Plastid Sequences Contribute to Some Plant Mitochondrial
Genes
Dong Wang, ,1 Mathieu Rousseau-Gueutin, ,1 and Jeremy N. Timmis*,1
1
Discipline of Genetics, School of Molecular and Biomedical Science, The University of Adelaide, Adelaide,
South Australia, Australia
These authors contributed equally to this work.
*Corresponding author: E-mail: [email protected].
Associate editor: Richard Thomas
Abstract
Key words: chloroplast, DNA transfer, mitochondrion, mtpts.
A Perl script was written in order to determine if any mtpt
insertions colocalized with a mitochondrial protein-coding
gene. Each mtpt sequence that contributed to a protein-coding
gene was then Blasted against the mitochondrial genomes
of the species investigated in order to determine if it was
present only once in the genome.
The first involvement of a mtpt sequence in a mitochondrial protein-coding sequence was found at the 3#-end of
mitochondrial ccmC (cytochrome-c maturation protein) in
V. vinifera (grapevine), Silene latifolia (campion), and N.
tabacum (tobacco), where it encodes four additional
amino acids at the carboxyl terminus of the polypeptide
(fig. 1A). Transcription of this mtpt sequence was verified
by two V. vinifera expressed sequence tags (ESTs)
(DT037770 and DT038666) in which plastid-derived nucleotides form part of the ccmC coding sequence. Further
examination of the ccmC showed that the mtpt also
donated the highly conserved t-element motif
(Forner et al. 2007) of the pseudouridine arm of tRNAs
(5#-GGTTCRANYCC-3#) to the 3# untranslated region,
which suggests involvement in mitochondrial mRNA maturation (fig. 1B). This single copy mtpt sequence is present
in almost all the sequenced mitochondrial genomes of angiosperms indicating that it was transferred about 150 Ma
(Hedges et al. 2006). It contains only 74–86 bp of ptDNA in
all species except N. tabacum (tobacco) where there are
1,567 bp. By comparing the short mtpt sequences and their
corresponding plastidic sequences, four to ten substitutions were seen to have occurred in the mitochondrial
genome of Z. mays, S. latifolia, C. lanatus, and V. vinifera
whereas none occurred in N. tabacum. This result, together
with phylogenetical analysis, shows that the long tobacco
mtpt results from a much more recent secondary ptDNA
© The Author 2012. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please
e-mail: [email protected]
Mol. Biol. Evol. 29(7):1707–1711. 2012 doi:10.1093/molbev/mss016 Advance Access publication January 24, 2012
1707
Letter
It has been known for several decades that integrants of plastid (pt) DNA in the mitochondrial (mt) genome are abundant and widespread in seed plants (Stern and Lonsdale
1982; Stern and Palmer 1984). Recent sequencing and comparisons of plant organellar genomes have shown that mitochondrial genomes of different seed plant species contain
between 1% and 10% of plastidic sequences (mitochondrial
plastid DNAs: mtpts) emanating from widely various regions
of the plastome (Wang et al. 2007; Lloyd et al. 2012), whereas
plastid genomes contain no mtDNA (Smith 2011). Mtpts
have been assumed to be ‘‘virtually entirely’’ nonfunctional
(Hao and Palmer 2009) with only rare instances of
replacement of mitochondrial tRNA genes by their plastid
equivalents (Kanno et al. 1997; Miyata et al. 1998), the
partial replacement by homologous recombination of two
mitochondrial genes (atp1 and 18S ribosomal RNA) with
their homologous plastomic copies (Hao and Palmer
2009; Sloan et al. 2010) or the creation of new promoter
regions (Nakazono et al. 1996). However, we show here that
mtpt sequences encode amino acid tracts in several different
mitochondrial proteins in angiosperm species and are also
involved in maturation of mitochondrial mRNAs.
Mtpt sequences present in the mitochondrial genome of
ten species (Arabidopsis thaliana, Carica papaya, Cycas
taitungensis, Nicotiana tabacum, Oryza sativa subs. japonica,
Sorghum bicolor, Triticum aestivum, Vigna radiata, Vitis
Vinifera, and Zea mays subsp. mays), with currently available
annotated plastid and mitochondrial genomes, were analyzed using BlastN (version 2.2.23) (Altschul et al. 1990). Local
BlastN was carried out using the parameters previously
described (Smith 2011): an expectation value of 10 4; a word
size of 11; match and mismatch scores of 2 and 3, respectively; and gap-cost values of 5 (existence) and 2 (extension).
Downloaded from http://mbe.oxfordjournals.org/ at Bibliothèque de l'IRMAR on November 7, 2013
DNA of plastid (chloroplast) origin comprises between 1% and 10% of the mitochondrial genomes of higher plants, but
functions are currently considered to be limited to rare instances where plastid tRNA genes have replaced their
mitochondrial counterparts, where short patches of mitochondrial genes evolved using their homologous plastidic copies
by gene conversion or where a new promoter region is created. Here, we show that, in some angiosperms, plastid-derived
DNA in mitochondrial genomes (also called mtpt for mitochondrial plastid DNA) contributes codons to unrelated
mitochondrial protein-coding sequences and may also have a role in posttranscriptional RNA processing. We determined
that these transfers of plastid DNA occurred a few to 150 Ma and that mtpts can sometimes remain dormant many
millions of years before contributing to the mitochondrial proteome.
Wang et al. · doi:10.1093/molbev/mss016
MBE
FIG. 1. Insertion of plastid DNA in the mitochondrial genome contributes to ccmC protein-coding sequences in some species of angiosperm.
(A) Contribution of a mtpt to the ccmC amino acid sequence in some angiosperms is presented by comparisons of the amino acid sequence at
the carboxyl terminus of mitochondrial ccmC in five angiosperm species: In red: Zea mays subs. mays (NC_007982: 201419-201463), Nicotiana
tabacum (NC_006581: 19088-19014), Silene latifolia (NC_014487: 32946-32872), Citrillus lanatus (NC_014043: 362984-362964), and Vitis vinifera
(NC_012119: 303774-303848). In blue: The two grapevine ESTs (DT037770 and DT038666) containing both mtpt and ccmC coding sequence
are shown on this alignment. The green boxes indicate the amino acids contributed by the mtpt sequence. Identical amino acids are
represented by dots (N. tabacum mtDNA used as reference). Stars correspond to stop codons. (B) Comparison of the mtpt nucleotide
sequence that contribute to the 3#-end of mitochondrial ccmC with the corresponding region in some angiosperm plastomes. The sequences
used in this alignment are: In red: the mitochondrial sequences of Z. mays subs. mays (NC_007982: 201470-201615), N. tabacum (NC_006581:
19057-18923), S. latifolia (NC_014487: 32915-32773), C. lanatus (NC_014043: 362953-362807), and V. vinifera (NC_012119: 303805-303951). In
green: the corresponding trnI plastome sequences of N. tabacum (NC_001879: 88802-88668 and 153828-153962), V. vinifera (NC_007957:
91313-91179 and 158747-158881), and Z. mays (NC_001666: 84984-84850 and 137753-137887). In blue: the V. vinifera ccmC ESTs (DT037770
and DT038666) containing both mtpt and ccmC coding sequence. The green box indicates the nucleotides contributed by the mtpt sequences.
The ccmC stop codons deriving from the mtpt are underlined and the highly conserved 5#-GGTTCRANYCC-3# t-element acquired from the
mtpt is indicated by a black rectangle. The mtpt present in N. tabacum is longer than the one present in the other four species and derives from
a secondary ptDNA transfer. Identical nucleotides are represented by dots (Z. mays. mays mtDNA used as reference). (C) Test of amplification
of most of the mtpt sequence that contributes to N. tabacum ccmC coding sequence in other Solanales, Asterales, and Brassicales. Polymerase
chain reaction amplification of this region in the Solanales N. tabacum (1), N. sylvestris (2), N. tomentosiformis (3) and Lycopersicon esculentum
(4), DNA ladder (lane 5, not numbered), the Asterales Helianthus annuus (6) and Trachelium caeruleum (7) and the Brassicale Arabidopsis
thaliana (8). The primers used for this amplification were present in the ccmC gene 197 bp before the mtpt sequence (5#
GCATCAACCTGGGAGCATTAG 3#) and inside the mtpt (5# CTAAGAGGTGGAATAGAATAACCCG 3#).
transfer with the same 5# terminus. Due to the unavailability of mitochondrial genome sequences from other Asterids, we were unable to determine if this second mtpt
insertion involved homology between the plastidic
sequence and the preexisting mtpt or any other adjacent
mitochondrial sequences. We designed primers to amplify
most of this long mtpt, and we found that it was also
present in other Nicotiana species and Solanum esculentum
(tomato) (fig. 1C), indicating that this second transfer most
probably occurred before the divergence of the Nicotiana
and Solanum genera, about 24 Ma (Wu and Tanksley 2010).
1708
By comparing the long mtpt present in N. tabacum with the
corresponding plastidic sequences from various species belonging to different Asterid families (data not shown), we
observed that it had accumulated only three mutationssince its insertion, confirming a very recent transposition.
We found the involvement of a second mtpt sequence,
again composed of most of a plastid tRNA gene (trnR), at
the 3#-end of the mitochondrial atp4 (ATPase subunit 4)
protein-coding sequence in Zea species (fig. 2A). This
sequence was observed previously (Dewey et al. 1986) near
the 3#-end of ORF25, now known to be atp4 (Heazlewood
Plastid DNA Contributes to Mitochondrial Genes · doi:10.1093/molbev/mss016
MBE
FIG. 2. Plastid DNA inserted in the mitochondrial genome of Zea species contributes to atp4 protein-coding sequences. (A) Contribution of a mtpt
sequence to the atp4 amino acid sequence in maize is demonstrated by comparisons of the amino acid sequences present at the carboxyl terminus
of mitochondrial atp4 in six Panicoid species. The sequences used in this alignment are: In red: Sorghum bicolor (NC_008360: 334754-334809),
Tripsacum dactyloides (NC_008362: 139557-139508), Zea perennis (NC_008331: 565413-565587), Zea luxurians (NC_008333: 534464-534640), Zea
mays subs. parviglumis (NC_008332: 279012-279187), Zea mays subs. mays (NC_007982: 138625-138462). In blue: The maize EST BM332325
containing both mtpt and atp4 coding sequence is also shown on this alignment. The green box indicates the amino acids contributed by the mtpt
in Zea species. Identical amino acids are represented by dots (Z. perennis mtDNA used as reference). Stars correspond to stop codons. (B)
Comparison of the mtpt nucleotide sequences present at the 3#-end of mitochondrial atp4 and the surrounding region in some Panicoid
mitochondrial genomes. The sequences used in this alignment correspond to the mitochondrial sequences (in red) responsible for the protein
product shown in (A) and to the corresponding plastome sequences: In green: Z. mays (NC_ 001666: 102669-102839 and 120068-119898),
Saccharum hybrid cultivar NCo 310 (NC_006084: 103393-103563 and 120838-120668), Saccharum hybrid cultivar SP-80-3280 (NC_005878: 2383624006 and 41281-41111), S. bicolor (NC_008602: 103560-103730 and 120928-120758), Coyx lacryma-jobi (NC_013273: 103096-103266 and 120442120272) and Panicum virgatum (NC_0015990: 101953-102123 and 119326-119156). The stop codons of the mitochondrial atp4 genes are
underlined. The green box shows the plastidic fragment that increased the length of the mitochondrial atp4 coding sequence in Zea spp. Identical
nucleotides are represented by dots (Z. perennis mtDNA used as reference). The black bar shows the sequence corresponding to the plastidic trnR
sequence (trnR pt). Asterisks indicate the region of microhomology (8 bp) probably involved in the mtpt insertion event. The highly conserved 5#GGTTCRANYCC-3# t-element acquired from the mtpt in Zea is indicated by a black rectangle.
et al. 2003), but its implication has not been recognized.
Using the recent complete organelle genome sequences
of Zea species, we could clarify the situation which showed
clearly that ptDNA encodes between 13 and 15 amino
acids at the carboxy terminus of mitochondrial ATP4 of
Zea species and provides the stop codon (fig. 2A). We identified a maize EST (BM332325), containing both mtpt and
upstream coding sequence, confirming contiguous transcription of the plastid integrant and its contribution to
the mitochondrial protein. This 89–105 bp mtpt that is
mainly comprised of the plastidic tRNA-Arg (fig. 2)
contains a t-element downstream of the atp4 stop codon,
again suggesting a role in 3# mRNA maturation. Thus two
different tRNA-like genes (trnR and trnI) fortuitously
encode amino acids at the carboxyl termini of two different
mitochondrially encoded proteins (ATP4 and ccmC) in different angiosperm species. The mtpt contributing to atp4
in Zea was present in all Zea mitochondrial genomes but
absent from those of other panicoid species, including S.
bicolor (sorghum) and Tripsacum dactyloides (gama grass)
(fig. 2B). A refined search for this mtpt in Zea mitochondrial
genomes allowed the identification of a larger mtpt that
was also present only in Zea, indicating that the transfer(s)
of chloroplastic sequences to the mitochondrion occurred
after the divergence of Zea and Sorghum, less than 11.8 Ma
(Swigonova et al. 2004). In the common ancestor of the
four Zea species, this larger mtpt was at least 4.1 kb. It
is reduced in size to 1.4 kb in Z. mays mays and Z. mays
parviglumis, most probably due to mtDNA rearrangements. The presence of a common insertion event in
1709
MBE
Wang et al. · doi:10.1093/molbev/mss016
FIG. 3. Plastid DNA inserted in the mitochondrial genome of Poaceae species contributes to nad9 protein-coding sequences in Triticum aestivum.
(A) Contribution of a mtpt sequence to the nad9 amino acid sequence in T. aestivum is demonstrated by comparisons of the N-terminal amino
acid sequence of mitochondrial nad9 in five species of Poaceae: In red: Sorghum bicolor (NC_008360: 49644-49615), Tripsacum dactyloides
(NC_008362: 164899-164870), Zea mays subs. mays (NC_007982: 101544-101573), Oryza sativa japonica (NC_011033: 361793-361822), and
T. aestivum (NC_007579: 212573-212253). In blue: The wheat EST CD924893 containing both mtpt and nad9 coding sequence are shown on this
alignment. The green box indicates the amino acid contributed by the mtpt in T. aestivum. Identical amino acids are represented with dots
(T. aestivum mtDNA used as reference). The amino acid differences observed in the EST CD924893 that result from RNA editing are in bold
(Lamattina et al. 1993). (B) Comparison of the mtpt nucleotide sequence present at the 5#-end of mitochondrial nad9 and the surrounding region
in some Poaceae mitochondrial genomes. The sequences used in this alignment are: In red: the mitochondrial sequences of S. bicolor (NC_008360:
49929-49813), T. dactyloides (NC_008362: 165180-165064 and 476880-476764), Z. mays subs. mays (NC_007982: 101263-101379), O. sativa japonica
(NC_011033: 361512-361628), and T. aestivum (NC_007579: 212568-212451). In green: the corresponding ndhC plastome sequences of T. aestivum
(NC_002762: 50032-500153), Oryza sativa japonica (NC_001320: 49448-49569), Z. mays (NC_001666: 52003-52124), and S. bicolor (NC_008602:
52757-52878). In blue: the T. aestivum EST (CD924893) containing both mtpt and nad9 coding sequence. Identical nucleotides are represented with
dots (S. bicolor mtDNA used as reference). The green box indicates the mtpt sequence in the Poaceae.
the long and short mtpts present in all Zea mitochondrial
genomes, as well as the absence of other common shared
features in comparison with their corresponding plastidic sequences suggest that only one transfer occurred and that the
small mtpt sequences that contribute to atp4 probably derives from a partial duplication of the large mtpt soon after
its insertion in the mitochondrial genome. Comparisons of
the mtpt involved in atp4 with other available panicoid mitochondrial genomes suggest that integration utilized microhomology of 8 bp (TGGGGGGT) present in the preexisting
mtDNA and at the 5#-end of the mtpt sequence (fig. 2B).
A third example is a mtpt at the 5#-end of nad9 (subunit 9
of NADH dehydrogenase) in T. aestivum (wheat) (fig. 3A).
This 58 bp sequence, corresponding to part of plastidic ndhC,
is present in the mitochondrial genome of all species belonging to the two major clades of the Poaceae with sequenced
mitochondrial genomes (fig. 3B) and thus was most probably
inserted before their divergence, 45–60 Ma (Massa et al.
2011). However, this mtpt sequence is capable of encoding
amino acids only in T. aestivum (EST: CD924893), an
acquired function facilitated by the presence of indels that
remove preexisting mitochondrial stop codons when in
frame in nad9 mRNA. Comparison with corresponding
plastidic sequences from various species belonging to different families of Liliopsida (data not shown) revealed that
these mtpts had accumulated three mutations in all species
considered. Another larger mtpt encompassing the mtpt that
contributes to nad9 was observed in Oryza japonica,
S. bicolor, and T. dactyloides. These short and long mtpts
share a deletion and similar substitutions compared with
the corresponding plastidic sequence, implying that a single
1710
transfer occurred with the short mtpt originating from a
partial duplication of the long version.
Thus, in contrast to previous conclusions, mtpts create
novel mitochondrial genes, unrelated to their plastidic functions, in ways that are similar to their nuclear equivalent
‘‘promiscuous’’ DNAs (Ellis 1982)—nupts and numts (nuclear
integrants of plastid and mitochondrial DNAs, respectively)
(Noutsos et al. 2007). These results emphasize that mtpts are
evolutionarily potent sequences. Although they may remain
inactive for millions of years, they may become functional
and spread through the mitochondrial gene pool. Here,
we provide examples of mtpt sequences that contribute
to mitochondrial protein-coding sequences and that have
a likely role in mitochondrial posttranscriptional mRNA
processing. With increasing mitochondrial and plastidic
genome sequences becoming available, we predict the
discovery of more examples that demonstrate the significance of mtpt sequences in the evolution of the cohabiting
genetic compartments of eukaryotic cells.
Acknowledgments
We thank the reviewers for their helpful comments. This
work was supported by the Australian Research Council’s
Discovery Projects funding scheme (DP0986973). D.W. was
supported by the China Scholarship Council.
References
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic
local alignment search tool. J Mol Biol. 215:403–410.
Plastid DNA Contributes to Mitochondrial Genes · doi:10.1093/molbev/mss016
Dewey RE, Levings CS 3rd, Timothy DH. 1986. Novel recombinations
in the maize mitochondrial genome produce a unique transcriptional unit in the Texas male-sterile cytoplasm. Cell 44:439–449.
Ellis J. 1982. Promiscuous DNA—chloroplast genes inside plant
mitochondria. Nature 299:678–679.
Forner J, Weber B, Thuss S, Wildum S, Binder S. 2007. Mapping of
mitochondrial mRNA termini in Arabidopsis thaliana: telements contribute to 5’ and 3’ end formation. Nucleic Acids
Res. 35:3676–3692.
Hao WL, Palmer JD. 2009. Fine-scale mergers of chloroplast and
mitochondrial genes create functional, transcompartmentally
chimeric mitochondrial genes. Proc Natl Acad Sci U S A.
106:16728–16733.
Heazlewood JL, Whelan J, Millar AH. 2003. The products of the
mitochondrial orf25 and orfB genes are FO components in the
plant F1FO ATP synthase. FEBS Lett. 540:201–205.
Hedges SB, Dudley J, Kumar S. 2006. TimeTree: a public knowledgebase of divergence times among organisms. Bioinformatics
22:2971–2972.
Kanno A, Nakazono M, Hirai A, Kameya T. 1997. Maintenance of
chloroplast-derived sequences in the mitochondrial DNA of
Gramineae. Curr Genet. 32:413–419.
Lamattina L, Gonzalez D, Gualberto J, Grienenberger JM. 1993.
Higher plant mitochondria encode an homologue of the
nuclear-encoded 30-kDa subunit of bovine mitochondrial
complex I. Eur J Biochem. 217:831–838.
Lloyd AH, Rousseau-Gueutin M, Sheppard AE, Ayliffe MA, Timmis JN.
2012. Promiscuous organellar DNA. In: Bock R, Knoop V, editors.
Advances in photosynthesis and respiration. Berlin (Germany):
Springer Verlag.
Massa AN, Wanjugi H, Deal KR, et al. (13 co-authors). 2011. Gene
space dynamics during the evolution of Aegilops tauschii,
MBE
Brachypodium distachyon, Oryza sativa, and Sorghum bicolor
genomes. Mol Biol Evol. 28:2537–2547.
Miyata S, Nakazono M, Hirai A. 1998. Transcription of plastidderived tRNA genes in rice mitochondria. Curr Genet.
34:216–220.
Nakazono M, Nishiwaki S, Tsutsumi N, Hirai A. 1996. A chloroplastderived sequence is utilized as a source of promoter sequences
for the gene for subunit 9 of NADH dehydrogenase (nad9) in
rice mitochondria. Mol Gen Genet. 252:371–378.
Noutsos C, Kleine T, Armbruster U, DalCorso G, Leister D. 2007.
Nuclear insertions of organellar DNA can create novel patches
of functional exon sequences. Trends Genet. 23:597–601.
Sloan DB, Alverson AJ, Storchova H, Palmer JD, Taylor DR. 2010.
Extensive loss of translational genes in the structurally dynamic
mitochondrial genome of the angiosperm Silene latifolia. BMC
Evol Biol. 10:274.
Smith DR. 2011. Extending the limited transfer window hypothesis
to inter-organelle DNA migration. Genome Biol Evol. 3:743–748.
Stern DB, Lonsdale DM. 1982. Mitochondrial and chloroplast
genomes of maize have a 12-kilobase DNA sequence in
common. Nature 299:698–702.
Stern DB, Palmer JD. 1984. Extensive and widespread homologies
between mitochondrial DNA and chloroplast DNA in plants.
Proc Natl Acad Sci U S A. 81:1946–1950.
Swigonova Z, Lai J, Ma J, Ramakrishna W, Llaca V, Bennetzen JL,
Messing J. 2004. Close split of sorghum and maize genome
progenitors. Genome Res. 14:1916–1923.
Wang D, Wu YW, Shih AC, Wu CS, Wang YN, Chaw SM. 2007.
Transfer of chloroplast genomic DNA to mitochondrial genome
occurred at least 300 MYA. Mol Biol Evol. 24:2040–2048.
Wu F, Tanksley SD. 2010. Chromosomal evolution in the plant
family Solanaceae. BMC Genomics 11:182.
1711