rate of WT PC is ≈4-fold
higher on HEK293 cells expressing EPCR and TM (gray bars)
Table 2. Summary of SNVs Identified in Exon 3, Intron 2, and
Intron 3 of PROC
SNV
No. of Patients
(n=653)
No. of Controls
(n=627)
Arg to Cys at
position −1
1
0
Exon 3
Arg9Cys
1
0
Exon 3
Val34Met
1
0
0
Location
Consequence
C 2896 T
Exon 3
C 2923 T
G 2998 A
C 2633 G
Intron 2
1
C 2730 T
Intron 2
1
0
G3310A
Intron 3
G/G 430 (65.9%)
G/G 395 (63%)
G/A 193 (30.0%)
G/A 210
(33.5%)
A/A 30 (4.6%)
A/A 22 (3.5%)
SNV indicates single nucleotide variant.
compared with that observed on HEK293 cells (white bars).
Preincubation of the cells with an anti-EPCR antibody that
blocks PC–EPCR interactions (JRK 1535; 500 nmol/L) inhibits the activation rate of WT PC on HEK293/EPCR/TM cells.
The activation rate of PCArg9Cys is similar to that of WT PC,
whereas PCArg-1Cys and PCVal34Met have impaired capacity to generate APC. Thus, patients carrying the PCArg-1Cys
and PCVal34Met mutations have a type I and a type IIb heterozygous PC deficiency.
To analyze the PC-binding domain of EPCR, we sequenced
exons 2 and 3 of PROCR, which encode for the PC-binding
domain of EPCR. PCR amplification and sequencing of exons
2 and 3 were successful in all controls and in 630 of 653 and
649 of 653 patients, respectively. No SNVs were detected in
exon 2 of PROCR in either the patients or the controls. As
shown in Table 3, we found 3 SNVs in exon 3 that occurred
in the patients but not in the controls. The first SNV was a C
to T transition at nt 6367, which results in a Arg96Cys substitution. The second SNV was a G to C transition at 6589,
which results in a Val170Leu substitution. The third SNV was
a silent mutation (C6519T). Within intron 2, we found 3 SNVs
(G5212A, G5195A, and C5334A) in the patients but not in
the controls. Within intron 3, we found a SNV (G deletion at
6738) that is present in both the patients and the controls, and
a SNV (A6668T) that is present at a higher frequency in the
patients than in the controls.
To determine whether the EPCR SNVs result in abnormal
proteins with reduced binding affinity for PC, the cDNAs of
Wu et al Sequencing of PC and EPCR Genes in Patients With VTE 2677
Figure 1. Western blot analysis of protein C (PC)
variants expressed in human embryonic kidney
(HEK) 293 cells. HEK293 cells were stably transfected with cDNAs encoding either wild-type PC
(WT PC) or PC variants (PCArg-1Cys, PCArg9Cys,
and PCVal34Met). All cell lines contained similar levels of PC mRNA as assessed by the measurement
of real-time polymerase chain reaction. The cell
lysates and conditioned medium were separated by
SDS-PAGE (4%–15% gradient gel) under reducing
conditions and subjected to Western blot analysis
with HPC4, a monoclonal antibody against human
PC. The nitrocellulose membrane was stained with
Ponceau S dye to confirm that similar amounts of
protein were loaded in each lane (sample section of
the nitrocellulose membrane is shown).
**
6
*
5
4
3
Discussion
In this study, we explored the possibility that genetic mutations
that impair PC–EPCR interactions may be associated with an
increased risk of VTE. With respect to PROC, we identified
3 SNVs, each in individual patients, that result in mutations
in the Gla domain of PC (PCArg-1Cys, PCArg9Cys, and
PCVal34Met). The most common thrombophilic defects in
the ELATE patients were Factor V Leiden, the prothrombin
G20210A gene mutation, and antithrombin deficiency, with
prevalences of 26.5% 9.3%, and 3.6%, respectively.3 It should
be noted that none of these 3 patients were carriers of the
8
7
6
*
5
4
*
3
*
2
1
2
0
1
0
Finally, we identified a 23-bp insertion in exon 3 of PROCR
in 1 control individual, but not in any of the patients with VTE
(insertion described in Table 1). Previous studies have shown
that this insertion codes for 5 amino acids (YPQFL), which
is followed by a stop codon, resulting in an abnormal EPCR
protein that lacks part of the extracellular domain, the transmembrane domain, and the cytoplasmic tail.20
Rate (mOD/min)
7
PC (µg/mL)
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
WT EPCR and the 2 EPCR variants were stably transfected
into HEK293 cells, and the ability of the EPCR variants to
bind to fluorescently labeled APC was measured by flow
cytometry. All 3 stable cell lines expressed similar levels of
EPCR on the cell surface as confirmed by flow cytometry
using an anti-EPCR antibody (JRK 1535; Figure 4). WT
EPCR bound to fluorescently labeled APC with a Kd value of
77±21 nmol/L, consistent with previous reports.13,19 In contrast, EPCR variants, Arg96Cys and Val170Leu, bound to fluorescently labeled APC with reduced affinities (Kd values ≥2
µmol/L, which is higher than the circulating concentration of
PC [≈60 nmol/L]). The binding curves obtained from the flow
cytometry studies are shown in Figure 5.
We also determined the prevalence of the previously
reported PROCR A3 haplotype.15 This haplotype results in
substitution of Ser219 with Gly in the transmembrane domain
of EPCR, which leads to increased endothelial shedding of
EPCR and reduced EPCR function.15 The PROCR A3 haplotype occurred at a significantly higher frequency in the patient
group compared with the control group (P=0.001; Table 4).
It should be noted that none of the carriers of the PROCR
A3 haplotype were carriers of the PC or EPCR coding region
SNVs described above.
Healthy
Volunteers
ELATE
Patients
ELATE Patients
with PROC mutations
Figure 2. Protein C (PC) antigen levels in healthy volunteers and
in the Extended Low-intensity Anticoagulation for Thromboembolism (ELATE) Study patients (with or without PROC Gla
domain mutations). PC antigen levels were measured in plasma
samples from 6 healthy volunteers and in 21 warfarin-treated
ELATE Study patients (3 patients had mutations in the Gla
domain of PC and 18 did not). *P<0.05; and **P<0.001.
WT PC
WT PC+
PC
PC
PC
Arg9Cys Arg-1Cys Val34Met JRK1535
Figure 3. Analysis of wild-type human protein C (WT PC) and PC
variants in PC activation assays. PC activation assays were performed as described in Materials and Methods in the online-only
Data Supplement. Gray bars, PC activation rates in the presence
of human embryonic kidney (HEK) 293 cells expressing endothelial PC receptor (EPCR) and thrombin–thrombomodulin. White
bars, PC activation rates in the presence of HEK293 cells. JRK
1535 (an antibody that inhibits the binding of PC to EPCR) was
used at a concentration of 500 nmol/L. The bars represent the
mean, and the lines above the bars reflect the SE of ≥3 determinations. *P<0.05 compared with WT PC.
2678 Arterioscler Thromb Vasc Biol November 2013
Table 3. Summary of SNVs Identified in Exon 3, Intron 2, and
Intron 3 of the PROCR
SNV
Location
Consequence
C 6367 T
Exon 3
Arg96Cys
No. of Patients No. of Controls
1
0
G 6589 C
Exon 3
Val170Leu
1
0
C 6519 T
Exon 3 Silent (Phe to Phe)
1
0
G 5212 A
Intron 2
2
0
G 5195 A
Intron 2
1
0
C 5334 A
Intron 2
2
0
A6668T
Intron 3
7
2
G deletion at 6738 Intron 3
1
1
SNV indicates single nucleotide variant.
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Factor V Leiden gene, the prothrombin gene mutations, or had
antithrombin deficiency.
All 3 PROC SNVs have been reported previously (HGMD
CM930604; HGMD CM950976; and HGMD CM920593).
In this study, we showed that the 3 PC variants displayed
reduced protein synthesis when expressed in HEK293 cells
(Figure 1), and thus are classified as type I deficiencies.
Consistent with this observation, the PC antigen levels in the
ELATE Study patients harboring the Val34Met, Arg9Cys,
and Arg-1Cys mutations are lower than those in healthy volunteers and in the ELATE Study patients without PC mutations (Figure 2). It is possible that warfarin may have reduced
PC antigen levels in the 3 patients with, and the 18 patients
without, the PROC mutations; however, the comparison of
PC antigen levels between these 2 groups, and the finding
of lower PC antigen levels in the 3 patients with the PROC
mutations, should still be valid. Interestingly, the variants
are secreted as a lower molecular weight form of ≈40 kDa
(Figure 1). PC possesses 4 N-linked glycosylation sites: 1 is
located in the first EGF domain (Asn 97), and 3 are located in
the serine protease domain (Asn248, Asn313, and Asn 329).18
α-PC, which is glycosylated at all 4 sites, accounts for ≈70%
of plasma PC. In contrast, β-PC, which lacks glycosylation
at Asn 329 and thus has a lower molecular weight, accounts
for ≈30% of plasma PC. Previous studies suggest that the
degree of glycosylation at Asn 329 is influenced by the correct post-translational processing of the Gla domain.21 Thus,
the presence of mutations within the Gla domain of the PC
variants likely favors the formation of the β-form of PC. In
patients, the presence of only the β-form of PC in plasma
results in decreased anticoagulant activity.22 Specifically, the
naturally occurring PCN329T mutation results in an abnormal
APC with impaired ability to inactivate Factor Va.
Figure 4. Binding of endothelial protein C receptor
(EPCR) variants to fluorescently labeled activated
PC (Fl-APC) and fluorescein isothiocyanate (FITC)JRK 1535 (anti-EPCR mAb). Human embryonic
kidney 293 cells stably expressing wild-type human
EPCR or EPCR variants (Arg96Cys and Val170Leu)
were incubated at room temperature with 100
nmol/L of either Fl-APC (solid line) or FITC-labeled
JRK 1535, a monoclonal antibody against human
EPCR (dotted line). Binding of these ligands to the
cells was analyzed by flow cytometry. Top, Wildtype EPCR; middle, EPCR Arg96Cys; and bottom,
EPCR Val170Leu.
Wu et al Sequencing of PC and EPCR Genes in Patients With VTE 2679
Mean Channel Fluorescence
250
200
150
100
50
0
0
100
200
300
400
500
600
[Fl-APC]
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Figure 5. Binding of fluorescently labeled activated protein
C (Fl-APC) to wild-type (WT) endothelial PC receptor (EPCR)
or EPCR variants expressed on human embryonic kidney 293
cells. The binding of Fl-APC to EPCR variants was assessed
by flow cytometry as described in Materials and Methods in
the online-only Data Supplement. The values correspond to
the mean and the SE of 3 separate experiments. White circles,
WT EPCR; gray circles, EPCR Val170Leu; and black circles,
EPCR Arg96Cys.
The PCArg-1Cys and PCArg9Cys variants, both of which
carry a free cysteine residue, have been shown to form a complex with α1-microglobulin.23 Although we did not observe
complexes between these PC variants and α1-microglobulin
based on our Western blot analysis (presumably because
HEK293 cells do not synthesize α1-microglobulin), it is possible that these complexes exist in the patient plasma.
We also observed that the PCArg-1Cys and PCVal34Met
variants (secreted and purified from HEK293 cells) have
reduced capacity to be converted to APC on the surface of TMand EPCR-expressing cells (Figure 3). This is consistent with
previous studies that showed that mutation of Arg-1 to Cys
in PC abolishes binding to EPCR.24 Thus, patients harboring
the PCArg-1Cys or PCVal34Met mutation would have a type
I and a type II heterozygous PC deficiency. Physiologically,
however, plasma levels of the PCArg-1Cys and PCVal34Met
proteins would be very low, below that of the Kd for PC–EPCR
interactions (30 nmol/L).1,25 Therefore, the PCArg-1Cys and
PCVal34Met mutations may result indirectly in a type II deficiency because of reduced plasma PC levels.
With respect to PROCR polymorphisms in the patients
with VTE, we identified 2 SNVs that result in EPCR variants
(Arg96Cys and Val170Leu). These SNVs have been reported
previously (NCBI rs146420040 and NCBI rs61731003). In
the current study, we demonstrated that introduction of either
Table 4. Frequency of the A3 Haplotype in PROCR
Non-A3
Genotype
ELATE patients 497 (77.1%)
(n=657)
Controls
(n=627)
501 (86.5%)
A3
A3
Heterozygotes Homozygotes
Total A3
Haplotype
137 (21.2%)
11 (1.7%)
148 (22.9%)*
72 (12.4%)
6 (1.0%)
80 (13.5%)
*P≤0.001for Extended Low-intensity Anticoagulation for Thrombo-embolism
(ELATE) patients compared with all controls.
the Arg96Cys or the Val170Leu mutation results in abnormal
EPCR protein with impaired ability to bind PC. Residues
Arg96 and Val170 are located near residues that form
hydrogen bonds between EPCR and Gla residues of PC.12,13
Although these EPCR variants do not bind to PC, they retain
the ability to bind to JRK 1535 (a monoclonal antibody to
EPCR), suggesting that the tertiary structure is maintained.
In baboons, pretreatment with a monoclonal antibody to
EPCR (which blocks PC binding) reduced the amount of
thrombin-induced APC generation by 88%.2 EPCR gene disruption in mice results in early embryonic lethality because
of placental thrombosis.26
Other polymorphisms in PROCR have been described. The
first reported abnormality was a 23-bp insertion in exon 3 that
leads to the production of a truncated EPCR, which does not
bind to PC.20 In the present study, we found this insertion in
one of our control subjects. However, the clinical impact of
this mutation is difficult to assess because of its low allelic
frequency.20,27–30 More recent studies have shown that soluble
EPCR levels occur with a bimodal distribution in the normal
population; ≈80% of subjects have low levels of soluble EPCR
(<180 ng/mL), whereas ≈20% have high levels (between 200
and 700 ng/mL).31,32 Analysis of PROCR revealed that the A3
haplotype is over-represented in patients with VTE compared
with the controls.15 The A3 haplotype results in a Ser to Gly
substitution in the transmembrane domain of EPCR that promotes cellular shedding of EPCR in endothelial cells.33 In
the current study, we confirmed that the EPCR A3 haplotype
occurs at a significantly higher frequency in the patient group
compared with the control group (P<0.001).
There are limitations to our study. First, the probability
of finding 5 variants in the cases, but not in the controls, is
P=0.062 (2-tailed Fischer exact test). Thus, the results of this
study should be validated in larger studies of patients with
unprovoked VTE. Second, the control population was younger
in age than the ELATE patient. However, the cases and controls do have similar ethnicity and geographical background
(predominantly whites), which may prevent false-positives
because of population stratification.
To date, no common single nucleotide polymorphisms in
the PROC and PROCR genes have been identified in genomewide association studies of VTE.34–36 The results of a discovery genome-wide association studies for VTE in 1618 VTE
cases of European origin confirmed well-known association
of the FV Leiden variant and the ABO O blood group with
VTE.34–36 Additional genome-wide significant signals at the
F11 region were associated with an increased risk of thrombosis.36 Because genome-wide association studies cannot
detect rare variants, the missing heritability for VTE risk may
be because of clusters of rare variants. Our study suggests that
rare variants in PROC and PROCR are more likely to be found
in unprovoked VTE cases than in controls. Our data support
the common disease, rare variant hypothesis that multiple
rare variants, with functional effects and relatively high penetrance, are the major contributors to genetic susceptibility
to a complex disease, such as VTE.37,38 Thus, high-throughput sequencing studies of candidate genes may emerge as a
more accurate and powerful tool to elucidate the relationship
between genetics and VTE.
2680 Arterioscler Thromb Vasc Biol November 2013
In summary, this is the first targeted DNA sequencing analysis of PROC and PROCR in a large group of patients with
unprovoked VTE. We identified 5 SNVs in the coding regions
of PROC and PROCR that are present in the patients, but not
in the controls. Expression of the mutant proteins revealed
impaired synthesis and/or reduced capacity for PC–EPCR
interactions. We also validated previous findings that the
EPCR A3 shedding haplotype is over-represented in patients
with VTE. Our data suggest that genetic mutations that impair
PC–EPCR binding interactions may increase the risk of VTE.
Acknowledgments
We thank Jenny Nguyen for technical assistance with the DNA
sequence analysis in this study. We also thank the ELATE study
investigators and the subjects who were enrolled in the ELATE study
for making this study possible.
Sources of Funding
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
This research was supported, in part, by Grant-in-Aids from the
Heart and Stroke Foundation of Ontario (NA6311 and 00050), by a
team grant from the Canadian Institutes of Health Research (MOPCTP79846) and by an AFP research grant from the Division of
Hematology and Thromboembolism at McMaster University. This
research is also supported by a grant from the National Institute of
Health, RO1 HL112642 (K.D. and D.G.).
Disclosures
None.
References
1. Stearns-Kurosawa DJ, Kurosawa S, Mollica JS, Ferrell GL, Esmon CT.
The endothelial cell protein C receptor augments protein C activation
by the thrombin-thrombomodulin complex. Proc Natl Acad Sci USA.
1996;93:10212–10216.
2. Taylor FB Jr, Peer GT, Lockhart MS, Ferrell G, Esmon CT. Endothelial
cell protein C receptor plays an important role in protein C activation in
vivo. Blood. 2001;97:1685–1688.
3. Kearon C, Julian JA, Kovacs MJ, et al; ELATE Investigators. Influence
of thrombophilia on risk of recurrent venous thromboembolism while on
warfarin: results from a randomized trial. Blood. 2008;112:4432–4436.
4. Simioni P, Tormene D, Spiezia L, Tognin G, Rossetto V, Radu C, Prandoni
P. Inherited thrombophilia and venous thromboembolism. Semin Thromb
Hemost. 2006;32:700–708.
5. De Stefano V, Rossi E, Za T, Leone G. Prophylaxis and treatment of
venous thromboembolism in individuals with inherited thrombophilia.
Semin Thromb Hemost. 2006;32:767–780.
6.Walker PA, Bauer KA, McDonagh J. A simple, automated functional
assay for protein C. Am J Clin Pathol. 1989;92:210–213.
7. Martinoli JL, Stocker K. Fast functional protein C assay using Protac, a
novel protein C activator. Thromb Res. 1986;43:253–264.
8. Gempeler-Messina PM, Volz K, Bühler B, Müller C. Protein C activators from snake venoms and their diagnostic use. Haemostasis. 2001;31:
266–272.
9. Esmon CT. The endothelial cell protein C receptor. Thromb Haemost.
2000;83:639–643.
10. Esmon CT. Protein-C: biochemistry, physiology, and clinical implications.
Blood. 1983;62:1155–1158.
11. Esmon CT. The protein C pathway. Chest. 2003;124(3 Suppl):26S–32S.
12.Oganesyan V, Oganesyan N, Terzyan S, Qu D, Dauter Z, Esmon NL,
Esmon CT. The crystal structure of the endothelial protein C receptor and
a bound phospholipid. J Biol Chem. 2002;277:24851–24854.
13. Liaw PC, Mather T, Oganesyan N, Ferrell GL, Esmon CT. Identification
of the protein C/activated protein C binding sites on the endothelial cell
protein C receptor. Implications for a novel mode of ligand recognition by
a major histocompatibility complex class 1-type receptor. J Biol Chem.
2001;276:8364–8370.
14.Kearon C, Ginsberg JS, Kovacs MJ, et al; Extended Low-Intensity
Anticoagulation for Thrombo-Embolism Investigators. Comparison of
low-intensity warfarin therapy with conventional-intensity warfarin therapy for long-term prevention of recurrent venous thromboembolism. N
Engl J Med. 2003;349:631–639.
15. Saposnik B, Reny JL, Gaussem P, Emmerich J, Aiach M, Gandrille S. A haplotype of the EPCR gene is associated with increased plasma levels of sEPCR
and is a candidate risk factor for thrombosis. Blood. 2004;103:1311–1318.
16. Qu D, Wang Y, Song Y, Esmon NL, Esmon CT. The Ser219–>Gly dimorphism of the endothelial protein C receptor contributes to the higher soluble protein levels observed in individuals with the A3 haplotype. J Thromb
Haemost. 2006;4:229–235.
17. den Dunnen JT, Antonarakis SE. Mutation nomenclature extensions and
suggestions to describe complex mutations: a discussion. Hum Mutat.
2000;15:7–12.
18.Miletich JP, Broze GJ Jr. Beta protein C is not glycosylated at asparagine 329. The rate of translation may influence the frequency of usage at
asparagine-X-cysteine sites. J Biol Chem. 1990;265:11397–11404.
19.Fukudome K, Esmon CT. Identification, cloning, and regulation of a
novel endothelial cell protein C/activated protein C receptor. J Biol Chem.
1994;269:26486–26491.
20. Biguzzi E, Merati G, Liaw PC, Bucciarelli P, Oganesyan N, Qu D, Gu JM,
Fetiveau R, Esmon CT, Mannucci PM, Faioni EM. A 23bp insertion in
the endothelial protein C receptor (EPCR) gene impairs EPCR function.
Thromb Haemost. 2001;86:945–948.
21.Grinnell BW, Walls JD, Gerlitz B. Glycosylation of human protein C
affects its secretion, processing, functional activities, and activation by
thrombin. J Biol Chem. 1991;266:9778–9785.
22.Simioni P, Kalafatis M, Millar DS, Henderson SC, Luni S, Cooper DN,
Girolami A. Compound heterozygous protein C deficiency resulting in the presence of only the beta-form of protein C in plasma. Blood. 1996;88:2101–2108.
23.Wojcik EG, Simioni P, d Berg M, Girolami A, Bertina RM. Mutations
which introduce free cysteine residues in the Gla-domain of vitamin
K dependent proteins result in the formation of complexes with alpha
1-microglobulin. Thromb Haemost. 1996;75:70–75.
24.Preston RJ, Villegas-Mendez A, Sun YH, Hermida J, Simioni P,
Philippou H, Dahlbäck B, Lane DA. Selective modulation of protein C
affinity for EPCR and phospholipids by Gla domain mutation. FEBS J.
2005;272:97–108.
25. Fukudome K, Ye X, Tsuneyoshi N, Tokunaga O, Sugawara K, Mizokami
H, Kimoto M. Activation mechanism of anticoagulant protein C in large
blood vessels involving the endothelial cell protein C receptor. J Exp Med.
1998;187:1029–1035.
26. Gu JM, Crawley JT, Ferrell G, Zhang F, Li W, Esmon NL, Esmon CT.
Disruption of the endothelial cell protein C receptor gene in mice
causes placental thrombosis and early embryonic lethality. J Biol Chem.
2002;277:43335–43343.
27. von Depka M, Czwalinna A, Eisert R, Wermes C, Scharrer I, Ganser A,
Ehrenforth S. Prevalence of a 23bp insertion in exon 3 of the endothelial
cell protein C receptor gene in venous thrombophilia. Thromb Haemost.
2001;86:1360–1362.
28. Akar N, Gökdemir R, Ozel D, Akar E. Endothelial cell protein C receptor
(EPCR) gene exon III, 23 bp insertion mutation in the Turkish pediatric
thrombotic patients. Thromb Haemost. 2002;88:1068–1069.
29. Poort SR, Vos HL, Rosendaal FR, Bertina RM. The endothelial protein C
receptor (EPCR) 23 bp insert mutation and the risk of venous thrombosis.
Thromb Haemost. 2002;88:160–162.
30. Galligan L, Livingstone W, Mynett-Johnston L, Smith OP. Prevalence of
the 23bp endothelial protein C receptor (EPCR) gene insertion in the Irish
population. Thromb Haemost. 2002;87:773–774.
31. Stearns-Kurosawa DJ, Burgin C, Parker D, Comp P, Kurosawa S. Bimodal
distribution of soluble endothelial protein C receptor levels in healthy
populations. J Thromb Haemost. 2003;1:855–856.
32. Stearns-Kurosawa DJ, Swindle K, D’Angelo A, Della Valle P, Fattorini
A, Caron N, Grimaux M, Woodhams B, Kurosawa S. Plasma levels of
endothelial protein C receptor respond to anticoagulant treatment. Blood.
2002;99:526–530.
33. Qu D, Wang Y, Esmon NL, Esmon CT. Regulated endothelial protein C
receptor shedding is mediated by tumor necrosis factor-alpha converting
enzyme/ADAM17. J Thromb Haemost. 2007;5:395–402.
34.Trégouët DA, Heath S, Saut N, Biron-Andreani C, Schved JF, Pernod
G, Galan P, Drouet L, Zelenika D, Juhan-Vague I, Alessi MC, Tiret L,
Lathrop M, Emmerich J, Morange PE. Common susceptibility alleles are
unlikely to contribute as strongly as the FV and ABO loci to VTE risk:
results from a GWAS approach. Blood. 2009;113:5298–5303.
35.Heit JA, Armasu SM, Asmann YW, Cunningham JM, Matsumoto ME,
Petterson TM, De Andrade M. A genome-wide association study of
Wu et al Sequencing of PC and EPCR Genes in Patients With VTE 2681
venous thromboembolism identifies risk variants in chromosomes 1q24.2
and 9q. J Thromb Haemost. 2012;10:1521–1531.
36.Tang W, Teichert M, Chasman DI, et al. A genome-wide association
study for venous thromboembolism: the extended cohorts for heart and
aging research in genomic epidemiology (CHARGE) consortium. Genet
Epidemiol. 2013;37:512–521.
37. Gorlov IP, Gorlova OY, Sunyaev SR, Spitz MR, Amos CI. Shifting paradigm of association studies: value of rare single-nucleotide polymorphisms. Am J Hum Genet. 2008;82:100–112.
38.Schork NJ, Murray SS, Frazer KA, Topol EJ. Common vs. rare
allele hypotheses for complex diseases. Curr Opin Genet Dev.
2009;19:212–219.
Significance
The endothelial protein C receptor (EPCR) is an important cofactor for the conversion of protein C (PC) to the anticoagulant enzyme activated
PC on the endothelial cell surface. We hypothesized that mutations that impair PC–EPCR interactions may be associated with an increased
risk of venous thromboembolism. We sequenced portions of the PROC and PROCR genes in 653 patients with unprovoked venous thromboembolism and in 627 healthy controls. Five single nucleotide variants were identified that result in abnormal PC (Arg9Cys, Val34Met, and
Arg-1Cys) or abnormal EPCR proteins (Arg96Cys and Val170Leu) in the patients. None of these single nucleotide variants were found in the
controls. Expression of these mutants in human embryonic kidney 293 cells revealed impaired synthesis and reduced capacity for PC–EPCR
interactions. In addition, the previously reported EPCR A3 haplotype, which promotes cellular shedding of EPCR, is over-represented in the
patient group. This is the first targeted DNA sequencing analysis of the PROC and PROCR genes in a large group of patients with unprovoked
venous thromboembolism. Our data suggest that mutations that impair PC–EPCR interactions may be associated with an increased risk of
venous thromboembolism.
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Targeted Gene Sequencing Identifies Variants in the Protein C and Endothelial Protein C
Receptor Genes in Patients With Unprovoked Venous Thromboembolism
Cynthia Wu, Dhruva J. Dwivedi, Laura Pepler, Zakhar Lysov, John Waye, Jim Julian, Karl
Desch, David Ginsburg, Jeffrey I. Weitz, Clive Kearon and Patricia C. Liaw
Arterioscler Thromb Vasc Biol. 2013;33:2674-2681; originally published online September 19,
2013;
doi: 10.1161/ATVBAHA.113.302137
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2013 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/33/11/2674
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2013/09/19/ATVBAHA.113.302137.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
MATERIALS AND METHODS
Patients and controls- A total of 738 predominantly white patients from 16 clinical centers were
enrolled in the ELATE trial (Extended Low-intensity Anticoagulation for Thrombo-Embolism),
which compared low-intensity and conventional-intensity anticoagulation with warfarin for the
prevention of recurrent VTE1. These were patients with one or more episodes of unprovoked
VTE who had completed at least 3 months of conventional-intensity oral anticoagulant therapy.
Unprovoked VTE was defined as objectively confirmed, symptomatic, proximal deep venous
thrombosis or pulmonary embolism that occurred in the absence of a major risk factor for
thrombosis (e.g. fracture or plaster casting of leg, or hospitalization with confinement to bed for
three consecutive days, in the 3 months before thrombosis; active cancer within the previous two
years). Of the 738 patients who were enrolled in the ELATE trial, 653 patients (88%) had
consented to provide blood samples and were included in the current study. We have previously
reported the prevalence of common thrombophilias in these patients, and the association between
these abnormalities and recurrent VTE while on anticoagulant therapy2. The ELATE trial and
the current study were approved by the institutional review boards of all participating centers,
and written consent was obtained from all subjects in accordance with the Declaration of
Helsinki.
A total of 627 control subjects with no known history of VTE were obtained from three
groups. The first group consisted of 273 young, healthy white individuals (mainly college
students) who participated in the Genes and Blood Clotting Study (GABC)3. This group had a
median age of 21 ± 3.5 years and 65% were female. 76% self-identified as white while 8.8%
were of Asian ancestry, 5.5% were African American and 5.2% were Spanish, Hispanic or
Latino.
The second group consisted of 288 white individuals referred for hereditary
hemochromatosis (HFE gene) testing. The mean age in the second group was 59 ± 12 years and
44% were female.
Of these, HFE testing was positive in 17% (to our knowledge,
hemochromatosis is not known to be associated with VTE). The third group consisted of 66
white individuals from Hamilton, Ontario, Canada (mainly graduate students and laboratory
technicians) with a mean age of 45 ± 11 yrs and 39% were female.
DNA sequence analyses of PROC and PROCR- Blood was collected from patients and controls
by venipuncture into vacutainer tubes containing 0.105 M trisodium citrate pH 5.4 (1 vol/9 vol
blood). Genomic DNA was extracted from white blood cells using the QIAamp DNA Blood
Minikit (Qiagen Inc., Valencia, CA). The primers used to PCR amplify the 650 bp fragment
encompassing the coding region for the PC Gla domain are as follows: 5’ TAG AAA GGT
AAA GAC ACT GGC 3’ and 5’ GAA GCA GGG TGG TCT TTA GGT 3’. To study the PC
binding domain of EPCR, we PCR amplified portions of exons 2 and 3 of PROCR. The primers
for EPCR exon 2 are: 5’ CAG CGT CAA ACG GGA GAA GC 3’ and 5’ AGA GGT TAT GCC
AGC AGG ACG 3’. The primers for EPCR exon 3 are: 5’ CTC TCC TCA CAG CAC TGA
CTC 3’ and 5’ CCT TGC CAG CCT CCA TCA ATC 3’. The exon 3 primers also allowed us to
amplify a portion of exon 4 which contains the PROCR A3 haplotype polymorphism site. The
PCR amplification products were analyzed on an ABI Prism 3700 sequencer (MOBIX
Sequencing Core Facilities, McMaster University).
Mutagenesis of PC and EPCR genes- Human EPCR cDNA4 was cloned as a XhoI/NotI
fragment into the multiple cloning site of the eukaryotic expression vector pcDNA3.1(-)
(Invitrogen, San Diego, CA). Human protein C cDNA was cloned as a HindIII/Xba1 fragment
into the multiple cloning site of pcDNA3.1(+) (kindly provided by Dr. Alireza Rezaie, Dept. of
Biochemistry, St. Louis University). In vitro mutagenesis to generate and select point mutations
was performed using the QuickChange site-directed mutagenesis system as described by the
supplier (Stratagene, La Jolla, CA). Double-stranded DNA sequencing was used to verify the
authenticity of the mutations.
Stable expression of variant forms of PC or EPCR in HEK293 cells- PC or EPCR variants
were stably transfected and expressed in HEK293 cells as previously described5. Transfection of
HEK293 cells with the cDNA of PC variants (PCArg-1Cys, PCArg9Cys, PCVal34Met) was
performed in 10-cm dishes using the Effectene transfection reagent as described by the supplier
(Qiagen).
The cells were grown in Dulbecco’s modified Eagle’s Medium (DMEM) (Life
Technologies Inc., Burlington, ON) supplemented with 10% fetal bovine serum (FBS) (Life
Technologies Inc.) and 5 µg/ml vitamin K1 (Sigma-Aldrich, St. Louis, MO).
48 h post-
transfection, the medium was changed to DMEM containing 10% FBS, 5 µg/ml vitamin K1, and
400 µg/ml G418 (Life Technologies Inc.). After 2 to 3 weeks of drug selection in which the
medium was changed every day, drug-resistant colonies were isolated.
Purification of PC variants stably expressed in HEK293 cells- Stable cell lines expressing the
PC variants were grown in 24 x 24 cm dishes containing DMEM, 10% FBS, 1 mg/ml G418,
penicillin (100 U/ml)-streptomycin (100 µg/ml), and 5 µg/ml vitamin K until 80% confluency.
The cells were washed 3 times with PBS and grown for 48 hr in serum-free DMEM containing
G418, penn-strep, and vitamin K.
The PC variants were purified by immunoaffinity
chromatography using the Ca2+-dependent anti-human PC monoclonal antibody (HPC4) linked
to Affigel-10 (Biorad) as previously described6.
Real-time PCR quantitation of PROC and β-actin mRNA levels- Total RNA was extracted
from HEK293 stable cell lines expressing WT PROC or PROC variants using the RNeasy Mini
Mammalian Total RNA kit (Qiagen, Mississauga, ON) as per manufacturer’s instructions. The
synthesis of cDNA was performed using the SuperScript III First Strand Synthesis System for
RT-PCR with random hexamer primers (Invitrogen) according to the manufacturer’s protocol.
Real-time PCR analysis of PROC and β-actin mRNA was performed using SYBR GreenER
qPCR Supermix (Applied Biosystems) as per manufacturer’s instructions using the Step One
Plus machine (Applied Biosystems). Specific primers were used to amplify PROC and β-actin
mRNA (McMaster University MOBIX Laboratory). The primer sequences are as follows:
PROC Forward: 5’-TAGAAAGGTAAAGACACTGGC-3’
PROC Reverse: 5’-GAAGCAGGGTGGTCTTTAGGT-3’
β-actin Forward: 5’-ACC GAG CGC GGC TAC AG -3’
β-actin Reverse: 5’-CTT AAT GTG ACG CAC GAT TTC C -3’
PC ELISA- Venous blood (4.5 mL) was drawn via venipuncture from patients or control
subjects into vacutainer tubes containing 0.5 mL 0.105 M buffered trisodium citrate (pH 5.4).
The blood was spun at 1500x g for 10 minutes at 20°C, and the plasma was stored as aliquots at 80°C.
PC antigen in the plasma samples were quantified by a sandwich-type enzyme
immunoassay (Affinity Biologicals, Ancaster, ON, Canada). The capturing antibody is a Ca2+independent monoclonal antibody (Product # PC-EIA).
PC activation assays- Protein C activation assays were performed using HEK293 cells stably
expressing EPCR and TM as previously described7. Briefly, the cells were washed 3 times with
phosphate-buffered saline. The cells were preincubated for 5 min at room temperature with 0.5
ml of HBSS containing 25 mM Hepes, pH 7.5, 0.1% bovine serum albumin, 3 mM CaCl2, and
0.6 mM MgCl2 before the addition of 100 nM WT PC or the PC variants (PCArg-1Cys,
PCArg9Cys, PCVal34Met). PC activation was initiated by the addition of 10 nM thrombin. In
some cases, 500 nM anti-EPCR mAb JRK 1535 was added before the addition of WT PC and
preincubated with the cells for 10 min at room temperature. After 30 min at 37 °C, 100 ml of the
reactions were stopped by the addition of 20 ml of 1.66 mg/ml antithrombin containing 20 mM
EDTA. 50 µL of the supernatant was transferred into a 96-well microplate, and amidolytic
activities of APC were determined toward 0.2 mM Spectrozyme PCa substrate in 20 mm TrisHCl, pH 7.5, 150 mM NaCl. The rates of substrate cleavage were measured in a Vmax
microplate reader (Molecular Devices) and were linear over time. All determinations were
performed in triplicate.
Western Blot Analysis of PC variants expressed in HEK293 cells—HEK293 cells stably
transfected with the cDNAs encoding the PC variants were grown in 10 cm dishes and serum
starved for 48 hours. The cells were lysed in 5 ml of phosphate-buffered saline containing 1%
Triton X-100 at room temperature for 10 min. The levels of PC variants in the cell lysates and
conditioned medium were analyzed by electrophoresis and immunoblotting. Electrophoresis was
performed under reducing conditions according to the method of Laemmli8 using 4-15% SDSpolyacrylamide gels. Immunoblotting was performed using HPC4, a Ca2+-dependent anti-human
PC monoclonal antibody (kindly provided by Dr. Charles Esmon, Oklahoma Medical Research
Foundation).
Flow Cytometric Analysis of Fl-APC Binding to EPCR Mutants- APC was labeled at the
active site with fluorescein (Fl-APC) as previously described7. HEK293 cells stably transfected
with EPCR variants were grown to confluence in T-75 flasks, detached with gentle pipetting, and
suspended in 3 ml of complete HBSS buffer (HBSS containing 25nM HEPES pH 7.5, 3 mM
CaCl2, 0.6 mM MgCl2, 1% bovine serum albumin). The cells were diluted 1:20 in complete
HBSS buffer and incubated with increasing concentrations of Fl-APC at 4 °C for 15 min in the
dark. Bound Fl-APC was detected on the fluorescence-1 channel on a FACSCalibur flow
cytometer (Becton Dickinson). The fluorescence intensity of each sample was analyzed twice.
Values for Kd were determined by fitting binding isotherms with a hyperbolic equation using the
TableCurve program (Jandel Scientific, San Rafael, CA).
REFERENCES FOR MATERIALS AND METHODS
(1) Kearon C, Ginsberg JS, Kovacs MJ et al. Comparison of low-intensity warfarin therapy
with conventional-intensity warfarin therapy for long-term prevention of recurrent venous
thromboembolism. N Engl J Med. 2003;349:631-639.
(2) Kearon C, Julian JA, Kovacs MJ et al. Influence of thrombophilia on risk of recurrent
venous thromboembolism while on warfarin: results from a randomized trial. Blood.
2008;112:4432-4436.
(3) Desch KC, Ozel AB, Siemieniak D et al. Linkage analysis identifies a locus for plasma von
Willebrand factor undetected by genome-wide association. Proc Natl Acad Sci U S A.
2013;110:588-593.
(4) Fukudome K, Esmon CT. Identification, cloning, and regulation of a novel endothelial cell
protein C/activated protein C receptor. J Biol Chem. 1994;269:26486-26491.
(5) Rezaie AR, Esmon CT. The function of calcium in protein C activation by thrombin and
the thrombin-thrombomodulin complex can be distinguished by mutational analysis of
protein C derivatives. J Biol Chem. 1992;267:26104-26109.
(6) Esmon CT, Esmon NL, Le Bonniec BF, Johnson AE. Protein C activation. Methods
Enzymol. 1993;222:359-385.
(7) Liaw PC, Mather T, Oganesyan N, Ferrell GL, Esmon CT. Identification of the protein
C/activated protein C binding sites on the endothelial cell protein C receptor. Implications
for a novel mode of ligand recognition by a major histocompatibility complex class 1- type
receptor. J Biol Chem. 2001;276:8364-8370.
(8) Laemmli UK. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature. 1970;227:680-685.