0022-1767/93/15111-6123$02.00/0
The Journal of Immunology
Copyright 0 1993 by The American Association of Immunologists
Vol 151, 6123-6134, No. 1 1 , December 1, 1993
Printed in U.S.A.
Third Component of Trout Complement
cDNA Cloning and Conservation of Functional Sites'
John D. Lambris,** Zhege Lao,* Jian Pang,* and Jochem Alsenzt
*Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, PA 19104; and
'Hoffman-La Roche Ltd. Co., Basel, Switzerland
ABSTRACT.
Of the 30 distinct complement proteins recognized to date, C3 is probably the most versatile and multifunctional molecule known, interacting with at least 20 different proteins. It plays a critical role in bothpathways
of complement activation
and participatesin phagocytic and immunoregulatoryprocesses. Structural and functional
analysis of C3 from different species, in addition to phylogenetic information, provides insights into the structural
elements mediating the various functions. This study describes the cDNA cloning of one of isoforms
two
of the third
complement component, C3-1, of rainbow trout (Salmo gairdneri) and the analysis of its functional sites.By
screening a trout liver hgtl1 library with anti-troutC3 chain-specific antibodies and polymerase chain reaction we
have determined the cDNA sequence of trout C3-1. The obtained sequence is in complete agreement with the
protein sequence of several tryptic peptides, corresponding to different regions of troutC3-1. C3-1 consists of 1640
amino acids with a calculatedmolecular mass of 181,497 Da. The sequence contains two potential N-glycocylation
sites, one on each chain of C3. The deduced protein sequence showed 44.1 , 43.3, 44.2, 44.9, 43.1 , 43.8, 45.9,
29.9, and 33.1 % amino acid identities to human, mouse rat, guinea pig, rabbit, cobra, frog, hagfish, and lamprey
C3, whereas the identities to human C4, C5, and aZMare 30.4, 28, and 22.9%, respectively. The trout C3 amino
acid sequence shows clusters of high and low similarity toC3 from other species. In the regions of high similarity
belong the C3 domains that contain the thiolester site and the properdin binding sites, whereas the regions that
correspond to regions of human C3 where CR1 and CR2 bind show low amino acid sequence similarity. The
deduced amino acidsequence shows that the C3 convertase cleavage site (Arg-Ser) is conserved in troutC3,whereas
the factor I cleavage sites are Arg-Ala and Arg-Thr instead of Arg-Ser, which is found in the C3 of other species.
Protein sequencing of the trout C3 fragments fixed on zymosan during complement activation confirmed the
cleavage oftrout C3 bytrout C3 convertase and factor I at Arg-Ser and Arg-Thr, respectively. Journal of
Immunology, 1993, 151: 6123.
T
he study of C3 molecule from different species
give insight into its structural elements
involved in
its different functions, the structural features constrained by selection, and the evolutionary history of C3
and complement in general. C3-like activity has been reported in various species, including invertebrates, yet thus
far C3 has been purified only from chordatesand has been
found to be present in representatives of each of the seven
Received for publication April
1993.
28, 1993. Accepted for publication July
14,
of
The costs of publication of this artlcle were defrayed in part by the payment
page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
' This work
was supported by National Science Foundation Grant DCB9018751, National Institutes of Health Grant AI 30040, a grant from the
Research
Foundation of the University ofPennsylvania, and Cancer Center Core support
Grant CA 16520-1 6.
living classes of vertebrates (1, 2). The complete primary
structures have been deduced for C3 of human (3), guinea
pig (4), mouse (5, 6), rat (7), hagfish (8), lamprey (9), and
cobra (10) and partial primary structures have been determined for C3 of rabbit (11) and Xenopus (12).
Although C3 has been purified from different species,
the best characterized is that of human (1, 13). Human C3
is the most abundant complement protein present in serum
(1.2 mg/ml) comprised of two polypeptide chains( a and p,
M, 110,000 and 75,000) linked by one disulfide bond and
noncovalent forces. It contains two N-linked carbohydrate
moieties at residues 63 and 917, with 5-6 and 8-9 mannose
* Address correspondence and reprint requests to Dr. John D. Lambris, Department of Pathology and Laboratory Medicine, University of Pennsylvania,
410JohnsonPavillion,36thandHamiltonWalk,Philadelphia,
PA 19104.
61 23
61 24
TROUT C 3
residues, respectively (14,15).Cleavage of C3 between
Antibodies totrout C3
residues726 and 727 (kg-Ser) by either the classical
Polyclonal antibodies against trout C3 were generated in
(C4b,2a) or the alternative (C3b,Bb) pathway C3 converrabbits by injecting either zymosan-C3b/iC3b and/or putases leads to the generation of C3b and C3a (M, 9,000).
rified C3. The former was prepared by incubating 5 mg of
The C3bmolecule transiently acquiresthe ability to be
zymosan with1ml oftrout serum for30 min at 25°C. After
fixed covalently through an ester or amide bond to the hyboiling for 5 min in 1% SDS/PBS, the zymosan particles
droxyl or amino groups present on cell surfaces, complex
were extensively washed with the same buffer, followed by
carbohydrates, or immune complexes (16, 17). In contrast
washing with PBS and used for immunization. Thesegento native C3, C3b expresses multiple binding sites for other
eratedantibodies reacted weakly with other serum procomplement components, including C5,
properdin (P), factein(s) and were used only in the initial experiments to
tors H, B, and I, C4 binding protein (C4bp), CR1 (C3b
purify trout C3. Monospecific antibodiesfor trout C3 were
receptor), and the membrane cofactorprotein (1,13). Bindprepared by immunizing with intact C3 and its individual
ing of these proteins to C3b leads eitherto amplification of
chains. The CY- and @-chainsof trout C3 were purified by
the C3 convertase (by B and P in the presence of factor D)
electrophoresis of purified C3 under reducing conditions.
and initiation of the membrane attack complex (C5), or to
The individual bands after visualization with 1M KC1 were
the inactivation of C3b (factor I) (18). Whether amplificut and the minced gel pieces injected in to rabbits. The
cation or inactivation occurs depends on the nature of the
antibodies were affinity purified on a C3 column.
surface that C3b is fixed.
The C3 fragments, both soluble and/or surface bound,
Purification of trout C 3 and preparation of
generated during complement activationhave the potential
tryptic fragments
to bind specifically to several cell surface receptorsknown
Trout C3 was purified as previously described (26). Briefly,
as CR1, CR2, CR3, CR4, CR5, and C3a receptor. Consetrout plasma wastreated with 2 mM diisopropylfluorophosquently, these C3 receptor interactions lead to various
phate and brought to 4% polyethylene glycol 4000. After
biologic responses (13, 19-23).
constant stirring for30 min at 4"C, plasma was centrifuged
Trout have a complement system that is similar to that
(10,000
X g for 20 min), the supernatant brought to 16%
of mammals (24). C3 purified from trout plasma has strucpolyethelene
glycol and stirred for 1 h at 4°C. After centure and properties similar to those of mammalian C3 (25,
trifugation (10,000 X g for 20 min), the pellet was redis26). It consists of two disulfide-linked polypeptide chains,
solved in 5 ml of 20 mM Tris-HC1, pH 7.5, containing 2
containinga thiolester site, and is glycosylated in the
mM diisopropylfluorophosphate and applied to a MonoQ
@-chain(26). A variant of trout C3, termed C3-2, shows no
HR 10/10 anion exchange column equilibrated in 20 mM
hemolytic activity and its tryptic peptide map contains sigTris-HC1, pH 7.5. C3 was eluted with a linear NaC1nificant number of peptides (20%) that are different from
gradient (0 to 500 mM) and identified by ELISA and SDSthose in the C3-1 (27). In this report we present the comPAGE. The fractions containing C3 were subjected to caplete primary structure of trout C3-1 and comparethis
tion exchange on FPLC Mono S HR 5/5 column. The Mono
structure with that of C3 from other species and other hoS
column was equilibrated in 20 mM sodium acetate, pH
mologous proteins. In this studywe have also characterized
5.2,
and C3 was eluted with alinear NaCl gradient (0 to 500
the factor I and C3 convertase cleavage sites in trout C3-1
mM).
Fractions containing C3 were pooled and dialyzed
and correlate the conservation of these sites to those found
against PBS.
in the C3 from other species. Finally, we have correlated
Tryptic fragments of trout C3 were prepared by incuthe conservation of the C3 structure to its ability to interact
bating trout C3 with trypsin (5% wt/wt) for30 min at 37°C.
with CR1, CR2, H, B, and P.
The individual fragments were separated by SDS-PAGE
under reducingconditions then electroblotted and their
Materials and Methods
NH2-terminal sequence determined as described below.
Rainbow trout (SaZmo gairdneri) were obtained from LanAmino acid sequence determination of the C3
denberg trout farm, Philadelphia and Rheinbrucke, Basel.
convertase and factor I generated C 3 fragments
Blood was collected using a syringe from the caudal
artery.
Zymosan A is a polysaccharide component of yeast cell
Trout livers were excised and either frozen in liquid niwalls that activates the alternative pathway of complement
trogen or used immediately to prepare the cDNA libraries.
(28). This leads to C3b fixation to its surface; part of this
All chemicals for automated sequencing were from Applied
C3b
is degraded to iC3b by factors I and H. Zymosan was
Biosystems. Restriction enzymes were from either Boehincubated
with human and trout serum (5 mg/ml serum) for
ringer Mannheim (Indianapolis, IN)or Promega (Madison,
30
min
at
37°C or 25"C, respectively. The zymosan parWI). All radionucleotides were from NEN (Boston). All
ticles were boiled in 2% SDS and extensively washed with
other chemicals and reagents used were reagent or higher
2% SDS. The C3fragments @-chain and the equivalent to
grade.
Journal of Immunology
human 43 kDa COOH-terminal a-chain fragment) were
eluted from the zymosan by boiling it for 5 min in the
electrophoresisreducingsamplebuffer.
The supernatant
was removedandthezymosanparticlesafterextensive
washing were incubated in 0.1 M NaHCO,, 0.1 M hydrazine, pH 11,for 60 min at 37°C toelute the a-chain and/or
its 68 kDa NH2-terminal fragment (29). The supernatants
from both incubations wasran in 10% SDS-PAGE and the
individual bands were sequenced by a modified method
(30) of Matsudaira (31). Protein bands electroblotted onto
polyvinylidene difluoride membranes were visualized by
staining with Coomassie
brilliant blue, then were cut off the
membrane and stored under vacuum at 4°C until sequenced. NH2-terminal sequencing was then performed on
an Applied Biosystem 473A gas phase Protein Sequencer.
Protein sequencing was performed at the Protein Chemistry
laboratory of the University of Pennsylvania.
PAC E
Electrophoresis of the purified protein fragments was performed in the presence of SDS as described by Laemmli
(32). The sampleswere reduced with 2% mercaptoethanol.
Protein bands were detected by staining with 0.1% Coomassie blue R-250 (Bio-Rad, Richmond,
CA) in isopropano1:methanol:acetic acid:H20 (2.8:2.0:1.0:4.2 by vol).
The m.w. were estimated using reference proteins.
Isolation of RNA and construction of cDNA libraries
61 25
EcoRI and MluI. The inserts of the longest clone (clone12)
were subclonedto theMluI sites of vector pIB131 (IBI, New
Haven, CT) for direct sequencing; the EcoRI enzyme did
not cleave this clone.
Cloning of trout C3 by PCR3
To clone the 5’ of trout C3 cDNAthe technique of PCR was
used. Oligonucleotides were synthesized
on a MilliGen/
Biosearch DNA synthesizer (Cyclone) and purified using
the Oligo-pak columns (MilliGedBiosearch).The PCR
was performed as described by Saiki et al. (35) using a
commercially available kit (Cetus). Two antisense oligonucleotides (oligo32b: 5’AACCTCGAAGCTGGGCAGAACATAC; oligo32c: S’ATACCTGGCAGTGATGTCAACAG) (Fig. 3) were synthesized according to the obtained 5’-end sequence of clone 12. PCR was conducted in
a thermocycler using the oligo-dT or random-primed trout
library DNA as the template, M13 universal primer (forward or reverse) as one primer, and oligo32c as the other
primer. The product of first PCR was subjected to a nested
PCR using the oligo32b and M13 universal primers. PCR
parameters were as following: 30 cycles 95°C for 1 min,
45°C for 2 min, and 72°C for 2 min. The amplified products
wereprecipitated and subclonedinto plasmid pCRl00O
vectorusing the TA cloningsystem (Invitrogen, San
Diego). C3 cDNAcontaining clones wereidentified by hybridization using the 2.7-kb BamHI fragment of clone 12
as probe. The recombinant clones were subjected to direct
sequencing using the M13 universal primers.
Rainbow trout liver total RNA was isolated by the guaniDNA sequencing
dineisothiocyanate method followedbycentrifugation
Nucleotide sequences were determined using method
the
of
through aCsClcushion(33).
Polyadenylated RNAwas
Sanger
et
al.
(36)
by
using
the
Amersham
sequenase
kit
purified using the PolyA Tract mRNA isolation kit (Proaccording to manufacturer’s directions.
mega) according to manufacturer’s instructions. Random
or oligo-dT-primed cDNA libraries were constructed using
Computer methods
an Amersham cDNA synthesis kit according to manufacturer’s instructions. Afterprotection of any internal EcoRI
The protein sequences for human, rabbit, rat, and mouse
sites byEcoRI methylase and additions of synthetic EcoRI
were taken from Swiss Protein Sequence data bases. The
linkers, thecDNA wasEcoRIdigested and size fractionated protein sequences for guineapig, lamprey, cobra, and hagon Sepharose CL4B column. cDNA larger than 500 bp
fish C3 were translated from their cDNA sequences taken
were ligated into EcoRI-digested, dephosphorylatedXgtll
from GenBank sequence data bases. The Xenopus C3 searms and packaged in vitro using the Amersham cloning
quence represents 80% ofXenopus gili C3
and will be pubsystem.
lished elsewhere. The alignments were generatedusing the
Wisconsinsoftware and programPileup based on the
method of Doolitle and Feng (23). All otheranalysis were
Screening of the cDNA library
performed using the PcGene software (Inteligenetics).
The libraries will be screened without prior amplification.
Screening of the cDNA libraries with the affinity purified
Results
antitrout C3 antibodies was performed as previously deIsolation of trout C3 cDNA clones and nucleotide
scribed (34). The filters were successively incubated with
sequencing
the anti-C3 antibody (5 pgiml), a biotinylated goat antiTo obtain trout C3 cDNA clones the trout h g t l l cDNA
rabbit Ig, and a complex of avidin and biotinylated horselibrary
was screened with an affinity purified antitrout C3
radish peroxidase according to manufacturer’s instructions
(VectorLaboratories,Burlingame,CA).Singlecolonies
wereisolated and digestedwith the restriction enzymes
Abbreviations used in this paper: PCR, polymerase chain reaction.
61 26
TROUT C 3
a chain
AVTISDVITSMASKYHGLAK
p chain
AALQVLSAPNLLRVGSNENIFVE
Trvotic peotidB
30 kDa (equivalent of C3d)
NQVPNSDADTLISVT
QLAYRKEDGS
40 kDa C-terminal a chain
ASGNGEATLSVVTLYYALPE
a'chain
SEEDDDDxAYM
C3 convertase aenerated fraaments
a'c hai n
SEEDDDDDAY
Factor I aenerated fraaments
68 kDa (N-terminal a' chain) SEEDDDDDAYM
43 kDa (C-terminal a'chain) TDKVNSIDKXLTVKASG
FIGURE 1. Amino acid sequence of trout C3-1 fragments.
The chains of trout C3- and its fragments generated by trypsin, C3 convertase, or factor I were separated by SDS-PAGE
thenelectroblotted to PVDF membranes and subjected to
Edman degradation.
a-chain specific antibody and obtained one positive clone
(clone 12). The screening was performed as previously described for the Xenopus C3 cloning (12). The filters were
successively incubated with the anti-C3 antibody, a biotinylated goat anti-Rb Ig, and a complex of avidin and biotinylated horseradish peroxidase. This clone was expanded
then phage DNA isolated and the size of the cDNA insert
was determinedto be 4.7 kb. The 5' 360 bases of this clone
was sequenced directly on the hgtll. The partial deduced
amino acid sequence whenit was compared withthat of Hu
C3 revealed 44% similarity to C3 segment spanning residues 208-338. Its similarity to corresponding regions of
mouse C3, human C4, mouse C5, and human azM was
found to be 45, 28, 24, and 15%, respectively. The high
similarity of the clone 12 sequence to that of C3 from other
species and its reactivity with the monospecific antitrout C3
antibody showedthat in fact the isolated clone is atrout C3
clone. To sequence the clone 12 cDNA, h g t l l insert was
digested with MluI and subcloned into plBI31 vector. The
insert of the obtained plasmid, plBI-TrC3-12, was further
digested by ApaI, BarnH1, XhoI, and PstI (Fig. 2 ) and the
generated fragments were subcloned into pIBI31. The sequence of the subcloned fragments was
obtained using M13
universal and internal primers. The deduced protein sequence matches the protein sequence (Fig. 3, underlined)
obtained by sequencing C3 tryptic fragments (Fig. 1) or
fragments eluted from zymosan (see below) and this provides direct evidence that the isolated clone is indeed aC3
clone. The complete coding sequence of clone 12 spans
4352 bp. To obtain the 5' sequence of trout C3, oligo-dT
and random-primed liver trout cDNA was subjectedto PCR
using two oligonucleotide probes (oligo 32b and 32c, see
Fig. 3) corresponding to 5' sequence of clone 12. The amplified products of 600 bp were cloned into pCRlOOO and
three different clones were sequenced. The nucleotide sequence of 600 bp fragment match the sequenceof clone 12
by 200 nucleotides and extends to the 5' by 400 nucleotides.
The deducedamino acid sequence in its NH2-terminal
matchesresidues
21-23 (FVE) of the P-chain NH2terminal amino acid sequence (Fig. 3). Several attempts to
obtain the cDNA sequence of the first 20 amino acids of
P-chain and that of the signal peptide were unsuccessful.
The compiled amino acid sequence of trout C3 contains
1640 amino acids. The calculated molecular mass of trout
C3 was 181.497Da consistingof a 111,061Da a-chain and
a 70,436 Da P-chain. The mass calculated by SDS-PAGE
was 112and 70 kDa. In view of the factthat Con A binded
only to P-chain of trout C3 (26)it appears that from the two
potential N-glycosylation sites in trout C3 only the P-chain
site is glycosylated. The amino acid sequence identity to
human, rabbit, mouse, rat, Xenopus, hagfish, and lamprey
C3 is shown in Table I. The amino sequence identity to
human C4, C5, and a2M in comparison to C3 is significantly lower (Table I). Trout C3 contains a four Arg processing signal that is located in the same position as in
the C3 from all other species except lamprey and hagfish
C3, whichisArg-Lys-Pro-Arg
and Arg-Arg-Lys-Arg,
respectively.
C3 convertase and factor I cleavage sites in trout C3
To characterize the factor I and C3 convertase cleavage
sites in trout C3, we generated C3 fragments by activating
500bp
FIGURE 2. Restriction map and sequencing strategy. The black box at the
top shows the open reading frame. Solid
arrows show sequencing using restriction
sites and dotted arrows sequencing by oligonucleotides.
H
5'
trout C3 DNA
Psr I
I
Pst I
I
3'
I
- ."". --- ..... - --
1_1
L
I
+
".."
.....
+
.
.
.
.
.
e
"
c
L
pCR-TrC3
Xho I BamH I
I
c
.
L
Apa I
I
I
~lBlTrC3-1
2
BamH I
...".
c-
"
.""c
......
.
......
.....c
I
61 27
Journal of Immunology
trout serum with zymosan (zymosan-C3b/iC3b) (Fig. 5)
thenanalyzingthem
by SDS-PAGE andobtainedtheir
NH2-terminal amino acid.
Electrophoretic analysis of the C3 fragments fixed on
zymosan after activation of trout serum showed a similar
degradation pattern to that observed for human
C3 (Fig. 5).
Although similar fragments were found in the presence or
absence of EGTA (inhibits classical complement pathway),
no fragments weredetected when the activationof the different sera was performed in the presence of EDTA (inhibits both complement pathways).These data suggest that
trout have proteins with
similar functions to thoseof human
factors B, D, I, and H. The NH2-terminal amino acid sequence of the 68 kDa fragment (Fig. 1) showed that this
fragment is the analogue of human C3 fragments generated
by C3 convertase (Fig. 4). In addition, these datashow that
the cleavage site forthe C3 convertase (human C3 residues
726-727) is conserved within theC3 from the species tested
(Fig. 4).
The NH2-terminal sequence of the 43 kDa fragment (Fig.
1) showed that this fragment is the analogue of human C3
fragments generated by factors I and H (Fig. 4). Because
it relates to the factor I-mediated cleavages, of interest are
the finding that the sequence Arg-Thr is found instead of
Arg-Ser at the factor I cleavage sites of trout C3.
Discussion
z
.
0
0
0
7
m
The bony fish possess a well developed complement system, and protein analoguesof mammalian complementproteins have been isolated from trout plasma. Trout C3 is
comprised of two chains(a,p) and contains a thiolester site
in the a-chain (25, 26). It exists in two isoforms (C3-1,
C3-2) that differ in their antigenicity, tryptic peptide map,
and hemolyticaly activity (27). Although both C3 contain
a thioester, C3-2 has been found to be hemolytically inactive (27). To resolve the genetic origin of the two C3
proteins and define the structural elements that makeC3-2
hemolyticinactive, we initiated studies to characterize
these two forms of C3. In this study we have obtained the
cDNA sequenceof trout C3 and analyzed the conservation
of functional sites in trout C3 and correlated them to the
conservation of structural elements.
Evidences indicating that the obtained DNA sequenceis
that of trout C3 are: 1) the clone 12 was isolated using
monospecific anti-trout C3 antibody, 2) the deduced protein sequence matches completely with the partial protein
sequence of seven different fragments of trout C3, and 3)
the sequence shows high similarity to the sequence of C3
from other species. The obtained sequence represents the
sequence of C3-1 for two reason: 1) it matches all the available protein sequence for C3-1 and 2) as expected differs
from that for C3-2 in two residues. However, due to the
limited sequence for C3-2 it is not clear whether these two
changes are due to polymorphism and thus this requires
61 28
TROUT C 3
20
120
40
180
60
260
90
300
100
360
120
420
140
'
480
160
540
180
600
200
660
220
32b
120
240
180
260
040
290
900
300
960
320
1020
CCTCCGCMT~UCCTC~CT-CMTCCTCCA~TA~-CCCCAT
V
R
X
L
Q
L
L
V
K
A
I
L
E
N
Y
S
I
kxr#xxx
D
P
I
8
2520
4 O
C A T T C T C C C T C T C O I C C T C ~ C C C T D A D C T C T ~ T C C C C U E 2~5Q0 0
I V R V L L Y S N G L V C S S A S K K G 8 6 0
32c
61 29
Journal
Human C3
Hu C3aR
CRl,
Hu
H, and
Hu CR2
Binding Site
CR2 Binding Sites
Binding Site
Residues
722-726
Residues
727-768
Residues
1199-1210
0%
Trout C3
Human C3
Rabbit C3b
Rat C 3
Mouse C3
Cui. Pig C3
Xenopus C3b
Cobra C3
Lamprey C3
Hagfish C3
Human C4
Human C5
Human azM
44/59
100/100
80187
78/86
77185
78/86
46/60
51/66
32/48
31/47
28/43
28/45
21/35
Amino Acid Sequence Identity/Similarity
60180
100/100
45/60
100/100
NA
NA
100/100
1 0011 00
1oo/r 00
76/86
71/83
71/83
42/50
100/100
75/83
831'3 2
75183
50/58
NA
NA
NA
80180
40140
40140
60160
40160
0120
50174
2 9143
41/62
40155
29/44
23/48
25/42
25/42
36146
1 7/42
38/48
33133
H'
Binding Site
Residues 1422-1432
Binding to Hu C3 Ligands
CR2 CR1
"
H
+
B
"
8219 1
+ + + +
100/100
91/100
821100
+
+ N D
+ + +ND
7311 00
100/100
ND
+ 5
82191
+ + " +
821100
ND
ND
ND
ND
73/82 ND
ND
ND
ND
ND
45/64 ND
+ " "
36/64
" " 18145
64/82
+
+
+
+
+
+
P
+
+
+
+
ND
_ " "
_ " "
"The percentage of identities and similarities are rounded to the nearest integer. For the
reactivities of different C3 with human C3 ligands and mapping of
human C3 binding sites, see refs. 1, 13.
Partial amino acid sequence; ND, not done; NA, not available sequence for these sites.
surroundingthe
thiolester bondin
C3, C4, and a2further analysis.
macroglobulin
is
relatively
hydrophobic
and it has been
Comparison of the C3 amino acid sequences among speproposed that it serves to shield thethiolester from the aquecies and correlation of this information with the ability of
ous environment and nucleophilic attack (16, 17, 41, 42).
these C3 to bind the different ligands and receptors is inIn vitro mutagenesis experimentshave suggested that prostrumental in identifying structural features of C3 that are
lines at position 1007 and 1020 are necessary for stable
important for its functionality, The different C3 molecules
thiolester formation(39).isconserved
in trout C3 and
and homologous
proteins
such
as C4, C5, and a2PloZ0is replaced by leucine. Whether this mutation is commacroglobulin serve as natural analogues and yield information on which C3 residues arecritical for ligand binding. pensated by proline in position 1021 or the replacementsin
other positions is not clear. Although mutation of P1007by
Investigations by Chothia and Lesk (37) have shown that
G destabilizes the thiolester, it appears from the trout C3
75% divergence in amino acid sequence of homologous
and the replacement of P1020by H in rabbit C3 that some
proteins leads to less than 2 A rms divergence in backbone
substitutions are allowed. Other replacements in the surstructure. This suggest that the tertiary structure of C3 from
rounding region of the thiolester site are S1008by V, and
different species will be approximately the
same (38). The
Gly1017 by Y. Further work will be required to define the
comparative analysis of C3 interactions was used successdifferences and the role the different residues play in the
fully in analyzing the structural elements involved in the
formation of the thiolester.
formation of thiolester bond (39) and in proving that the
Comparison of the amino acid sequences within the other
RGD sequence is not involved in CR3 binding (40). The
C3 functional sites shows different degrees of similarity
latter is further supported
by the presence of NSE sequence
(Table I). The similarity in P, C3aR binding sites, and thiin trout C3 instead of the RGD sequence in human C3
(Figs. 2 and 4).
olester site is higher than the overall similarity between the
different C3 (Table 11). It is anticipated that conserved
All C3 so far tested containa thiolester bond in the
a-chain. Comparison of the amino acid sequences of C3
amino acid sequences are arranged in clusters that may be
from different species (Fig. 4) revealed that the segment
associated with the functionally conserved sites. Because
containing the thiolester bond is highly similar; the thiligands must evolve to match each other, the necessity for
olester site, GCGEQ,is 100% conserved in all species. This
dual evolution is expected to make changes at these sites
conservation of the thiolester bond and its surrounding hyto proceed slower. When the trout C3 was compared with
drophobicaminoacidsemphasizethefunctionalimporthe sequences of C3from other species, such clusters
tance of this region in maintaining throughout evolution the of sequence conservation were indeed identified for the
thiolester and properdin binding site.
molecules capacity to fix itself onto surfaces. The region
FIGURE 3. Nucleotide and amino acid sequence of trout C3-I. The translated amino acids are in single-letter code. The Pa
junction site and N-linked glycosylation sites are indicated by * and x, respectively. Underlined protein sequences indicate
sequences thathave been confirmed by Edman degradation of C3 a- and P-chains and zymosan elutedand tryptic C3
fragments. Underlined nucleotide sequences indicate the position of oligonucleotides.
Ii BINDING
l uuLPBTOD”
FsEmvKGDP
DLLQVAEUUL
PRpP.LIvSAL
I
AQ-LL
WXVSDOAAKV
*DPBs~s
. . . . . . . . . II
. . . . . . . . . I
. . . . . . . ..L
LBnLmATIQ
ADSRLPIDDR”.
. . . . . . . ..A
-mYm
tulxIBBPYL.Q
. . . . . . . . .I
. . . . . . . ..I
. . . . . . . ..L
I
l-l BINDING
CR2
-_.-
SITE
BS
--
FIGURE
4.
Comparison
of the deduced
trout C3 amino
acid sequence
with mammalian, reptilian,
osteichthian,
amphibian,
and cyclostome
C3 sequences
and sequences
of other
homologous
proteins.
Gaps,
introduced
for maximal
sequence
alignment,
are
denoted
by periods.
Boxed
sequences
indicate
areas that correspond
to the human
C3
functional
sites (1, 13).
61 32
TROUT C3
Tr
A
FIGURE 5. SDS-PAGE electrophoresis
of trout and human fragments elutedfrom
zymosan. The zymosan C3 fragments
were prepared as described in Materials
and Methods. A : Fragments eluted after
reduction of zymosan-iC3bwith 2-ME. B :
fragments eluted after treatmentof zymosan-iC3b with hydrazine (was preeluted
as in A).
9
9
Hu
Tr
B
.-
+
-97
"43" Kd
-43
46
43
-31
-31
-21
-15
-21
-15
f3 Chain
+
As it relates to the CR1, CR2, H, and B functional sites,
the comparative analysis of the interaction of these ligands
with thedifferent C3 has beeninstrumental in dissecting the
functional sites in human C3. Allthese ligands share structural (43,44) and functional similarities (13,45,46) and all
four proteins bind to a region in human C3 spanning residues 727-768 (47-49); two of them, H and CR2, bind to
an additional site located within residues 1187-1249 of C3
(50). The findings that human CRl and CR2 but not H bind
to Xenopus iC3 and that H but not CR1 and CR2 interacts
with trout iC3 suggest that, although these three molecules
recognize the same domains in human C3,their exact binding sites are different. In addition, the inability of human
factor B to bind to either trout or Xenopus C3 suggests that
its binding site on human C3b is different from that for H
and CR1. Thus, the ability of H and CR1 to compete with
B for binding to C3b may be due to an allosteric or steric
effect and not to a competition for the same binding site(s).
The segment of trout C3 spanning residues 1199-1214
shows low amino acid similarity with the corresponding
segment of human C3 that binds CR2. This is in agreement
with the inability of trout C3 to bind to human CR2 and
suggests thatall or some of the following C3 residues,
~ 1 1 9 9Dl200 Kl203 ~ 1 2 0 4N1207, and Vl208,
,
are involved
in CR2 binding.
The analysis of the Con A binding to C3 from different
species revealed that in contrast to human and rabbit C3,
which contain Con A-binding carbohydrates in both the aand P-chains, trout C3, like frog and axolotl C3, lacks this
moiety in the a-chain (26). This suggests that the a-chain
potential glycosylation site isnot glycosylated. The absence of carbohydrates in the a-chain of trout C3 is of
particular interest because the a-chain carbohydrate moiety
onhuman C3 isinvolved in the binding to conglutinin
(51, 52). Thus, it will be of interest to determine whether
trout have a protein analogous to bovine or human conglutinin and whethersuch a protein exists to test its binding
specificity.
The conservation of Arg726Ser727in the a-chain of the
9
Hu
46
68 Kd
+
-97
different C3 suggests that the C3 convertases from these
species have similar specificities as in human complement.
The inactivation of C3b by factor I proceeds in three
steps (53-58) and requires one of the several cofactor molecules (membrane cofactor protein, CRl, CR2, H, C4bp).
The cleavage of the a-chain of C3b first between residues
1281-1282 (Arg-Ser) andbetween residues 1298-1299
(Arg-Ser) of C3 liberates the C3f fragment (M,2000) and
yields iC3b (53-56). A third factor I cleavage site, with
CR1, CR2, or factor H serving as cofactors (53-55,57), has
been reportedto occur at residues 932-933 (Arg-Glu) of the
a-chain of C3, generating the C3c and C3dg fragments
(56). Nilsson-Ekdahl etal. (58) suggested that factor I generates three different C3dg-like fragments. Their NH2terminal starts at residues 933 (cleavage between Arg-Glu),
939 (cleavage betweenLys-Glu), and 919, 924, or 930
(cleavage between Lys-Thr, Arg-Thr, or Arg-Leu). The
cleavages by factor I in the region between residues 918940 and the specificity of factor I have been a debatable
issue and so far no conclusive experiments havebeen
performed to clarify these issues.
As it relates to the factor I-mediated cleavages, of interest
are the findings (based on cDNA sequencing) that 1) ArgAla and Arg-Thr are found instead of Arg-Ser at the first
and second factor I cleavage sites of trout C3 (Fig. 4) and
2) His-Gly is found instead of Arg-Glu at the third factor
I cleavage site of trout C3 (residue 932-933). Currently, it
is unknown whether trout factor I cleaves trout C3 at ArgAla and bonds His-Gly. By sequencing the zymosan eluted
trout C3 fragments we foundthattrout factor I indeed
cleaves C3b at the Arg-Thr bond.These data taken together
with degradation of C4 (59,60) support our hypothesis that
factor I in the presence of the suitable cofactor can cleave
R-S/T bonds and that some of the observed cleavages may
be mediated by enzyme@) other than I. The latter is supported by the presence of sequences His-Thr, His-Leu,and
Gln-Gly at the proposed factor I cleavage site in rabbit,
mouse, and rat C3 (Fig. 4). Site-directed mutagenesis experiments and sequencing of factor I generated fragments
Journal of Immunology
of C3 from different species will help elucidate the factor
I specificity and its dependence on the different cofactors.
Another segment of trout C3 showing high amino acid
similarity with the corresponding segment of human C3 is
that between residues 1424-1432; this segment in human
C3 mediates P binding (61). However the Ser1432in human
C3 is Lysin trout C3. We found that trout C3 does not bind
to human P and a peptide spanning residues 1424-1433 of
trout C3 does not inhibit the binding of human C3 to human
P. These data emphasize the importance of S1432in C3b-P
interaction.
Acknowledgments
We thank Dr. C. Tsoukas for critical readingof our manuscript and Yang
Wang and Sabine Opermmann for excellent technical assistance.
References
1. Lambris, J. D. 1993. Chemistry, biology and phylogeny of
C3. Complement Profiles 1:16.
2. Dodds, A. W., and Day, A. J. 1993. The phylogeny and evolution of the complement system. Immunol. Med. 20:39.
3. De Bruijn, M. H. L., and G. H. Fey. 1985. Human complement component C3: cDNA coding sequence and derived
primary structure. Proc. Natl. Acad. Sci. USA 82:708.
4. Auerbach, H. S., R. Burger, A. Dodds, andH.R.
Colten.
1990. Molecular basis of complement C3 deficiency in guinea
pigs. J . Clin. Invest. 86:96.
5. Wetsel, R. A., A. Lundwall, F. Davidson, T. Gibson, B. F.
Tack, and G. H. Fey. 1984. Structure of murine complement
component C3. 11. Nucleotide sequence of cloned complementary DNA coding for the alpha chain. J. Biol. Chem.
259:13857.
6. Lundwall, A., R. A. Wetsel, H. Domdey, B. F. Tack, and
G. H. Fey. 1984. Structure of murine complement component C3 1: nucleotide sequence of cloned complementary
and genomic DNA coding for the P chain. J. Biol. Chem.
259:13851.
7. Misumi, Y., M. Sohda, and Y. Ikehara. 1990. Nucleotide and
deduced amino acid sequence of rat complement C3. Nucleic
Acids Res. 18:2178.
8. Ishiguro, H., K. Kobayashi, M. Suzuki, K. Titani, S.
Tomonaga, and Y. Kurosawa. 1992. Isolation of a hagfish
gene that encodesa complement component. EMBO J .
11:829.
9. Nonaka, M., and M. Takahashi. 1992. Complete complementary DNA sequence of the 3rd component of complement of
Lamprey: implication for the evolution of thioester containing proteins. J. Immunol. 148:3290.
10. Fritzinger, D. C., E. C. Petrella, M. B. Connelly, R.
Bredehorst, and C. W. Vogel. 1992. Primary structure of
cobra complement component C3. J . lmmunol. 149:3554.
11. Kusano, M., N. H. Choi, M. Tomita, K. Yamamoto, S. Migita,
T. Sekiya, and S. Nishimura. 1986. Nucleotide sequence of
cDNA and derived amino acid sequence of rabbit complement component C3 alpha-chain. lmmunol. Invest. 15:365.
12. Grossberger, D., A. Marcuz, L. Du Pasquier, and J. D.
Lambris. 1989. Conservation of structural and functional domains in complement component C3 of Xenopus and mammals. Proc. Natl. Acad. Sci. USA 86:1323.
61 3 3
13. Lambris, J. D. 1988. Themultifunctional role of C3, the third
component of complement. Immunol. Today 9:387.
14. Hase, S., N. Kikuchi, T. Ikenaka, and K. Inoue. 1985. Structures of sugar chains of the third component of human
complement. J. Biochem. 98:863.
15. Hirani, S., J. D. Lambris, and H. J. Muller-Eberhard. 1986.
Structural analysis of the asparagine-linked oligosaccharides of human complement component C3. Biochem. J .
233:613.
16. Tack, B. F. 1983. The P-Cys-y-Glu thiolester bond in human
C3, C4, and a2-macroglobulin. Springer Semin. Immunopathol. 6:259.
17. Levine, R. P., and A. W. Dodds. 1990. The thiolester bond
of C3. Curr. Top. Microbiol. Immunol. 153:73.
18. Volanakis, J. E. 1990. Participation of C3 and its ligands in
complement activation. Curr. Top. Microbiol. Immunol.
153:l.
19. Becherer, J. D., J. Alsenz, and J. D. Lambris. 1990. Molecular
aspects of C3 interactions and the structuralifunctional analysis of C3 from different species. Curr. Top. Microbiol.
Immunol. 153:45.
20. Fearon, D. T. and J. M. Ahearn. 1990. Complement receptor
type 1 (C3/C4b receptor; CD35) and complement receptor
type 2 (CSdiEpstein-Barr virus receptor; CD21). Curr. Top.
Microbiol. Immunol. 153:83.
21. Hugli, T. E. 1990. The anaphylatoxin C3a. Curr. Top.
Microbiol. Immunol. 153:181.
22. Rosen, H., and S. K. A. Law. 1990. Theleukocyte cell surface
receptor(s) for the iC3b product of complement. Curr. Top.
Microbiol. Immunol. 153:99.
23. Doolittle, R. F., and D. F. Feng. 1990. Nearest neighbor procedure for relating progressively aligned amino acid sequences. Methods Enzymol. 183:659.
24. Nonaka, M., S. Natsuume-Sakai, andM. Takahashi. 1981.
The complement system in rainbow trout (Salmo gairdneri).
J. Immunol. 126:1495.
25. Nonaka, M., M. Iwaki, C. Nakai, M. Nozaki, T. Kaidoh, S.
Natsuume-Sakai, and M. Takahashi. 1984. Purification of a
major serum protein of rainbow trout (Salmo gairdneri) homologous to the third component of mammalian complement.
J. Biol. Chem. 259:6327.
26. Alsenz, J., D. Avila, H. Huemer, I. Esparza, D. Becherer, T.
Kinoshita, Y. Wang, S. Oppermann, and J. D. Lambris. 1992.
Phylogeny of the third component of complement, C3: analysis of the conservation of human CR1, CR2, H and B binding
sites, ConA binding sites and thiolester bond in the C3 from
different species. Dev. Comp. Immunol. 16:63.
27. Nonaka, M.,M. hie, K. Tanabe, T. Kaidoh, S. NatsuumeSakai, andM. Takahashi. 1985. Identification and characterization of a variant of the third component of complement
(C3) in rainbow trout (Salmogairdneri)serum. J. Biol. Chem.
260:809.
28. Brade, V., G. D. Lee, A. Nicholson, H. Shin, and M. M.
Mayer. 1973. The reaction of zymosan with the properdin
system in normal and C4-deficient guinea pig serum. J.
Immunol. 111:1389.
29. Law, S. K., and R. P. Levine. 1977. lnteraction between the
third complement protein and cell surface macromolecules.
Proc. Natl. Acad. Sci. USA 74:2701.
30. Becherer, J. D., and J. D. Lambris. 1988. Identification of the
C3b-receptor binding domain in the third component of
complement. J. Biol. Chem. 263:14586.
61 34
31. Matsudaira, P. 1987. Sequence from picomole quantities of
proteinselectroblotted onto polyvinylidene diflouride membranes. J. Biol. Chem. 262:10035.
32. Laemmli, U. K. 1970. Cleavage of structural proteins during
the assembly of the head of bacteriophage T4. Nature
277:680.
33. Chirgwin, J., A. E. Przybla, R. J. MacDonald, and W. J.
Rutter. 1979. Biochemistry 18.5194.
34. Huynh, T. V., R. A. Young, and R. W. Davis. 1988. Constructing and screening cDNA libraries in IgtlO and Igtll. In
DNA Cloning: A Practical Approach. 3rd ed. D.M. Glover,
ed. IRL Press, Oxford, UK, p. 49.
35. Saiki, R. K., D. H. Gelfand, S. J. Stoffel, R. Higuchi, G. T.
Horn, and H. A. Erlich. 1988. Science 239:487.
36. Sanger, F. S., S. Nicklen, and A. R. Coulson. 1977. DNA
sequencing with chain-terminating inhibitors. Proc. Natl.
Acad. Sci. USA 74:5463.
37. Chothia, C., and A. M. Lesk. 1986. The relation between the
divergence of sequence and structure in proteins. EMBO J.
52323.
38. Pompton, D., and A. Nicolas. 1989. Protein engineering by
cDNA recombination in yeasts: shuffling of mammalian
cytochrome P-450 functions. Gene 83:15.
39. Isaac, L., and D. E. Isenman. 1992. Structural requirements
for thioester bond formation in human complement component C3: reassessment of the role of thioester bond integrity
on the conformation of C3. J. Biol. Chem. 267:10062.
40. Taniguchi-Sidle, A., and D. E. Isenman. 1992. Mutagenesis
of the Arg-Gly-Asp triplet in human complement
component-C3 does not abolish binding of iC3b to the leukocyte integrin complement receptor Type-I11(CR3, CDllbi
CD18). J. Biol. Chem. 267:635.
41. Zhao, B., G . Musci, Y. Susawara, and L. J. Berliner. 1988.
Spin label and fluorescence studies of the thiolester bonds in
alpha-2-macroglobulin. Biochemistry 27:5304.
42. Fontaine, M., J. P. Aubert,F. Joisel, and J. P. Lebreton.
1982. Structure-function relations in the third component of
human complement (C3)-I, hydrophobic sites. Mol. Immunol.
19:27.
43. Reid, K. B. M., D. R. Bentley, R. D. Campbell, L. P. Chung,
R. B. Sim, T. Kristensen, and B. F. Tack. 1986. Complement
system proteins which interact with C3b or C4b. Immunol.
Today 7:230.
44. Holers, V. M., J. L. Cole, D. M. Lublin, T. Seya, and J. P.
Atkinson. 1985. Human C3b- and C4b-regulatory proteins: a
new multi-gene family. Immunol. Today 6:188.
45. Farries, T. C., T. Seya, R. A. Harrison, and J. P. Atkinson.
1990. Competition for binding sites on C3b by CR1, CR2,
MCP factor B and factor H. Complement Inflammation 7:30.
46. Pangburn, M. K. 1986. Differences between the binding sites
of the complement regulatory proteins DAF, CR1,and factor
H on C3 convertases. J. Immunol. 136:2216.
TROUT C3
47. Becherer, J. D., J. Alsenz, I. Esparza, C. E. Hack, and J. D.
Lambris. 1992. A segment spanning residues 727-768 of the
complement C3 sequence contains a neoantigenic site and
accommodates binding of CR1, factor H and factor B.
Biochemistry 31 :I 787.
48. Fishelson, Z. 1991. Complement-C3: a molecular mosaic of
binding sites. Mol. Immunol. 28:545.
49. Esparza, I., J. D. Becherer, J. Alsenz, A. Delahera, Z. Lao,
C. D. Tsoukas,and J. D. Lambris. 1991. Evidence for multiple
sites of interaction in C3 for complement receptor type-2
(C3diEBV receptor, CD21). Eur. J. Immunol. 21:2829.
50. Lambris, J. D., D. Avila, J. D. Becherer, and H. J. MullerEberhard. 1988. A discontinuous factor H binding site in the
third component of complement as delineated by synthetic
peptides. J. Biol. Chem. 263:12147.
51. Hirani, S., J. D. Lambris, and H. J. Muller-Eberhard. 1985.
Localization of the conglutinin binding site on the third component of human complement. J. Immunol. 134:1105.
52. Thiel, S., G. Baatrup, P. Friis-Christiansen, S.-E. Svehag, and
J. C. Jensenius. 1987. Characterization of a lecitin in human
plasma analogous to bovine conglutinin. Scand. J. Immunol.
26:461.
53. Ross, G. D., J. D. Lambris, J. A. Cain, and S. L. Newman.
1982. Generation of three different fragments of bound C3
with purified factor I or serum. I. Requirements for factor H
vs CR1 cofactor activity. J. Immunol. 129:2051.
54. Medof, M. E., K. Iida, C. Mold, and V. Nussenzweig. 1982.
Unique role of the complement receptor CR1 in the degradation of C3b associated with immune complexes. J. Exp.
Med. 156:1739.
55. Medicus, R. G., J. Melamed, and M. A. Arnaout. 1983. Role
of human factor I and C3b receptor in the cleavage of surfacebound C3b. Eur. J. Immunol. 13:465.
56. Davis, A. E. 111, and R. A. Harrison. 1982. Structural Characterization of factor I mediated cleavage of the third component of complement. Biochemistry 21:5745.
57. Mitomo, K., T. Fujita, and K. Iida. 1987. Functional and antigenic properties of complement receptor type 2, CR2.
J. Exp. Med. 165:1424.
58. Ekdahl, K. N., U. R. Nilsson, and B. Nilsson. 1990. Inhibition
of factor I by diisopropylfluorophosphate:evidence of factor
I conformational changes in factor I induced by C3b and
additional studies on the specificity of factor I. J. Immunol.
144:4269.
59. Press, E. M., and J. Gagnon. 1981. Human complement component C4. Biochem. J. 199:351.
60. Campbell, R. D., J. Gagnon, and R. R. Porter. 1981. Amino
acid sequence around the thiol and reactive acyl groups of
human complement component C4. Biochem. J . 199:359.
61. Daoudaki, M. E., J. D. Becherer, and J. D. Lambris. 1988. A
34-amino acid peptide of the third component of complement
mediates properdin binding. J . Immunol. 140:1577.