Veterinary Immunology and Immunopathology 115 (2007) 146–154
www.elsevier.com/locate/vetimm
Cloning, sequencing and expression of white rhinoceros
(Ceratotherium simum) interferon-gamma (IFN-g) and
the production of rhinoceros IFN-g specific antibodies
D. Morar a,*, E. Tijhaar b, A. Negrea b, J. Hendriks b, D. van Haarlem b,
J. Godfroid a, A.L. Michel c, V.P.M.G. Rutten b
a
Department of Veterinary Tropical Diseases, University of Pretoria, Private Bag X04, Onderstepoort 0110, South Africa
Department of Infectious Diseases and Immunology, Utrecht University, Yalelaan 1, 3584 CL Utrecht, The Netherlands
c
TB Laboratory, Onderstepoort Veterinary Institute, Private Bag X05, Onderstepoort 0110, South Africa
b
Received 28 July 2006; received in revised form 16 October 2006; accepted 19 October 2006
Abstract
Bovine tuberculosis (BTB) is endemic in African buffalo (Syncerus caffer) in the Kruger National Park (KNP). In addition to
buffalo, Mycobacterium bovis has been found in at least 14 other mammalian species in South Africa, including kudu (Tragelaphus
strepsiceros), Chacma baboon (Papio ursinus) and lion (Panthera leo). This has raised concern about the spillover into other
potentially susceptible species like rhinoceros, thus jeopardising breeding and relocation projects aiming at the conservation of
biodiversity. Hence, procedures to screen for and diagnose BTB in black rhinoceros (Diceros bicornis) and white rhinoceros
(Ceratotherium simum) need to be in place. The Interferon-gamma (IFN-g) assay is used as a routine diagnostic tool to determine
infection of cattle and recently African buffalo, with M. bovis and other mycobacteria. The aim of the present work was to develop
reagents to set up a rhinoceros IFN-g (RhIFN-g) assay. The white rhinoceros IFN-g gene was cloned, sequenced and expressed as a
mature protein. Amino acid (aa) sequence analysis revealed that RhIFN-g shares a homology of 90% with equine IFN-g.
Monoclonal antibodies, as well as polyclonal chicken antibodies (Yolk Immunoglobulin-IgY) with specificity for recombinant
RhIFN-g were produced. Using the monoclonals as capture antibodies and the polyclonal IgY for detection, it was shown that
recombinant as well as native white rhinoceros IFN-g was recognised. This preliminary IFN-g enzyme-linked immunosorbent
assay (ELISA), has the potential to be developed into a diagnostic assay for M. bovis infection in rhinoceros.
# 2006 Elsevier B.V. All rights reserved.
Keywords: Interferon-gamma (IFN-g); White rhinoceros (Ceratotherium simum); Bovine tuberculosis (BTB); Mycobacterium bovis; Kruger
National Park (KNP)
1. Introduction
Mycobacterium bovis is the causative agent of
bovine tuberculosis (BTB) and has mostly presented
* Corresponding author. Tel.: +27 12 529 8266;
fax: +27 12 529 8312.
E-mail address: [email protected] (D. Morar).
0165-2427/$ – see front matter # 2006 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetimm.2006.10.016
itself as a problem in cattle (O’Reilly and Daborn, 1995,
pp. 1–46; Pollock et al., 2006, pp. 141–150) and related
species including goats (Cousins et al., 1993, pp. 262–
263; Liébana et al., 1998, pp. 50–53) worldwide. More
recently M. bovis has also been found to infect wildlife
species like lions (Panthera leo), kudu (Tragelaphus
strepsiceros), African buffalo (Syncerus caffer) and
Chacma baboon (Papio ursinus) in South Africa
(Michel et al., 2006, pp. 91–100; Michel, 2002),
D. Morar et al. / Veterinary Immunology and Immunopathology 115 (2007) 146–154
European badger (Meles meles) (Cheeseman et al.,
1989, pp. 113–125) in the United Kingdom and the
Brushtail possum (Trichosurus vulpecula) in New
Zealand (Buddle et al., 2000, pp. 1–16). In the KNP
and elsewhere, potential spillover into other species,
like rhinoceros, for which currently no validated ante
mortem (indirect) diagnostic tools exist, may jeopardise
breeding and relocation projects aiming towards the
conservation of biodiversity. The development of
practical and reliable procedures to diagnose BTB in
black rhinoceros (Diceros bicornis) and white rhinoceros (Ceratotherium simum) has therefore been
identified as a priority area for research by conservation
bodies. Although bovine tuberculosis has to date not
been diagnosed in pachyderms in South Africa it is of
utmost importance to be able to provide an additional
guarantee on the Tb free status of these animals and to
provide conservation bodies with an early warning
system should bovine Tb enter the rhino population.
While tests traditionally available for diagnosing bovine
Tb include microscopic and bacterial culture techniques
(Schaechter et al., 2006), as well as tuberculin skin tests
(Wood et al., 1990, pp. 37–46; Monaghan et al., 1994,
pp. 111–124), these are of little value for screening
purposes in pachyderms. The culture techniques are
most reliable and specific (Schaechter et al., 2006), but
have the drawback that they require post mortem
specimens and results are obtained only after 6–8
weeks. Specificity and sensitivity of Tb skin tests have
been determined mostly for domesticated animals,
especially cattle (Monaghan et al., 1994, pp. 111–124),
while diagnosing M. bovis infection in wildlife is
proving to be a challenge. In pachyderms, like
rhinoceros and elephants, tuberculin skin tests are not
practical both due to difficulties in defining suitable
injection sites and the fact that these reactions have to be
read after approximately 72 h, which necessitates the
recapture of the animals. As an alternative to tuberculin
skin tests, IFN-g assays, for example the BOVIGAMTM
test (Wood and Jones, 2001, pp. 147–155; Wood et al.,
1990, pp. 37–49), have been used during the last decade
to determine M. bovis specific immune responses in
ruminants. These tests consist of antibody-based
sandwich enzyme immunoassays that will detect
IFN-g produced by specific T cells after incubation
of heparinized blood with M. bovis antigens. Infected
animals are identified by their high IFN-g responses,
due to M. bovis antigen specific T cells induced by the
mycobacterial infection.
In this paper we describe the first steps in developing
an IFN-g based ELISA for the detection of M. bovis
infection in white rhinoceros and report the first
147
evaluation of the specificity of the test in known Tb
free rhinoceros. The Tb free status of these white rhinos
was determined based mainly on the epidemiological
evidence of the absence of M. bovis infection in rhinos
in South Africa. Indeed to date, after more than 10 years
of translocation programmes, no single case of Tb
infected rhinoceros has been documented (Michel et al.,
2006, pp. 91–100). The set up of the test includes the
cloning, sequencing and the expression of the white
rhinoceros IFN-g gene and the production of RhIFN-g
specific monoclonal and polyclonal antibodies. Thus,
the IFN-g produced in vitro by antigen stimulation of
sensitised T-lymphocytes can be measured to serve as a
sensitive and specific indicator of M. bovis exposure.
Development of this assay could ultimately yield a vital
tool for detecting M. bovis infection in rhinoceros prior
to the development of clinical signs.
2. Materials and methods
2.1. Cloning and sequencing white rhinoceros IFN-g
Blood from an adult white rhinoceros was collected
in EDTA Vacutainer tubes. Peripheral blood mononuclear cells (PBMC) were isolated by density gradient
centrifugation using Ficoll-Paque PLUS (Amersham
17-1440-02). After 25 min of centrifugation at
2800 rpm, mononuclear cells were taken from the
interphase and washed two times in RPMI-1640
medium supplemented with L-glutamine (Sigma,
R8758) and 10% heat inactivated fetal calf serum
(FCS). To induce IFN-g production, purified mononuclear cells (1 106 cells/ml in wells of a 24-well
plate) were stimulated with 5 mg/ml Concanavalin A
(Con A) (Sigma, C2010-100 mg) for 18–24 h at 37 8C
in a 5% CO2 incubator. Total RNA was purified from
stimulated lymphocytes using Trizol reagent (Gibco
BRL, life technologies, 15596-018) and 1 mg of total
RNA was subjected to first strand cDNA synthesis using
reverse transcriptase Rnase H SuperscriptIITM (Gibco
BRL, life technologies, 18064-014) and oligo-(dT)12–18
as a primer for RT-PCR. The cDNA produced in
this way was used as a template for a polymerase
chain reaction (PCR) using Pwo DNA polymerase
(Roche, 1644 947) according to the manufacturer’s
instructions. PCR primers (50 -end primer sequence: 50 GCCGCGCGGGAGCCAGGCCGCGTTTTTTAAAGAAATAG -30 and 30 -end primer sequence: 50 GCGGCGGCGGGAATTCAAATATTGCAGGC AGG-30 ) used were designed to amplify the part of the
white rhinoceros IFN-g gene that encodes the mature
protein (without signal sequence). The sequence of the
148
D. Morar et al. / Veterinary Immunology and Immunopathology 115 (2007) 146–154
primers was based on the IFN-g gene of the horse
(Genbank accession no. D28520), because this species
has a close phylogenetic relationship with rhinoceros. A
gradient PCR was performed for 35 cycles using a BioRad Thermal iCycler. One cycle consisted of: DNA
denaturation at 95 8C for 30 s, primer annealing at
56 8C, 58 8C, 61 8C or 64.7 8C (depending on the
position of the PCR tube in the gradient) for 45 s and
primer extension at 72 8C for 60 s. The underlined
sequences in the primers above are not part of the IFN-g
sequence, but were included as annealing sites for a
second PCR performed with the forward primer GW2-F
(50 -GGGGACAAGTTT GTACAAAAAAGCAGGCTTGGTGCCGCGCGGGAGC-30 ) and the reverse primer
GW-R (50 -GGGGACCACTTTGTACAAGAAAGCTGGGTGCGGCGGCGGG-30 ). This second PCR, introduced the attB1 and attB2 sites, which enabled
subsequent Gateway1 cloning (Invitrogen). The conditions for this second PCR were similar as described
for the first PCR, apart from the annealing temperature
that was set at 56 8C.
Following DNA electrophoresis, the PCR product was
harvested from the low melting point agarose gel and
inserted into the vector pDONR201 (Invitrogen) by the
BP Gateway reaction (Invitrogen, GatewayTM BP
Enzyme Mix, 11789-013) performed according to the
manufacturers instructions. After transformation of E.
coli strain DH5a, plasmid DNA was purified from
selected colonies and sequenced to check the cloned
fragment. Subsequently, the Interferon-gamma gene was
subcloned into the expression vector pET15bGW by the
LR Gateway reaction (Invitrogen, Life technologies,
GatewayTM LR Clonase Mix, 11791-091). The resulting
expression vector was designated pET15-RhIFN-g.
Vector pET15bGW is a derivative of pET15b (Novagen)
that was adapted for Gateway cloning (Invitrogen) by
ligation of the Gateway cassette containing XbaI–HindIII
fragment of pDEST17 (Invitrogen) into the corresponding sites of pET15b. The resulting plasmid was purified
from liquid culture from ampicillin and chloroamphenicol resistant colonies obtained after transformation of
E. coli DB3.1 (Invitrogen).
To determine the 50 -end of the complete coding part of
the RhIFN-g-gene (including the sequence encoding the
signal sequence), this end was cloned separately. First, it
was PCR amplified using KOD hotstart polymerase
(Novogen) according to the manufacturer’s instructions.
The white rhinoceros cDNA described above was used as
a template. The forward primer F3 (30 -CCTGATCAGCTTAGTACAGAAGTGA-50 ) was based on the published
equine IFN-g sequence upstream of the start codon and
the reverse primer R3 (50 -TCCTCTTTCCAGTTCTT-
CAAGATATC-30 ) based on the RhIFN-g-gene sequence
encoding the mature protein that had been cloned as
described above. A gradient PCR, with annealing
temperatures between 65 8C and 55 8C, resulted in a
weak PCR band of the expected size for the reaction
performed at 57 8C. To obtain enough material for
cloning, additional PCR rounds were required. To avoid
amplification of the smear of unspecific PCR bands
present, a half-nested PCR was performed on the original
PCR product to increase the specificity. For this halfnested PCR, the same forward primer (F3) was used,
because the 50 -end sequence was not known, and a reverse
primer (R7: 50 -TCATTCATCACTTTGATGAGTTCA30 ) which anneals to a sequence upstream of primer R3
(internal reverse primer). For the first 20 cycles, the
annealing temperature was reduced with 0.5 8C each
cycle (touch down PCR), starting at 65 8C. The following
20 cycles were performed at a constant annealing
temperature of 55 8C. The resulting PCR product was
run on a 1.5% low melting point agarose gel and a
dominant PCR band of the expected size (approximately
450 bp) was cut out. After melting the agarose at 65 8C,
this PCR band was used as a template for another halfnested PCR, using the same forward primer and as a
reverse primer (R4: 50 -CCTCTTTCCAGTTCTTCAAGATATC-30 ) which anneals to a sequence upstream of
primer R7. The PCR conditions were identical to those
described for the previous half-nested PCR, except that
only ten cycles were given, once the touch down
PCR reached an annealing temperature of 55 8C. The
obtained PCR product was cloned into the vector pCR4,
using the ‘‘Zero-blunt-TOPO-PCR-cloning-kit’’ (Invitrogen) according to the manufacturer’s instructions.
After transformation of E. coli strain DH5a, plasmid
DNA was purified from selected colonies and sequenced
to verify the cloned fragment. The successive rounds of
this half-nested PCR approach were performed to obtain
enough material to allow efficient cloning and to increase
the specificity.
2.2. Expression and purification of recombinant
white rhinoceros IFN-g
Vector pET15-RhIFN-g was used to transform E. coli
BL21-codon+1(DE3)-RIL competent cells (Stratagene,
230245). A single ampicillin and chloroamphenicol
resistant colony was spread on an LB agar plate
containing ampicillin, chloroamphenicol and 1% (w/v)
glucose. The glucose was added to repress expression of
the recombinant protein. After overnight incubation at
37 8C, the bacteria were harvested from the plate with an
inoculation loop and resuspended in 10 ml LB. After
D. Morar et al. / Veterinary Immunology and Immunopathology 115 (2007) 146–154
resuspension the bacteria were transferred to 500 ml LB
containing ampicillin and chloroamphenicol and incubated at 37 8C, with shaking, until the optical density at
600 nm (OD600) reached 0.6–0.9. Gene expression was
induced with 1 mM IPTG and incubation continued for
4 h, after which cells were harvested by centrifugation at
5000 g for 15 min. Cell pellets were resuspended in
40 ml of Buffer B (20 mM Tris–HCl [pH 8], 500 mM
NaCl) containing 0.1 mg/ml of lysozyme. The cell
suspension was transferred to a 50 ml tube and was
incubated at room temperature under rotation for 30 min.
This was followed by addition of 5 ml buffer C (100 mM
DTT, 50 mM EDTA, 10% Triton X-100). The contents of
the tube were mixed by inverting the tubes several times
and the lysate was prepared by repeating alternate
freezing and thawing steps at 20 8C and room
temperature, respectively. After the last freeze/thaw step,
1500 units of benzonase (Novagen) and 1.5 ml of a 0.5 M
MgCl2 solution was added and incubated at room
temperature for 30 min to break down the DNA and
reduce the viscosity. The total protein lysate was
centrifuged at 5000 g for 15 min. The pellet, containing the IFN-g inclusion bodies, was washed with Buffer B
containing 1% Triton X-100. After a final centrifugation
step (5000 g for 15 min) the pellet was solved in 10 M
urea prepared freshly in buffer B containing 20 mM
imidazole at room temperature. Any remaining insoluble
material was removed by centrifugation at 5000 g for
20 min at room temperature. The hexa-histidine tagged
recombinant IFN-g was purified by immobilized metal
affinity chromatography (IMAC) on chelating sepharose
fast flow (Amersham-Biosciences, 17-0575-02) charged
with Ni2+ according to the manufacturer’s instructions.
After equilibration of the column with buffer B containing 20 mM imidazole and 8 M urea, the solved inclusion
bodies were applied to the column. The bound protein was
washed with 10 column volumes of buffer B containing
20 mM imidazole and 8 M urea. The protein was refolded
on the column by fast replacement of wash buffer with
two column volumes of refolding buffer (50 mM Tris–
HCl [pH 8], 2 mM oxidized gluthathione, 0.22 mM
reduced gluthathione, 1 M NDSB201, 0.5 M L-arginine)
and incubated at 4 8C for 40 h. Refolding buffer was
discarded and the column washed twice with one column
volume PBS containing 1 M NDSB201. The refolded
IFN-g was eluted with a total of five column volumes of
PBS containing 50 mM EDTA. The protein was dialysed
against 1 PBS and subsequently centrifuged (5000 g
for 30 min) to remove any protein that had precipitated
during the dialysis. The protein solution was mixed with
an equal volume of glycerine then sterile filtered using a
0.2 mM filter and stored at 20 8C. Samples were taken
149
during the whole purification process for analysis by
sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).
2.3. White rhinoceros IFN-g specific poly- and
monoclonal antibodies
Mice were immunised with recombinant IFN-g
according to routine procedures using Specol, an oil
based adjuvant (Boersma et al., 1992, pp. 503–512;
Bokhout et al., 1981, pp. 491–500; Hall et al., 1989, pp.
175–186) and boosted on three occasions. When desired
serum antibody titres were achieved, as determined by
indirect rRhIFN-g ELISA, mice spleens cells were
fused to SP2/0 cells to obtain hybridomas and plated in
96 well tissue culture plates (Kohler, 1975, pp. 495–
497; Kohler, 1975, pp. 495–497). Supernatants from
wells containing colonies of hybridoma cells were
tested in the ELISA for the presence of rRhIFN-g
specific monoclonal antibodies. Positive colonies were
subcloned by FACSVantage (Becton Dickson) single
cell sorting, based on forward/sideward scatter characteristics, and tested again.
For the production of polyclonal antibodies, chickens
were immunised intramuscularly using Specol as an
adjuvant, and boosted on a regular basis to maintain
antibody titres. Eggs were collected for up to 1 year
following the first booster immunization and stored at
4 8C till further processing. Finally antibodies were
purified from the egg yolk by the ‘‘water dilution method’’
followed by ammonium sulphate precipitation according
to the procedure described by (Hansen et al., 1998, pp. 1–
7). After extensive dialysis against PBS, poly-and
monoclonal antibodies were sterile filtered using a
0.2 mM filter, aliquoted and stored at 4 8C until use.
The immunization protocols were approved by the
Animal Ethics Committee of the Veterinary Faculty of
the University of Utrecht.
2.4. Screening of hybridomas for antibody
production by indirect ELISA
Fifty microlitres per well of the recombinant IFN-g
protein diluted to 1 mg/ml in carbonate/bicarbonate
buffer (0.1 M, pH 9.6) was used to coat 96 well Costar
high binding ELISA plates overnight at 4 8C. After
removal of the coating, the plates were blocked with
100 ml/well of 2% non-fat powdered milk (Protifar) in
PBS for 1 h at 37 8C. Plates were then washed five times
using tap water with 0.1% Tween 20 using an ELISA
plate washer. Hybridoma supernatants, 50 ml diluted
1:1 with 2% Protifar in PBS containing 0.1% Tween 20,
150
D. Morar et al. / Veterinary Immunology and Immunopathology 115 (2007) 146–154
were added to the wells. After 1 h at 37 8C and five
additional washings, goat anti-mouse IgG (1:2000)
HRP conjugate (Boehringer Mannheim, 1047523) in
Protifar + PBS containing 0.1% Tween 20 was added
and plates were incubated for 1 h at 37 8C. After five
additional washes, ABTS (5 mg/ml) (Roche, 1112597)
was used as the substrate for the colour reaction. After
30 min at room temperature plates were read spectrophotometrically (Bio-Rad) at 492 nm.
2.5. Native IFN-g
Blood was collected in EDTA Vacutainer tubes from
three Tb free white rhinoceros. PBMC were isolated as
described above. To induce IFN-g production, purified
mononuclear cells (1 106 cells/ml in wells of a 24well plate) were stimulated with 10 mg/ml Con A
(Sigma, C2010-100 mg) at 37 8C in a 5% CO2
incubator. PBMC were also stimulated with Bovine
and Avian purified protein derivatives (PPD). PPDs’ are
the antigens used in standard in vivo comparative skin
tests and in vitro IFN-g tests for the diagnosis of Tb in
cattle. Bovine and Avian PPD are extracts produced
from cultures of M. bovis strain AN5 (Hewinson et al.,
2006, pp. 127–139) and M. avium strain D4ER which
have been inactivated. A control sample was included
consisting of PBMC cultured without mitogen. After
18–24 h incubation, cell cultures were collected and
centrifuged at 3200 rpm for 10 min and the supernatant
harvested. Production of IFN-g was analysed in the
capture ELISA described below.
2.6. Prototype capture ELISA for detection of
native white rhinoceros IFN-g
MicrowellTM polysorb ELISA plates (Nunc, C96
446140) were coated with 50 ml of monoclonal
antibody (mAb) 1H11 at 1 mg/ml and incubated
overnight at 4 8C. Wells were blocked with 100 ml
block buffer (2% fat free milk powder in 1 PBS) and
incubated at 37 8C for 1 h. The plates were washed with
wash buffer (H2O/0.1% Tween 20) five times. As a
positive control recombinant white rhinoceros IFN-g
was diluted in PBS to 1 mg/ml and tested in duplicate.
Undiluted supernatants (50 ml) collected from overnight stimulated PBMC were added to the remainder of
the wells. After the incubation the wells were washed
five times with wash buffer and incubated with 50 ml
polyclonal antibodies to white rhinoceros IFN-g
(chicken IgY (700 mg/ml), 1:100 dilution in block
buffer) per well. After 1 h the plates were washed five
times with wash buffer and rabbit polyclonal to chicken
IgY H&L (HRP) (Abcam, ab6753) antibody was added
(1:3000 dilution). The wash step with wash buffer was
repeated and the addition of o-phenylenediamine (OPD)
(Sigma, P3804) substrate followed. The reaction was
stopped after 20 min with 50 ml of 2N H2SO4 and the
OD was read 10 min later at 492 nm.
3. Results
3.1. Cloning and sequencing of the white
rhinoceros (C. simum) IFN-g gene
Initially the part of the IFN-g gene encoding the
mature protein was amplified by RT-PCR, using primers
that were based on the horse IFN-g sequence. A single
PCR band was obtained (results not shown) that was
cloned into the Gateway vector pDONR201. A BLAST
search demonstrated strong homology of the cloned
PCR fragment with the horse IFN-g gene. This IFN-g
gene was subsequently cloned into an E. coli expression
vector (pET15b-GW). To determine the total coding
sequence of the RhIFN-g gene, the missing 50 -end was
cloned separately, using a forward primer that was
based on the horse 50 -end IFN-g sequence and reverse
primers based on the cloned sequence encoding the
mature part of white rhinoceros IFN-g. The complete
coding sequence was composed of this 50 -end sequence
and the previously determined sequence encoding the
mature IFN-g. The nucleotide (nt) and predicted amino
acid (aa) sequences of white rhinoceros IFN-g are
shown in Figs. 1 and 2, respectively.
The coding part of the white rhinoceros IFN-g gene
is 501 nucleotides long and encodes a protein with a
predicted molecular weight (MW) of 19.4 kDa.
According to the SignalP 3.0 prediction server
(http://www.cbs.dtu.dk/services/SignalP/) the most
likely signal peptidase cleavage site is located between
aa 25 and 26, which would yield a mature protein of 141
aa and a signal peptide of 25 aa.
The predicted amino acid sequences of white
rhinoceros and equine IFN-g (Grünig et al., 1994, pp.
448–449) are aligned in Fig. 2.
Blast searches of the nucleotide sequences and the
predicted aa sequences of RhIFN-g demonstrated the
highest homology with equine IFN-g, that is 90%
identity on the nucleotide as well as on the aa level.
3.2. Expression and purification of recombinant
white rhinoceros IFN-g (rRhIFN-g)
The rRhIFN-g protein with a hexa-histidine tag
(his-6-tag) at its N-terminal end and the additional
D. Morar et al. / Veterinary Immunology and Immunopathology 115 (2007) 146–154
151
Fig. 1. Nucleotide sequence of RhIFN-g gene. Bold arrows under the sequence indicate annealing regions used by PCR primers used for cloning the
sequence encoding the mature protein (bold arrows). Primers used for determining the 50 -end of the gene are indicated with thin arrows. The start
codon (ATG) and the stop codon (TAA) are in bold and underlined (Genbank accession no. DQ305037).
aa’s derived from the GW recombination sequence
and thrombine cleavage site was expressed in E. coli
by plasmid pET15-RhIFN-g. Upon IPTG induction a
strong protein band with the expected molecular
weight for the tagged rRhIFN-g was induced (Fig. 3,
lane 3). The major part of the expressed rRhIFN-g
was present in the insoluble fraction as inclusion
bodies (Fig. 3, lane 5). After solubilisation of the
inclusion bodies in 8 M urea (Fig. 3, lane 6), the
majority of the hexahistidine-tagged rRhIFN-g bound
to a column with immobilized Ni2+ (Fig. 3, lane 8)
and a minor part failed to bind and showed up in the
flow through fraction (Fig. 3, lane 7). After washing,
the bound protein was refolded on the column. After
Fig. 2. Alignment of predicted protein sequences for white rhinoceros and equine IFN-g. Amino acid identities are shown between the
white rhinoceros and equine sequence; a plus sign denotes conserved substitution. Underlined is the predicted signal sequence of rhinoceros
IFN-g.
152
D. Morar et al. / Veterinary Immunology and Immunopathology 115 (2007) 146–154
Fig. 3. SDS-PAGE gel showing the purification of recombinant IFN-g. Lane 1: broad range Mw marker; lane 2: total bacterial lysate (uninduced);
lane 3: total bacterial lysate (IPTG-induced); lane 4: soluble fraction; lane 5: insoluble fraction (inclusion bodies); lane 6: solved inclusion bodies
(10 M urea); lane 7: flow-through Ni2+ column; lane 8: protein bound on column; lane 9: eluted protein.
elution and dialysis the refolded IFN-g had a purity of
at least 95% (Fig. 3, lane 9).
3.3. Prototype sandwich ELISA for the detection of
white rhinoceros IFN-g
The purified recombinant white rhinoceros IFN-g was
used to generate specific monoclonal mouse antibodies
and polyclonal chicken antibodies (IgY). Initially, the
supernatants of ten hybridomas showed strong binding to
the recombinant RhIFN-g in an indirect ELISA. Further
analysis demonstrated that three hybridomas produced
antibodies specific for the IFN-g moiety of the fusion
protein, while others were specific for the remainder of
the recombinant molecule incorporated to allow affinity
purification. Stable subclones could be obtained from
two of the three IFN-g specific hybridomas. The
monoclonal antibodies produced by both hybridomas
behaved similar when they were tested as capture
antibodies in initial experiments. We chose to use the
product of the best producing hybridoma, i.e. monoclonal
antibody 1H11 (mAb 1H11, IgG1, kappa light chain).
Recombinant white Rhinoceros IFN-g could be detected
using the preliminary sandwich ELISA, using mAb 1H11
as a capture antibody in combination with polyclonal
anti-IFN-g IgY as a detecting antibody. This sandwich
ELISA was also able to detect native white rhinoceros
IFN-g (Fig. 4).
The sandwich ELISA could also detect native IFN-g,
as was demonstrated by the strong signal obtained with
supernatants of PBMC of three white rhinoceros that
had been stimulated with Con A to induce the
expression of this cytokine (Fig. 4).
4. Discussion
Fig. 4. Detection of white rhinoceros IFN-g in PBMC stimulated with
bovine PPD, avian PPD and concanavalin A using the IFN-g sandwich
ELISA. Results are expressed as the mean value from three rhinoceros. ‘I’ indicated the standard deviations.
M. bovis has been found to have an exceptionally
wide host range which includes domesticated ruminants
and captive and free-ranging wildlife (Buddle et al.,
2000, pp. 1–16; Michel et al., 2006, pp. 91–100). A high
bovine tuberculosis prevalence among buffalo herds in
the southern region of the KNP has facilitated the
spillover of M. bovis infection into a number of animal
species and poses a real threat on rare species, thus
jeopardising both breeding and relocation projects of
amongst others, rhinoceros in the context of conservation of biodiversity. Although not yet diagnosed in
South Africa, rhinoceros have been reported to be
D. Morar et al. / Veterinary Immunology and Immunopathology 115 (2007) 146–154
susceptible to both M. tuberculosis and M. bovis (Mann
et al., 1981, pp. 1123–1129; Oh et al., 2002, pp. 1290–
1293; Dalovisio et al., 1992, pp. 598–600; Stetter et al.,
1995, pp. 1618–1621), but little is known concerning
the pathogenesis of BTB in rhinoceros. Diagnostic tests
available for M. bovis infection are often limited to
certain species or lack validation in others, such as the
intradermal tuberculin test in pachyderms. As a
consequence the specificity and sensitivity of these
tests is unknown in these animal species.
Control of infection in the individual animal or in
groups of animals strongly depends on early diagnosis.
The IFN-g test has proven to be highly successful in
demonstrating mycobacterial infections in domestic
and non-domestic species, including cattle, goats,
bison, African buffalo (BovigamTM) (Grobler et al.,
2002, pp. 221–227), deer (CervigamTM) and primates
(PrimagamTM) (Waters et al., 2006, pp. 37–44; Garcia
et al., 2004, pp. 578–584; Garcia et al., 2004, pp. 86–
92). In wildlife species the test is considered practical,
as it requires minimal invasion and manipulation.
The present paper reports the successful cloning,
sequencing and expression of IFN-g from white
rhinoceros (C. simum) and the production of monoclonal antibodies specific for rRhIFN-g, as essential
tools for development of assays to detect the IFN-g
response to M. bovis infection in rhinoceros.
As expected from the close phylogenetic relationship, the highest homology was observed with the
equine IFNg sequence on the DNA as well as the
protein level (both 90%). The RhIFN-g gene is
predicted to encode a signal sequence of 25 aa and a
mature protein of 141 aa residues. For expression
purposes in E. coli, initially the sequence encoding the
mature protein was cloned. The forward primer that was
used to clone the mature IFN-g was based on the IFNg
sequence of the horse, because of its relatedness to
rhinoceros. Potentially this horse forward primer might
have had one or a few mismatches with the rhinoceros
sequence, which would consequently result in different
amino acids at the N-terminal end of the mature white
rhinoceros IFN-g. The sequence of the 50 -end was
therefore cloned separately using forward primers
corresponding to equine IFN-g sequences upstream
of the start codon and reverse primers based on the
obtained white rhinoceros IFN-g sequence. Based on
the new set of primers derived from those sequences, the
final nucleotides at the 50 -end was verified (Fig. 1,
Genbank accession no. DQ305037). Indeed, the horse
forward primer used to clone the sequence encoding the
mature rhinoceros IFN-g, contained two mismatches
with the real rhinoceros sequence. Only the second
153
mismatch results in a different amino acid after
translation. This aa, the first of the predicted mature
rhinoceros IFN-g, turned out to be a valine (v), instead
of the alanine (a) (Fig. 2). Apparently, the amino acid at
this position does not form (an essential) part of the
epitope recognized by monoclonal antibody 1H11, as a
prototype sandwich ELISA could be developed, using
this antibody in combination with polyclonal chicken
antibodies, that is able to detect both recombinant and
native white rhinoceros IFN-g.
To date tests have only been performed in white
rhinoceros and have yet to be performed in black
rhinoceros.
A first confirmation of the specificity of the test was
done using Tb free white rhinoceros. No IFN-g was
detected after PPD stimulation although a positive
signal was detected after Con A stimulation of PBMC.
In conclusion, although optimization of the ELISA with
respect to its evaluation for Tb (M. bovis/M. tuberculosis) infected rhinoceros need to be conducted, the
sandwich ELISA as designed demonstrated to be a
promising approach towards diagnosis of Tb (M. bovis/
M. tuberculosis) infection in the white rhinoceros.
Acknowledgements
The authors would like to thank the following people
and funding institutes for their contributions towards
this project: Peter van Kooten, Utrecht University,
Department of Immunology and Infectious Diseases,
The Netherlands; Peter Buss, Wildlife and Game
Capture Unit, Kruger National Park, Skukuza, South
Africa; Utrecht Delta Scholarship, Utrecht University,
The Netherlands; National Research Foundation (NRF),
Thuthuka Grant, South Africa; Belgium Grant, Institutional Collaboration between ITM and DVTD, University of Pretoria (95401) Framework Agreement
DGIC-ITM 2003-2007; UP Postgraduate Abroad
Programme, University of Pretoria, South Africa.
References
Boersma, W.J.A., Bogaerts, W.J.C., Bianchi, A.T.J., Claassen, E.,
1992. Adjuvant properties of stable water-in-oil emulsions: evaluation of the experience with Specol. Res. Immunol. 143, 503–
512.
Bokhout, B.A., van Gaalen, C., van der Heijden, P., 1981. A selected
water-in-oil emulsion: composition and usefulness as an immunological adjuvant. Vet. Immunol. Immunopathol. 2, 491–
500.
Buddle, B.M., Skinner, M.A., Chambers, M.A., 2000. Immunological
approaches to the control of tuberculosis in wildlife reservoirs.
Vet. Immunol. Immunopathol. 74, 1–16.
154
D. Morar et al. / Veterinary Immunology and Immunopathology 115 (2007) 146–154
Cheeseman, C.L., Wilesmith, J.W., Stuart, F.A., 1989. Tuberculosis:
the disease and its epidemiology in the badger, a review. Epidemiol. Infect. 103, 113–125.
Cousins, D.V., Francis, B.R., Casey, R., Mayberry, C., 1993. Mycobacterium bovis infection in a goat. Aust. Vet. J. 70, 262–263.
Dalovisio, J.R., Stetter, M., Mikota-Wells, S., 1992. Rhinoceros’
rhinorrhea: cause of an outbreak of infection due to airborne
Mycobacterium bovis in zookeepers. Clin. Infect. Diseases 15,
598–600.
Garcia, M.A., Bouley, D.M., Larson, M.J., Lifland, B., Moorhead, R.,
Simkins, M.D., Borie, D.C., Tolwani, R., Otto, G., 2004a. Outbreak of Mycobacterium bovis in a conditioned colony of rhesus
(Macaca mulatta) and cynomolgus (Macaca fascicularis) macaques. Comp. Med. 54, 578–584.
Garcia, M.A., Yee, J.A., Bouley, D.M., Moorhead, R., Lerche, N.W.,
2004b. Diagnosis of tuberculosis in macaques, using whole-blood
in vitro interferon-gamma (PRIMAGAM) testing. Comp. Med. 54,
86–92.
Grobler, D.G., Michel, A.L., Klerk, L.M., Bengis, R.G., 2002. The
γ-interferon test: its usefulness in a bovine tuberculosis
survey in African buffaloes (Syncerus caffer) in the Kruger
National Park. Onderstepoort J. Vet. Res. 69, 221–227.
Grünig, G., Himmler, A., Antczak, D.F., 1994. Cloning and sequencing
of horse interferon-gamma cDNA. Immunogenetics 39, 448–449.
Hall, W., Molitor, T.W., Joo, H.S., Pijoan, C., 1989. Comparison of
protective immunity and inflammatory responses of pigs following
immunization with different Actinobacillus pleuropneumoniae
preparations with and without adjuvants. Vet. Immunol. Immunopathol. 22, 175–186.
Hansen, P., Scoble, J.A., Hanson, B., Hoogenraad, N.J., 1998. Isolation
and purification of immunoglobulins from chicken eggs using
thiophilic interaction chromatography. J. Immunol. Meth. 215, 1–7.
Hewinson, R.G., Vordermeier, H.M., Smith, N.H., Gordon, S.V., 2006.
Recent advances in our knowledge of Mycobacterium bovis: a
feeling for the organism. Proceedings of the 4th International
Conference on Mycobacterium bovis, Dublin, Ireland, August 22–
26,, Vet. Microbiol. 112, 127–139.
Kohler, G.M.C., 1975. Continous cultures of fused cells secreting
antibody of predefined specificity. Nature 5517, 495–497.
Liébana, E., Aranaz, A., Urquı́a, J.J., Mateos, A., Domı́nguez, L.,
1998. Evaluation of the gamma-interferon assay for eradication of
tuberculosis in a goat herd. Aust. Vet. J. 76, 50–53.
Mann, P.C., Bush, M., Janssen, D.L., Frank, E.S., Montali, R.J., 1981.
Clinicopathologic correlations of tuberculosis in large zoo mammals. J. Am. Vet. Med. Assoc. 179, 1123–1129.
Michel, A.L., 2002. Implications of tuberculosis in African wildlife
and livestock. The domestic animal/wildlife interface: issues for
disease control, conservation, sustainable food production, and
emerging diseases. In: Gibbs, E.P.J., Bokma, B.H. (Eds.), Conference and Workshop Organised by the Society for Tropical
Veterinary Medicine and the Wildlife Diseases Association. Wildlife and Livestock, Disease and Sustainability: What makes sense?
Pilanesberg National Park, South Africa, July 22–27, 2001, pp.
251–255.
Michel, A.L., Bengis, R.G., Keet, D.F., Hofmeyr, M., Klerk, L.M.,
Cross, P.C., Jolles, A.E., Cooper, D., Whyte, I.J., Buss, P., Godfroid, J., 2006. Wildlife tuberculosis in South African conservation
areas: implications and challenges. Vet. Microbiol. 112, 91–100.
Monaghan, M.L., Doherty, M.L., Collins, J.D., Kazda, J.F., Quinn,
P.J., 1994. The tuberculin test. Vet. Microbiol. 40, 111–124.
O’Reilly, L.M., Daborn, C.J., 1995. The epidemiology of Mycobacterium bovis infections in animals and man: a review. Tubercle
Lung Disease 76, 1–46.
Oh, P., Granich, R., Scott, J., Sun, B., Joseph, M., Stringfield, C.,
Thisdell, S., Staley, J., Workman-Malcolm, D., Borenstein, L.,
Lehnkering, E., Ryan, P., Soukup, J., Nitta, A., Flood, J., 2002.
Human exposure following Mycobacterium tuberculosis infection
of multiple animal species in a metropolitan zoo. Emerg. Infect.
Diseases 8, 1290–1293.
Pollock, J.M., Rodgers, J.D., Welsh, M.D., McNair, J., 2006. Pathogenesis of bovine tuberculosis: the role of experimental models of
infection. Vet. Microbiol. 112, 141–150.
Schaechter, M., Medoff, G., Eisssenstein, B.I., 2006. Mechanisms of
microbial disease. In: Spitznagel, J.K., Jacobs, Jr., W.R. (Eds.),
Mycobacteria: Tuberculosis and Leprosy. Williams and Wilkins,
Maryland, USA, pp. 316–333.
Stetter, M.D., Mikota, S.K., Gutter, A.F., Monterroso, E.R., Dalovisio, J.R., Degraw, C., Farley, T., 1995. Epizootic of Mycobacterium bovis in a zoologic park. J. Am. Vet. Med. Assoc. 207,
1618–1621.
Waters, W.R., Palmer, M.V., Slaughter, R.E., Jones, S.L., Pitzer, J.E.,
Minion, F.C., 2006. Diagnostic implications of antigen-induced
gamma interferon production by blood leukocytes from Mycobacterium bovis-infected reindeer (Rangifer tarandus). Clin. Vac.
Immunol. 13, 37–44.
Wood, P.R., Corner, L.A., Plackett, P., 1990. Development of a simple,
rapid in vitro cellular assay for bovine tuberculosis based on the
production of γ interferon. Res. Vet. Sci. 49, 46–49.
Wood, P.R., Jones, S.L., 2001. BOVIGAMTM: an in vitro cellular
diagnostic test for bovine tuberculosis. Tuberculosis 81, 147–155.