Journal
of General Virology (1997), 78, 2747–2750. Printed in Great Britain
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .SHORT
.
COMMUNICATION
Hepatitis C virus negative strand RNA is not detected in
peripheral blood mononuclear cells and viral sequences are
identical to those in serum : a case against extrahepatic
replication
Tomasz Laskus,1 Marek Radkowski,2 Lian-Fu Wang,1 Janusz Cianciara,2, 4 Hugo Vargas3
and Jorge Rakela1, 3
1, 3
Division of Transplantation Medicine, Thomas E. Starzl Transplantation Institute, University of Pittsburgh, Lhormer Bldg 3011, and
Division of Gastroenterology and Hepatology3, University of Pittsburgh Medical Center, 200 Lothrop Street, Pittsburgh, PA 15213, USA
2, 4
Institute of Infectious Diseases2 and Municipal Hospital for Infectious Diseases4, Wolska 37, 01-201 Warsaw, Poland
Peripheral blood mononuclear cells (PBMCs) from
27 hepatitis C virus (HCV)-infected patients were
analysed for the presence of HCV negative strand
RNA with strand-specific Tth-based RT–PCR. No
negative strand RNA was detected in any sample,
and positive strand HCV sequences amplified from
PBMCs were identical to those found in serum.
These findings suggest that HCV does not replicate
in PBMCs, and the presence of HCV sequences at
this site is compatible with passive virus adsorption
and/or contamination by circulating virus.
The existence of extrahepatic reservoirs of hepatitis C virus
(HCV) replication remains controversial. Several groups have
described the detection of HCV negative strand, a viral
replicative intermediate, in peripheral blood mononuclear cells
(PBMCs) (Wang et al., 1992 ; Muller et al., 1993 ; Gabrielli et al.,
1994 ; Saleh et al., 1994), and it has been reported that a human
T-cell line is capable of supporting a productive infection
(Shimizu et al., 1993). However, the strand specificity of
RT–PCR, which is currently the only suitable method for the
detection of HCV RNA, has recently been questioned : this
assay has been demonstrated to be prone to false priming of
the incorrect strand or to self-priming related to RNA
secondary structures (Lanford et al., 1994).
Several methods of avoiding the mispriming events have
been proposed : tagged PCR (Lanford et al., 1994) ; using
primers specific for a region devoid of strong secondary
structures (Lerat et al., 1996) ; or conducting cDNA synthesis at
high temperature with the thermostable enzyme Tth (Lanford
Author for correspondence : Tomasz Laskus.
Fax ­1 412 647 9672.
et al., 1994, 1995). In the current study the latter technique was
employed for an extensive search for HCV RNA negative
strand in PBMCs from patients with chronic hepatitis C.
Synthetic RNA was used to optimize the sensitivity and
strand-specificity of the assays. Furthermore, HCV sequences
amplified from PBMCs were compared with those amplified
from serum, assuming that in the presence of passive virus
adsorption and}or contamination of these cells by circulating
viral RNA the amplified sequences should be identical, while in
the presence of independent replication they might be different.
The sequences were compared by single strand conformation
polymorphism (SSCP), as well as by direct sequencing.
Twenty-seven patients with chronic hepatitis C were
subjects of the study. None of the patients had received any
antiviral therapy prior to the study, and none had serological
evidence of hepatitis B virus or HIV infection. PBMCs were
isolated by Ficoll–Hypaque (Pharmacia) density-gradient centrifugation, washed three times with PBS pH 7±4, and stored
frozen at ®80 °C until use. RNA was extracted from 5¬10'
cells or 100 µl serum by means of a modified guanidinium
thiocyanate–phenol–chloroform technique using a commercially available kit (RNAzol B ; Biotecx Laboratories) and finally
dissolved in 20 µl water ; 10 µl of this RNA solution was
reverse transcribed as further described.
To generate synthetic positive and negative HCV RNA
strands, PCR products encompassing the 5« untranslated region
were cloned into a plasmid vector (pGEM-3Z ; Promega) and,
after plasmid linearization, transcribed with T7 polymerase
(Riboprobe Transcription System, Promega). The orientation
of the insert was checked by direct sequencing of the plasmid.
The template was removed by digestion with DNase I (1 U}µg
DNA for 60 min at 37 °C), and the absence of significant
amounts of residual DNA was ascertained by routine inclusion
of control PCR without the RT step.
Two different RT–PCR assays, one employing MMLV-RT
and the other employing Tth, were used. For the MMLV-based
0001-4871# 1997 SGM
CHEH
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 16:23:57
T. Laskus and others
Fig. 1. Sensitivity and specificity of RT–PCR using MMLV-RT and Tth. Synthetic positive and negative strands were generated
by in vitro run-off transcription with T7 RNA polymerase from a vector (pGEM-3Z) containing the 5« untranslated sequence of
HCV and serially diluted in water. The number of target template copies was calculated from absorbance readings and gel
electrophoresis. A positive-sense primer was present during cDNA synthesis, after which the enzyme was inactivated either by
heating for 10 min at 99 °C (MMLV) or chelating with Mn2+ (Tth) and then negative-sense primer was added. Samples were
amplified for 50 cycles using Taq polymerase (MMLV-based assay) or Tth (Tth-based assay) as described in the text. A 20 µl
volume (20 %) of the reaction was fractionated on a 2±5 % agarose gel, transferred to nylon membrane by Southern blotting
and subsequently hybridized to a 32P-labelled probe internal to the amplification primers. Significant strand specificity could be
demonstrated for Tth-based RT–PCR, but not for MMLV-based assay. When 1 µg of total cellular RNA extracted from normal
human livers was added, the sensitivity of the reactions was lowered by no more than one log.
detection of negative strand, extracted RNA was incubated for
20 min at 42 °C in a 30 µl reaction containing 50 pM of the
positive-sense primer (5« A}GAC}TCACTCCCCTGTGAGGAAC 3« ; nt 35–55), 1¬ RT buffer (Gibco), 5 mM DTT,
5 mM MgCl , 1 mM dNTP, 20 U RNase inhibitor (RNasin,
#
Promega) and 20 U MMLV RT (Gibco). After heating to 99 °C
for 10 min, 50 pM of the negative-sense primer (5« TGA}
GTGCACGGTCTACGAGACCTC 3« ; nt 342–320), 7 µl of
10¬ PCR buffer II (Perkin Elmer) and 2±5 U Taq DNA
polymerase (Perkin Elmer) were added and the volume was
adjusted to 100 µl. For the detection of positive strand, the
primers were added in reverse order. Amplification was run in
DNA Thermal Cycler 480 (Perkin Elmer) as follows : initial
denaturing at 94 °C for 4 min followed by 50 cycles of 94 °C
for 1 min, 58 °C for 1 min and a final extension at 72 °C for 7
min. The final product (20 µl) was analysed by agarose gel
electrophoresis and Southern hybridization with a $#P-labelled
internal oligoprobe (5« ACTGTCTTCACGCAGAAAGCGTC
3« ; nt 57–79).
For Tth-based RT–PCR, the cDNA was generated in a 20 µl
reaction mixture containing 50 pM of sense primer, 1¬ RT
buffer (Perkin Elmer), 1 mM MnCl , and 200 µM (each) dNTP
#
and 5 U Tth (Perkin Elmer). After 20 min at 65 °C, Mn#+ was
chelated with 8 µl of 10¬ EGTA chelating buffer (Perkin
Elmer). 50 pM of antisense primer was added and the volume
adjusted to 100 µl, and MgCl concentration was adjusted to
#
2±2 mM. The amplification was performed in a Perkin Elmer
GenAmp PCR System 9600 thermocycler as follows : initial
denaturing for 1 min at 94 °C, 50 cycles of 94 °C for 15 s,
58 °C for 30 s and 72 °C for 30 s followed by a final extension
CHEI
at 72 °C for 7 min. PCR products were analysed as described
above.
For amplification of the NS5 region, the primers were 5«
GGCGGAATTCCTGGTCATAGCCTCCGTGAA 3« (nt
8645–8616 ; antisense) and 5« TGGGGATCCCGTATGATACCCGCTGCTTTGA 3« (nt 8245–8275 ; sense) and the
probe was 5« CTCAACCGTCACTGAGAGAGACAT 3« (nt
8276–8299). To increase the specificity and sensitivity of our
assays, wax beads (Ampliwax, Perkin Elmer) were routinely
employed for hot start of all PCR after the RT step.
The results of the analysis of the serial dilution of synthetic
RNA are presented in Fig. 1. The MMLV RT–PCR assay for
negative strand was capable of detecting 10 equivalent
genomic molecules (Eq) of the respective template. However,
when using the same protocol, a positive signal was observed
in the presence of & 10$ Eq, and occasionally even in the
presence of & 10 Eq, of the positive strand. Use of Tth at the
70 °C RT step increased the specificity of RT–PCR by seven
logs since the incorrect strand was now detected only at 10"!
Eq ; however it also lowered sensitivity 100-fold. Since this loss
of sensitivity could have been partly related to the high
temperature of the RT step, the experiments were repeated
with the RT step conducted at 65 °C. This increased the
sensitivity of the assay 10-fold, but simultaneously lowered
the specificity 100-fold. These temperature-dependent changes
suggest that the loss of strand specificity at high concentrations
of incorrect template is not due to trace contamination by
transcriptional vector DNA, but rather reflects persistent
incorrect priming. To mimic the conditions encountered in
amplification of biological samples, 1 µg RNA extracted from
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 16:23:57
Extrahepatic HCV replication
Fig. 2. Lack of detection of HCV RNA negative strand in PBMCs from an HCV infected patient. Tenfold serial dilutions of
extracted RNA were tested for the presence of positive and negative HCV RNA strands using MMLV-RT-based and Tth-based
RT–PCR, as described in the text. Both positive and negative HCV RNA strands were detected by the MMLV assay ; however,
only positive strands were detected by the Tth-based strand-specific assay. The amount of RNA loaded into reaction at dilution
10−0 corresponds to 2±5¬106 cells. Negative controls (lane N) consisted of RNA extracted from PBMCs from uninfected
subjects, and positive/sensitivity controls (lane P) consisted of end-point dilutions of the correct synthetic strand (10 Eq for
MMLV assay and 100 Eq for the Tth assay).
uninfected human liver was added into each reaction. This
lowered the sensitivity of the assays by no more than one log
(not shown). The sensitivity of our assays for the detection of
the positive strand was identical to that for the detection of the
negative strand.
The sensitivity and specificity of the Tth protocol was even
higher than that described by Lanford et al. (1994), probably
reflecting such factors as the simplified hot start procedure with
wax beads, and the short ramp times achievable in the Perkin
Elmer GenAmp PCR System 9600 which are likely to lower
nonspecific amplification and increase sensitivity.
During optimization of the MMLV-RT-based assay, we
found that hot start of the PCR step increased sensitivity
10$–10% times (not shown). This effect was probably related to
the strong secondary structure of the template in the 5« untranslated region, as it was not observed using RNA templates
devoid of hairpin structures (unpublished observations).
Tth assays with primers specific for the NS5 region were
not analysed as rigorously for sensitivity and strand specificity
with synthetic RNA. However, when tested on serial dilutions
of two positive liver samples, they were no more than one log
less sensitive in the detection of positive and negative strands
than assays for the 5« untranslated region (not shown).
Taking into account the results of the initial experiments
with synthetic template, only Tth-based assay (RT at 65 °C)
was used for HCV negative strand search. This assay seemed
to be a good compromise between sensitivity and strand
specificity. All RT–PCR runs included positive controls
consisting of end-point dilutions of respective RNA strands ;
negative controls included normal PBMCs and normal sera.
PBMCs and sera from all 27 patients were negative for the
presence of the minus strand when tested with Tth-based
assays in both 5« noncoding and NS5 regions. The positive
strand was detected by MMLV assay in 17 and 12 PBMC
samples and in 27 and 20 serum samples in the 5« untranslated
and NS5 regions, respectively. Positive strand titres, which
were calculated by assuming that the end-point 10-fold serial
dilution contains 10 Eq, ranged from 10"–10& Eq per reaction
for serum (mean 10%±#) and 10" to 10' Eq per reaction for
PBMCs (mean 10&±"). Thus, if negative strand were present in
PBMCs it would have to be present at 10& lower levels than
positive strand, at least in those PBMCs with the highest virus
titres. A representative presence of high titre HCV RNA
positive strand and lack of evidence for the presence of the
negative strand are shown in Fig. 2.
To determine the proportion between the positive and
negative strands in liver cells, two explant livers from HCV
infected transplant recipients were studied. By testing of liver
RNA dilutions with the Tth-based assay, the titre of the
positive strand was determined to be 10& and 10'}1 µg RNA
while the titre of the negative strand was 10% and 10&}1 µg
RNA, respectively. The titres were calculated assuming that
the end-point 10-fold serial dilution contains 10# Eq.
Considering the strand specificity of our assays as determined on synthetic RNA, it is not surprising that false
positive detection of the negative strand was not encountered.
Nonspecific detection of the incorrect strand might be expected
when the latter is present at high numbers, at least 10) Eq per
reaction, which was not encountered in the samples studied.
Twelve patients were positive for positive strand HCV
RNA in both serum and PBMCs with primers specific for the
NS5 region. Since this part of the viral genome is considerably
more variable than the 5« untranslated region, we considered it
appropriate for comparison of amplified sequences. It was
assumed that in the presence of passive virus adsorption
and}or contamination of the PBMCs by circulating viral RNA,
the amplified sequences would be identical to those in serum,
while in the presence of independent replication they might be
different. The sequences were compared by SSCP, which is
appropriate for the detection of minor sequence differences, as
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 16:23:57
CHEJ
T. Laskus and others
virus. Taking into consideration the efficiency of the techniques
employed, any existing virus replication in PBMCs would
have to be extremely low to elude detection.
References
Cabot, B., Esteban, J. I., Martell, M., Genesca, J., Vargas, V., Esteban,
R., Guardia, J. & Gomez, J. (1997). Structure of replicating hepatitis C
virus (HCV) quasispecies in the liver may not be reflected by analysis of
circulating HCV virions. Journal of Virology 71, 1732–1734.
Gabrielli, A., Manzin, A., Candela, M., Caniglia, M. L., Paolucci, S.,
Danieli, M. G. & Clementi, M. (1994). Active hepatitis C virus infection
in bone marrow and peripheral blood mononuclear cells from patients
with mixed cryoglobulinaemia. Clinical and Experimental Immunology 97,
87–93.
Lanford, R. E., Sureau, C., Jacob, J. R., White, R. & Fuerst, T. R. (1994).
Fig. 3. Analysis by SSCP of HCV sequences, amplified by RT–PCR, from
PBMCs and serum from 12 patients with chronic hepatitis C. Lanes A and
B represent viral sequences from PBMCs and serum, respectively. All
patients show identical band patterns for PBMCs and serum ; the presence
of identical viral sequences was verified by direct sequencing.
well as by direct sequencing. We were encouraged by results
of our earlier study on HBV infection, in which differences
were detected between viral sequences from serum and PBMCs
(Laskus et al., 1997), and by a recently published work
documenting discrepancies between the replicating and circulating HCV quasispecies (Cabot et al., 1997).
For SSCP analysis, 0±1 µg of purified PCR product from the
NS5 region was subjected to non-denaturing PAGE in 1¬
Tris–borate–EDTA buffer and the bands were visualized with
silver staining as described (Laskus et al., 1996).
As illustrated in Fig. 3, SSCP analysis of PCR products
revealed the presence of indistinguishable band patterns from
PBMCs and serum, compatible with the presence of identical
viral sequences. The presence of identical viral sequences was
subsequently verified by direct sequencing as described
elsewhere (Laskus et al., 1996). Based on the sequence of the
NS5 region, all genotypes were assigned to subtype 1b
(Simmonds et al., 1993).
The existence of extrahepatic sites of HCV replication
would have broad implications for antiviral treatment and liver
transplantation. The presence of independent replication in
PBMCs has recently been questioned by Lanford et al. (1995),
who did not detect negative strand viral RNA when employing
strand-specific RT–PCR. Our study, done on a large scale and
employing very sensitive and highly specific assays, corroborates and extends these findings by showing that HCV
sequences amplified from PBMCs are identical to those found
in serum, which is compatible with passive virus adsorption on
the cell and}or contamination of cell samples with circulating
CHFA
Demonstration of in vitro infection of chimpanzee hepatocytes with
hepatitis C virus using strand-specific RT}PCR. Virology 202, 606–614.
Lanford, R. E., Chavez, D., Chisari, F. V. & Sureau, C. (1995). Lack of
detection of negative-strand hepatitis C virus RNA in peripheral blood
mononuclear cells and other extrahepatic tissues by the highly strandspecific rTth reverse transcriptase PCR. Journal of Virology 69, 8079–8083.
Laskus, T., Wang, L. F., Rakela, J., Demetris, A. S., Vargas, H., Pinna,
A. D., Tsamandas, A. C. & Fung, J. (1996). Dynamic behavior of
hepatitis C virus in chronically infected patients receiving liver graft from
infected donors. Virology 220, 171–176.
Laskus, T., Wang, L. F., Radkowski, M., Vargas, H., Cianciara, J.,
Poutous, A. & Rakela, J. (1997). Comparison of hepatitis B virus core
promoter sequences in peripheral blood mononuclear cells and serum
from patients with hepatitis B. Journal of General Virology 78, 649–653.
Lerat, H., Berby, F., Trabaud, M.-N., Vidalin, O., Major, M., Trepo, C.
& Inchauspe, G. (1996). Specific detection of hepatitis C virus minus
strand RNA in hematopoietic cells. Journal of Clinical Investigation 97,
845–851.
Muller, H. M., Pfaff, E., Goeser, T., Kallinowski, B., Solbach, C. &
Theilmann, L. (1993). Peripheral blood leukocytes serve as a possible
extrahepatic site for hepatitis C virus replication. Journal of General
Virology 74, 669–76.
Saleh, M. G., Tibbs, C. J., Koskinas, J., Pereira, L. M. M. B., Bomford, A.
B., Portmann, B. C., McFarlane, I. G. & Williams, R. G. (1994). Hepatic
and extrahepatic hepatitis C virus replication in relation to response to
interferon therapy. Hepatology 20, 1399–1404.
Shimizu, Y. K., Purcell, R. H. & Yoshikura, H. (1993). Correlation
between the infectivity of hepatitis C virus in vivo and its infectivity in
vitro. Proceedings of the National Academy of Sciences, USA 90, 6037–6041.
Simmonds, P., Holmes, E. C., Cha, T. A., Chan, S. W., McOmish, F.,
Irvine, B., Beall, E., Yap, P. L., Kolberg, J. & Urdea, M. S. (1993).
Classification of hepatitis C virus into six major genotypes and a series of
subtypes by phylogenetic analysis of the NS5 region. Journal of General
Virology 74, 2391–2399.
Wang, J. T., Sheu, J.-C., Lin, J.-T., Wang, T.-H. & Chen, D. S. (1992).
Detection of replicative form of hepatitis C virus RNA in peripheral
blood mononuclear cells. Journal of Infectious Diseases 166, 1167–1169.
Received 10 April 1997 ; Accepted 24 June 1997
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 16:23:57