Hands on Human Evolution:
A Laboratory Based Approach
Margarita Hernandez
Summer Science Institute:
Exploring the Tree of Life
July 15, 2015
What organisms evolve?
Misconceptions about Human
Evolution
We came from monkeys!
Misconceptions about Human
Evolution
We are no longer evolving!
All in the Family (or should I say
genus?)
What you’ll be doing today…
• Familiarizing yourself with species closely
related to Homo sapiens
• Exploring morphological features of several
hominids and hominins
• Determining what trends are evident from
these casts
• Looking at relatedness of extant species using
both morphological and genetic data
Part 1: Lab Station Rotations
•
•
•
•
•
Small groups (4-5 people)
7-8 minutes per station
Packets to guide you through the stations
Human evolution tree hand out
Work together! Think and collaborate!
Part 2: Genetic Data Activities
• We will be working with:
– Chromosomes
– Amino acid sequences
– Base pair sequences
• Continue working in your groups
Station 1: Cranial Capacity in the genus Homo
At this station, the following casts are present: H. habilis, H. erectus, H. neanderthalensis and H.
sapiens (your species name). All of these species are within the genus Homo, which is the same
genus we are part of. Using the beans and measuring apparatus, determine which species has
the largest brain capacity, which has the middle brain capacity and which has the smallest.
Directions for measuring brain capacity:
1. Place skull upside-down on the cushion provided for you. This will aid in the stability
and protection of the skull during this activity.
2. Place the funnel inside of the foramen magnum (hole at the bottom on the skull where
the spinal cord would be).
3. Using your small cup, scoop out beans and begin funneling them into the skull.
4. Make sure to move the beans around in the skull in order to ensure that all places
inside the cranium are filled with beans.
5. Once the skull is full, carefully dump the beans from the skull into a large beaker by
simply turning the skull right side up into the glassware. Make sure to have a good grip
on the skull as it can get heavy due to the added weight of the beans.
6. Make sure all the beans are transferred from the skull into the beaker. This may take a
bit of shaking of the skull.
7. Measure the amount of beans you have in mL. In the metric system, mL = cm 3, which is
a standard measurement for volume. Use cm3 to record skull volume.
H. habilis: ____________
H. erectus: ____________
H. neanderthalensis: ______________
Based on the phylogeny given to you, what brain capacity would you expect modern day
humans, H. sapiens, to have and why?
Using the H. sapiens skull as your reference, what differences do you see between anatomically
modern humans and e other three species in front of you?
Using your phylogeny, line the skulls up from the oldest to the youngest in terms of existence
on Earth. What general trends do you see going from the oldest to the youngest species?
Station 2: Bipedalism
Shown here are the hip bones of various species of hominids. Chimpanzees walk on all four
limbs (quadrupedal) and have a very distinct hip morphology. Their hip bones are orientated
along their backs and are very slender and narrow. Modern day humans have a drastically
different hip morphology due to the fact that we walk on two legs (bipedal). Human hips are
oriented beneath the body and are wider and more “bowl” shaped.
Based on the above descriptions, circle the form of locomotion you think the species below
had. Use their hip morphology as an indicator.
Australopithecus afarensis
Quadrupedal
Bipedal
Quadrupedal
Bipedal
Ardipithecus ramidus
What does this tell us about the appearance of bipedalism during the course of human
evolution?
Station 3: Apes and Humans
At this station, small scale casts are present for modern day humans, gorillas and chimpanzees.
List the physical similarities between gorillas and chimps.
List the physical differences between the group of apes and humans.
What similarities do you see in all three species?
Based on all the characteristics listed above, draw a small level phylogeny for the three species,
denoting which two you think are more closely related to each other, with the exclusion of the
third.
Station 4: Cranial Capacity in the Australopithecines
At this station are members of the genus Australopithecus. The following casts are present: A.
africanus and A. afarensis. Using the beans and measuring apparatus, determine which species
has the largest brain capacity and which has the smallest.
Directions for measuring brain capacity:
1. Place skull upside-down on the cushion provided for you. This will aid in the stability and
protection of the skull during this activity.
2. Place the funnel inside of the foramen magnum (hole at the bottom on the skull where
the spinal cord would be).
3. Using your small cup, scoop out beans and begin funneling them into the skull.
4. Make sure to move the beans around in the skull in order to ensure that all places inside
the cranium are filled with beans.
5. Once the skull is full, carefully dump the beans from the skull into a large beaker by
simply turning the skull right side up into the glassware. Make sure to have a good grip
on the skull as it can get heavy due to the added weight of the beans.
6. Make sure all the beans are transferred from the skull into the beaker. This may take a
bit of shaking of the skull.
7. Measure the amount of beans you have in mL. In the metric system, mL = cm 3, which is
a standard measurement for volume. Use cm3 to record skull volume.
A. africanus: ______________
A. afarensis: ______________
What major similarities and differences do you see between these two species?
Station 5: Investigating differences between Homo and Australopithecus
At this station, small scale casts are present from two species within the genus Homo and two
species within the genus Australopithecus. Without looking at their tags, what two do you think
belong in each respective genus and why? Use the numbers in front of each species in order to
discuss them below.
What are the major differences between the two groups?
Using your phylogeny and the names of the species on their tags, order the species from the
oldest to youngest. What features do you see change over the course of the millions of years
between these species?
Station 6: Ardipithecus ramidus
In the station are images of the skeletons of A. ramidus (Ardi), Gorilla gorilla (Gorilla), and
Homo sapiens.
Provided for you is a triple Venn diagram for you to compare and contrast each species to each
other.
Which species does Ardi appear to be more similar to? Remember, many of these fossils show a
mosaic of traits that are particular to both species. This is important to keep in mind, as the
ancestors of certain lineages will also have a mosaic of traits for the species they gave rise to.
Station 7: How do you teach evolution?
At this station you will notice large poster papers and markers for your use. Write your
methodology for teaching human evolution in the classroom or if you do not teach this topic. If
a previous group wrote a methodology you use, draw a large red dot next to it. If a previous
group wrote a methodology you would like to use, draw a green star. We will discuss these
approaches after the activity.
Station 1: Cranial Capacity in the genus Homo
At this station, the following casts are present: H. habilis, H. erectus, H. neanderthalensis and H.
sapiens (your species name). All of these species are within the genus Homo, which is the same
genus we are part of. Using the beans and measuring apparatus, determine which species has
the largest brain capacity, which has the middle brain capacity and which has the smallest.
Directions for measuring brain capacity:
1. Place skull upside-down on the cushion provided for you. This will aid in the stability and
protection of the skull during this activity.
2. Place the funnel inside of the foramen magnum (hole at the bottom on the skull where
the spinal cord would be).
3. Using your small cup, scoop out beans and begin funneling them into the skull.
4. Make sure to move the beans around in the skull in order to ensure that all places inside
the cranium are filled with beans.
5. Once the skull is full, carefully dump the beans from the skull into a large beaker by
simply turning the skull right side up into the glassware. Make sure to have a good grip
on the skull as it can get heavy due to the added weight of the beans.
6. Make sure all the beans are transferred from the skull into the beaker. This may take a
bit of shaking of the skull.
7. Measure the amount of beans you have in mL. In the metric system, mL = cm 3, which is
a standard measurement for volume. Use cm3 to record skull volume.
H. habilis: __smallest_____(~620 cm3)
H. erectus: __middle_____(~880 cm3)
H. neanderthalensis: _largest___(~1400 cm3)
Based on the phylogeny given to you, what brain capacity would you expect modern day
humans, H. sapiens, to have and why?
H. sapiens would be expected to have a larger brain capacity than any of the species mentioned
above. This would be because one of the trends within human evolution is that later species
have larger brains.
Using the H. sapiens skull as your reference, what differences do you see between anatomically
modern humans and the other three species in front of you?
H. habilis has a broader gave, smaller brain case, and more robust features.
H. erectus has a sagittal keel present, very prominent brow ridges and a more protruding facial
region.
H. neanderthalensis also has prominent brow ridges, but more gracile than H. erectus. The
features of this skull are overall more gracile and has a more protruding facial region.
Using your phylogeny, line the skulls up from the oldest to the youngest in terms of existence
on Earth. What general trends do you see going from the oldest to the youngest species?
More robust to less robust.
Brow ridges present to no brow ridges.
Mid facial region becomes less protruding as you get younger.
Station 2: Bipedalism
Shown here are the hip bones of various species of hominids. Chimpanzees walk on all four
limbs and have a very distinct hip morphology. Their hip bones are orientated along their backs
and are very slender and narrow. Modern day humans have a drastically different hip
morphology due to our bipedal form of locomotion. Human hips are oriented beneath the body
and are wider and more “bowl” shaped.
Based on the above descriptions, circle the form of locomotion you think the species below
had. Use their hip morphology as an indicator.
Australopithecus afarensis
Quadrupedal
Bipedal
Quadrupedal
Bipedal
Ardipithecus ramidus
What does this tell us about the appearance of bipedalism during the course of human
evolution?
Bipedalism appeared very early in human evolution. The ability to walk on two legs within our
evolution history must have evolved over 4 million years ago. This differs from the time we see
increased brain capacity in Homo, as the genus must have evolved just over 2 million years ago.
What we see here is that characteristics that make us strictly “human” were acquired at
different times over our evolutionary history.
Station 3: Apes and Humans
At this station, small scale casts are present for modern day humans, gorillas and chimpanzees.
List the physical similarities between gorillas and chimps.
Presence of sagittal crest. Robusticity of skull. Large canines. Strong brow ridges. Protruding
lower face etc.
List the physical differences between the group of apes and humans.
Humans more gracile. Humans have smaller canines. They have a more gracile skull etc.
What similarities do you see in all three species?
Same number and types of teeth. Post orbital closure etc.
Based on all the characteristics listed above, draw a small level phylogeny for the three species,
denoting which two you think are more closely related to each other, with the exclusion of the
third.
Humans and chimps are more closely related to each other, with gorillas falling outside that
clade. The students may say that chimps and gorillas are more closely related. We will further
explore why morphological features may not always hold the key to phylogenetic relationships.
Station 4: Cranial Capacity in the Australopithecines
At this station are members of the genus Australopithecus. The following casts are present: A.
africanus and A. afarensis. Using the beans and measuring apparatus, determine which species
has the largest brain capacity and which has the smallest.
Directions for measuring brain capacity:
1. Place skull upside-down on the cushion provided for you. This will aid in the stability
and protection of the skull during this activity.
2. Place the funnel inside of the foramen magnum (hole at the bottom on the skull where
the spinal cord would be).
3. Using your small cup, scoop out beans and begin funneling them into the skull.
4. Make sure to move the beans around in the skull in order to ensure that all places
inside the cranium are filled with beans.
5. Once the skull is full, carefully dump the beans from the skull into a large beaker by
simply turning the skull right side up into the glassware. Make sure to have a good grip
on the skull as it can get heavy due to the added weight of the beans.
6. Make sure all the beans are transferred from the skull into the beaker. This may take a
bit of shaking of the skull.
7. Measure the amount of beans you have in mL. In the metric system, mL = cm 3, which is
a standard measurement for volume. Use cm3 to record skull volume.
A. africanus: _____largest_ (~320 cm3)___
A. afarensis: ____smallest_(~250 cm3)____
What major similarities and differences do you see between these two species?
Presence of brow ridges. Small brain cases. Protrusion of the lower face.
Station 5: Investigating differences between Homo and Australopithecus
At this station, small scale casts are present from two species within the genus Homo and two
species within the genus Australopithecus. Without looking at their tags, what two do you think
belong in each respective genus and why? Use the numbers in front of each species in order to
discuss them below.
What are the major differences between the two groups?
The australopithecines have a smaller brain case than the members of the genus Homo. Their
skulls are overall more robust and they have more protrusion of the lower face. The nuccal area
of the australopithecines is also larger and more robust.
Using your phylogeny and the names of the species on their tags, order the species from the
oldest to youngest. What features do you see change over the course of the millions of years
between these species?
Getting more gracile from oldest to youngest. Larger brain case from oldest to youngest.
Station 6: Ardipithecus ramidus
In the station are images of the skeletons of A. ramidus (Ardi), Gorilla gorilla (Gorilla), and
Homo sapiens.
Provided for you is a triple Venn diagram for you to compare and contrast each species to each
other.
Which species does Ardi appear to be more similar to? Remember, many of these fossils show a
mosaic of traits that are particular to both species. This is important to keep in mind, as the
ancestors of certain lineages will also have a mosaic of traits for the species they gave rise to.
Ardi is a bipedal ape. It shares many similarities between both species and clearly shows
transitions from an ape like ancestor for chimps and humans to a more human like appearance.
Station 7: How do you teach evolution?
At this station you will notice large poster papers and markers for your use. Write your
methodology for teaching human evolution in the classroom or if you do not teach this topic. If
a previous group wrote a methodology you use, draw a large red dot next to it. If a previous
group wrote a methodology you would like to use, draw a green star. We will discuss these
approaches after the activity.
Answers will vary.
Gorilla



Ardi
Thick bones
Large canines
Tall and narrow hips




Divergent toe
Wide rib cage
Presence of brow ridge
Robust cranial features

All primate
features


Human




Gracile facial features
Toe is not divergent
Narrow rib cage
Large brain case
Thinner bones
Small canines
1
3
2
4
5
7
6
CBE—Life Sciences Education
Vol. 9, 513–523, Winter 2010
Article
Teaching the Process of Molecular Phylogeny
and Systematics: A Multi-Part Inquiry-Based Exercise
Nathan H. Lents, Oscar E. Cifuentes, and Anthony Carpi
Department of Sciences, John Jay College, The City University of New York, New York, NY 10019
Submitted October 13, 2009; Revised February 16, 2010; Accepted April 12, 2010
Monitoring Editor: John Jungck
Three approaches to molecular phylogenetics are demonstrated to biology students as they
explore molecular data from Homo sapiens and four related primates. By analyzing DNA sequences, protein sequences, and chromosomal maps, students are repeatedly challenged to
develop hypotheses regarding the ancestry of the five species. Although these exercises were
designed to supplement and enhance classroom instruction on phylogeny, cladistics, and systematics in the context of a postsecondary majors-level introductory biology course, the activities
themselves require very little prior student exposure to these topics. Thus, they are well suited
for students in a wide range of educational levels, including a biology class at the secondary
level. In implementing this exercise, we have observed measurable gains, both in student
comprehension of molecular phylogeny and in their acceptance of modern evolutionary theory.
By engaging students in modern phylogenetic activities, these students better understood how
biologists are currently using molecular data to develop a more complete picture of the shared
ancestry of all living things.
INTRODUCTION
Teaching fundamental mechanisms of evolution by natural
selection is more important than ever, both to biology students and the general student population, and fresh pedagogical approaches to accomplish this are needed at all
levels (Dagher and BouJaoude, 1997; Robbins and Roy, 2007;
Labov and Kline Pope, 2008). Perhaps more than any other
subdiscipline of biological sciences, the study of systematics
tangibly and powerfully invokes the biological results of
evolution and selection. Thus, its inclusion throughout all
levels of the biology curriculum has long been strongly
recommended. However, as powerfully argued by Rudolph
and Stewart (1998), misunderstandings about evolution are
DOI: 10.1187/cbe.09 –10 – 0076
Address correspondence to: Nathan H. Lents ([email protected]).
© 2010 N. H. Lents et al. CBE—Life Sciences Education © 2010 The American
Society for Cell Biology. This article is distributed by The American Society
for Cell Biology under license from the author(s). It is available to the
public under an Attribution–Noncommercial–Share Alike 3.0 Unported
Creative Commons License (http://creativecommons.org/licenses/bync-sa/3.0).
largely philosophical, rooted in a poor understanding of the
scientific method and how it applies to the study of natural
history. Indeed, even advanced biology students can harbor
striking misconceptions regarding the fundamental basis of
evolutionary history (O’Hara, 1997; Robbins and Roy, 2007).
This lack of fundamental understanding by students is
compounded by the seemingly subtle differences among
different systematic approaches. Phenetics seeks to classify
organisms based on observable differences regardless of
evolutionary history, while cladistics, which also examines
observable characteristics, has the explicit goal of inferring
shared ancestry and constructing a hierarchical classification. Molecular phylogenetics is similar to cladistics, but
instead of relying on primitive and derived morphological
characteristics, it uses molecular sequence data and other
quantifiable measures to establish data matrices to infer
likely evolutionary relationships. Further, there exists a variety of possible forms for expressing the results of systematic analyses: phylogenetic trees, cladograms, phylograms,
dendograms, ultrametric trees, etc. Thus, it is not surprising
that students sometimes fail to grasp the larger conceptual
framework amid this disciplinary complexity.
513
Supplemental Material can be found at:
http://www.lifescied.org/content/suppl/2010/11/22/9.4.513.DC1.html
Downloaded from http://www.lifescied.org/ by guest on June 30, 2015
N. H. Lents et al.
Explicitly teaching the process and nature of scientific
research results in considerable learning gains, among
science majors and nonmajors alike (Lederman, 1992,
1999; Lombrozo et al., 2008). The National Academy of
Science (NAS) and the National Science Foundation (NSF)
have explicitly called for the teaching of the practice of
science within the existing science curricula, especially in
relation to evolutionary theory (Alberts and Labov, 2004;
Miller et al., 2006; Ayala, 2008). However, this pedagogical
approach is not trivial to implement. First, there are at
least two distinct conceptual frameworks to consider: the
philosophical nature of the scientific pursuit, and the trueto-life realities of the modern scientific practice, which are
markedly different among disciplines (Matthews, 1994;
Rudolph and Stewart, 1998; Staver, 1998; Schwartz and
Lederman, 2002). Second, using real datasets that challenge students to apply scientific concepts and analysis is
key to learning scientific thinking (Wise and Okey, 1983;
Soloway et al., 1999). These active-learning methods are
often met with student confusion and resistance, especially if they have not learned this way before (Gosser,
2003; Shetlar, 2005). Considerably more effort and thought
is required of students, compared with traditional passive
learning approaches involving didactic lectures and protocol-driven laboratory exercises in which students simply follow clear experimental procedures and interpret
data as instructed (Hofstein and Lunetta, 2004; Hanauer et
al., 2006).
Several new educational resources have emerged that specifically give attention to the methods and practice of the modern field of systematics (Clough, 1994; Alles, 2001; Perry et al.,
2008). Because the majority of biology students don’t properly
grasp discrete information conveyed by a simple phylogenetic
tree, groups including the “tree-thinking group” (http://treethinking.org) have resolved to develop resources and support
for biology teachers at all levels (O’Hara, 1997; Baum et al.,
2005). Other tools include the Understanding Evolution resource (http://evolution.berkeley.edu) from the University of
California Museum of Paleontology in Berkeley, CA, resources
from the NAS (www.nationalacademies.org/evolution/
index.html), the Public Broadcasting Station (www.pbs.
org/wgbh/evolution), and Visionlearning (visionlearning.
com), which is funded by the NSF and the U.S. Department
of Education.
In designing the educational method described herein,
we aimed to develop another teaching tool for demonstrating the modern practice of molecular phylogenetics
by using actual datasets and challenging students to interpret those data using their own skills in deductive
reasoning. We do this by providing DNA sequences, protein sequences, and chromosomal electron density maps
of five closely related species, and then asking students to
make simple hypotheses regarding the phylogeny of these
species. There are several unique features of this approach. First, by having students participate in the scientific process of hypothesis-making, they gain familiarity
with “what scientists do” with experimental data. Second,
by engaging several types of data addressing the same
underlying question, we demonstrate to students how
scientists use multiple lines of evidence to support or
refute hypotheses. Third, by exposing students to raw
data that can be used to elucidate the common evolution-
ary origins of related species, we may break through
resistance that some students have to evolution in general
(Clough, 1994; Lombrozo et al., 2008; Perry et al., 2008). In
our chosen method of implementation, unbeknownst to
the students, the raw data they will be handling are
taken from Homo sapiens and four closely related primates,
thus shedding light on the biological origin of humanity.
Fourth, the method that students will use, comparative
genomics, is currently used by evolutionary biologists
in exactly this context (Zhu et al., 2007), thus accurately
“mimicking” a relevant and cutting-edge scientific
practice.
EXPERIMENTAL METHODS
Student Assessment Groups
Assessment took place in spring of 2009 in the course
Biology 104 (Bio104), Principles of Modern Biology II, the
second semester of the majors-track introductory biology
course at John Jay College, a large, urban, minority-serving institution, and part of the City University of New
York (CUNY) university system. All three activities were
conducted in one 2.5-h laboratory session, with students
working in their normal laboratory group (pairs). The
laboratory took place after the second week of the course,
immediately after the course lecture on phylogeny and
systematics, which follows lectures on natural selection,
micro- and macroevolution, speciation, and Hardy–Weinberg equilibrium. Two laboratory sections (28 students
each) meet jointly for course lectures. For the assessment,
both lab sections met with the same course instructor at
the same time, thus providing for a case-controlled
experimental design. One lab section completed the traditional laboratory exercise [chapters 20 and 21 of the
Helms biology laboratory manual (Helms et al., 1998)]
and is referred to as the control section, while the
experimental section completed the exercises described
herein.
Performance on Exam Questions
The three phylogeny-related exam questions referred to in
the Assessment of the Activity section were as follows:
Q1. If two modern organisms are distantly related in an
evolutionary sense, then one should expect that…
A1. they should share fewer homologous structures than
two more closely related organisms.
Q2. In evolutionary terms, the more closely related two
different organisms are, the…
A2. more recently they shared a common ancestor.
Q3. The theory of evolution is most accurately
described as…
A3. an overarching explanation, supported by much
evidence, for how populations change over time.
These questions were given in multiple-choice format
(other answer choices are available upon request), and the
results shown in the Assessment of the Activity section
represent the percentage in each group that selected the
correct answer.
514
CBE—Life Sciences Education
Downloaded from http://www.lifescied.org/ by guest on June 30, 2015
Teaching Molecular Phylogeny
Surveys Regarding Perceptions of Evolution
The surveys used in this study (results shown Assessment
of the Activity section) were devised and twice validated by
administration to similar student sections in previous semesters and were deemed exempt from full panel review by
the John Jay College Institutional Review Board (IRB). Several “control statements” were included regarding the acceptance of the scientific validity of current understandings of geologic time, which had shown in previous
validations of this survey to be relatively stable in group
responses before and after learning about evolution in
detail. Next, we included a series of overlapping statements about 1) evolution, 2) natural selection, and 3) how
those processes contributed to the emergence of Homo
sapiens, which, in previous validations, had generated
responses that were subject to change as students studied
the mechanisms of evolution.
For this survey, students were asked to report their acceptance of the statements on a five-point scale: strongly agree,
agree, neither agree nor disagree, disagree, strongly disagree. Importantly, similar concepts were repeated in several variations, because studies have shown that students
may key in to certain “trigger words” including theory,
Darwin, evolution, scientists, and descent; and different
wordings can lead to different survey results, even with the
same students (Evans, 2001; Scott and Branch, 2009). For
most statements, a response of “strongly agree” was scored
as a “1” and indicated the strongest acceptance of current
scientific theory, while a response of “strongly disagree”
was scored as a “5” and indicated the strongest opposition to
current scientific theory. However, three statements were
expressed as “inverts,” such that agreement would indicate
a rejection of currently accepted scientific theory. The numerical scoring of these questions was inverted to maintain
the pattern that the lowest score indicates the strongest
acceptance of scientific theory. The survey questions were as
follows:
Control Questions
C1. I agree with the scientific evidence that dates the
earth to more than 4 billion years of age.
**C2. Although some scientists claim otherwise, the
earth is not more than 10,000 years old.
C3. I agree with the theory that, over the course of
time, the positions of the great land masses
(continents) have undergone many dramatic
changes.
Probative Questions
**Q1. I believe that, with only a few exceptions, the life
forms that exist on the planet today are, more or
less, the same that have always been here since
life first began on earth.
Q2. I believe that, over many generations, natural
selection has contributed to the gradual evolution
of animals and plants into their present forms.
**Q3. I believe that evolution by natural selection is just
one theory about how life on earth came to its
present form and I personally don’t support it.
Q4. I feel that a large body of evidence supports the
Darwinian theory of evolution by natural
selection.
Q5. I support the theory that the biological species,
Homo sapiens (Human beings) evolved from an
earlier species of primates.
Q6. I agree with Charles Darwin, who first suggested
that the current form of human beings was
influenced through the process of evolution by
natural selection.
Q7. Because human beings are mammals, I believe
that they have a shared ancestry with all other
mammals.
Q8. I believe that human beings descended to their
present form through natural processes, including
natural selection.
**⫽inverted statements; scoring is reversed.
Survey responses were tabulated, scores for invert statements were reversed, and group patterns were analyzed.
First, responses to the control questions were analyzed to
ensure that the two groups were comparable. To assess
changes in perception, we scrutinized pre- and posttreatment responses to identical questions and performed the
following calculation on the “average group scores”
(arithmetic mean) to individual questions: 100% ⫻ (pre ⫺
post)/pre. By placing the pretest values in the denominator, this formula normalizes for beginning differences in
the two student groups and expresses change relative to
the initial condition. Error bars were added to indicate
relative variance in survey responses, as calculated by the
following formula: (SD)/(average response) multiplied by
the “percent change” score for that question for proper
scaling.
DESCRIPTION OF THE ACTIVITIES
This activity, suitable for laboratory, discussion, or any other
group work setting, is broken into three parts. Although common connections are drawn at the conclusion, each individual
part could be done at different times or stand entirely on its
own. Further, each part could be simplified, further extended
to include a quantitative parsimony analysis, or otherwise
modified, as explained within each description. Thus, these
exercises are flexible and can accommodate many teaching
environments. The driving theme is to provide actual scientific
data to students and challenge them to draw conclusions about
the data in ways that lead them to propose a hypothetical
phylogram describing the evolutionary relatedness of the species involved. Although it may be best if these activities follow
a lecture on systematics that covers the differences between
cladistics and phylogenetics, as we have done, this may not be
strictly essential and a short primer on systematics (see www.
ncbi.nlm.nih.gov/About/primer/phylo.html) might suffice,
depending on the academic background of the students. The
complete student handout for this exercise is provided as
Supplemental Material 1, while the complete instructor
guide is provided as Supplemental Material 2.
Vol. 9, Winter 2010
515
Downloaded from http://www.lifescied.org/ by guest on June 30, 2015
N. H. Lents et al.
Figure 1. (A) Aligned genomic DNA sequences from the GULO pseudogene taken from the short arm of chromosome #8 (8p21 in
humans) of the following species: #1 ⫽ Pan troglodytes, #2 ⫽ Pongo pygmaeus, #3 ⫽ Homo sapiens, and #4 ⫽ Macaca mulatta. (B)
The discrete nucleotide differences among the four DNA sequences have been highlighted. The asterisks indicate key positions that
help reveal ancestry. (C) The most likely phylogram indicating the ancestry and divergence of the species based on these DNA
sequences.
Activity One: Molecular Phylogenetics Using a
Pseudogene
In the first activity, students are given four short DNA
sequences (Ohta and Nishikimi, 1999), shown in Figure 1A,
with a brief description.
• Below are four gene sequences. These are taken from four
animals that are believed to have “recent shared ancestry”
(are closely related).
• The gene sequences are from a so-called “broken gene” or
pseudogene, the evolutionary remnant of a gene, which is
now nonfunctional, in a given species or group of related
species. In this case, the gene is called GULO (L-gulonolactone oxidase), which codes for the enzyme which catalyzes a
key step in the synthesis of ascorbic acid (vitamin C). Along
the way, some animals have lost the function of this gene (by
random mutation) and must consume vitamin C in their
diet.
Procedure
1. Examine the four gene sequences below and mark any
differences among the sequences that you can find.
2. Discuss the following questions with your lab partner: Do
you notice any specific pattern? What could this pattern
mean regarding the ancestry/relatedness of the four species?
3. Together with your lab partner, make a hypothesis about
the ancestry of these four species in the form of a phylogenetic tree. Draw this tree on a separate sheet of paper and
make a few notes explaining why you drew it this way.
In an effort to reduce intellectual resistance to the topic, we
elect not to reveal the identity of the species until all activities are complete (Lombrozo et al., 2008). Studies have
shown that many self-identified Christians in the United
States have brokered a psychological compromise between
science and faith by accepting the validity of geologic time
and evolutionary change but maintaining that these processes had little to do with the divinely instituted emergence
of Homo sapiens (Smith, 1994; Meadows et al., 2000; Miller et
al., 2006). The DNA sequences are derived from a pseudogene, which opens up an interesting discussion in itself
(Nishikimi and Yagi, 1991; Eyre-Walker and Keightley,
1999). As students begin to examine the DNA sequences,
they have little trouble identifying the differences between
the species, highlighted in Figure 1B. However, if students
are then unsure what to do next, we let them wander
through the initial confusion and discuss how to approach
the problem with their lab partner and other classmates,
reinforcing the collaborative nature of scientific research.
Eventually, students focus on the differences marked with
asterisk in Figure 1B, and nearly all student pairs draw a
phylogram similar to that shown in Figure 1C. A quantitative analysis of parsimony might enrich this activity significantly for more advanced students. Based upon such a
quantitative parsimony analysis, the phylogram shown in
Figure 1C is indeed the most parsimonious relationship
based on these DNA sequences (data not shown).
Activity Two: Amino Acid Sequences of Functional
Homologous Proteins
In this activity, we present students with sequences from
related species and challenge them to deduce a phylogram.
However, this exercise is more complicated because there
are sequences provided from five species, and students are
provided with the amino acid sequences of a functional
protein, chromosome-encoded SCML1 protein that func-
516
CBE—Life Sciences Education
Downloaded from http://www.lifescied.org/ by guest on June 30, 2015
Teaching Molecular Phylogeny
tions in male embryonic development and male fertility (van
de Vosse et al., 1998; Wu and Su, 2008). Because mutation
and evolutionary change are more “constrained” in a protein sequence (Nachman and Crowell, 2000), these sequences utilize the “…/…” symbol to denote long stretches
of protein sequence with no differences in amino acids. This
opens a discussion of different silent mutations that might
be present in these species, both of the wobble and intronic
variety. The five sequences provided to students are shown
in Figure 2A (Wu and Su, 2008).
The differences between the homologous sequences, highlighted in black in Figure 2B, are more numerous in this
activity, but because of the practice they had in activity one,
students are more prepared to “see through the noise” and
ignore instances in which one species has a unique amino
acid at a certain position. Another new challenge faced by
students in this activity is the inclusion of data from five
species, instead of just four, which will require a more
complicated phylogram. Although most of the student
groups will notice the early divergence of the ancestor of #1
and #2, from the ancestor of #4 and #5, these same groups
are often split evenly regarding which side of the branch
point includes the most recent unique ancestor of species #3.
Thus, most students begin by constructing their phylograms
according to one of the options shown in Figure 2C, evenly
split between the two possibilities.
The fact that two hypothetical phylograms are nearly
equally likely provides a good teaching moment as this
introduces the nature of scientific controversy and debate.
We encourage students to present data for their position,
and we have observed that some lab groups argue strongly
that, using the positions marked with an asterisk in Figure
2B, there are three examples of species #3 being similar to #1
and #2, and only two examples when #3 is similar to #4 and
#5. Because three is more than two, this does argue, albeit
weakly, that the convergence of species #3 from #1 and #2
was more recent than its divergence from #4 and #5. This
opens a discussion of “weight of evidence” and the need for
much larger sets of sequence data, from many genes, to
build stronger hypotheses. Further still, this provides a nice
segue to the next activity, which is a wholly different
method of analysis, and how scientific research relies on
Figure 2. (A) Aligned amino acid sequences from the SCML1 gene product of the following species: #1 ⫽ Homo sapiens, #2 ⫽ Pan troglodytes,
#3 ⫽ Gorilla gorilla, #4 ⫽ Pongo pygmaeus, and #5 ⫽ Macaca mulatta. The symbol …/… indicates a long stretch of amino acids with no
differences among the species. (B) The discrete amino acid differences among the five protein sequences have been highlighted. The asterisks
indicate key positions that help reveal ancestry. (C) The two most likely phylograms indicating the first (most distant) divergence of the
species based on these protein sequences. (D) The two most likely complete phylograms indicating the ancestry of the species based on these
protein sequences.
Vol. 9, Winter 2010
517
Downloaded from http://www.lifescied.org/ by guest on June 30, 2015
N. H. Lents et al.
multiple lines of evidence from different methodologies,
resulting in an inherently self-correcting march toward a
more detailed understanding of the natural world.
Activity Three: Electron Density Maps of
Chromosomes
In the final activity, students are given chromosomal maps
(cytogenetic ideograms) of a few of the larger chromosomes
from four different species (Murphy et al., 2005). This opens
up a short discussion about euchromatin versus heterochromatin, and how and why some DNA is kept “silent” (Yunis
and Prakash, 1982). The maps are shown in Figure 3A and
are provided to students with the chromosomes clearly arranged by species. Students are instructed to cut each chromosome out and compare them to each other in a search for
homologous chromosomes shared by all four species. After
some time, most student groups identify the three sets of
homologues shared by all species (Figure 3B).
Concentrating only on the three sets of homologues, students are challenged to make qualitative comparisons about
the similarities and shared features of the homologues, and
in so doing, infer the relatedness of the four species.
Through a process of hypothesis testing, the students work
through the three sets of four homologous chromosomes
and most come to recognize that species #1 and #4 are
markedly more similar to each other than to the others, and
the same is true for species #2 and #3. Thus, most students
begin their phylogram as shown in Figure 3C. However,
before the students simply further branch the two sides into
symmetrical final branches, a new challenge is given. Students are asked to make a hypothesis regarding which divergence occurred more recently. In other words, students
were asked to return to the sets of homologues and make
qualitative judgments regarding which pair shows more
Figure 3. (A) Chromosomal maps (cytogenetic ideograms) for assorted chromosomes from the following species: #1 ⫽ Pan troglodytes, #2 ⫽
Pongo pygmaeus, #3 ⫽ Gorilla gorilla, and #4 ⫽ Homo sapiens. (B) The same chromosomes, but arranged by homologues that are shared by all
four species. (C) The two most likely phylograms indicating the first (most distant) divergence of the species based on the degree of similarity
among the chromosomal maps of the homologues. (D) The two most likely complete phylograms indicating the ancestry of the species based
on the chromosomal maps. (E) A cladogram showing the ancestry expressed in 3D. (F) The arrangement of chromosomes showing how
species #4 has one unique chromosome with two long arms, each of which shares substantial similarity with other chromosomes from the
other species. This is evidence that this long chromosome in species #4 is actually the result of a chromosomal fusion of two smaller ancestral
chromosomes.
518
CBE—Life Sciences Education
Downloaded from http://www.lifescied.org/ by guest on June 30, 2015
Teaching Molecular Phylogeny
similarity in their chromosome heat maps: #1 with #4 or #2
with #3. Such patterns of similarity can provide one line of
evidence regarding the relative relatedness of the species in
terms of evolutionary time (Nachman and Crowell, 2000;
Murphy et al., 2005).
Importantly, each student group will attack this problem
with a slightly different approach and this diversity of methodology is encouraged—there is no “right way” to solve the
problem and no “answer key” that will verify the correct
answer. This reflects how science really works: We speak in
“weight of the evidence” and theories that are supported by
“multiple lines of reasoning,” not in the absolutes of “correct
answers” and foregone conclusions. Additionally, the
challenge of deducing relative age of the branch points
(Figure 3D) in this exercise provides a nice opportunity to
connect with another common way of representing evolutionary relationships: the cladogram. Although cladograms are usually constructed based on shared and
derived characteristics, they share with phylograms the
fundamental basis of evolution and shared ancestry.
Thus, students gain important understanding by learning
how to interpret both. Figure 3E shows a cladogram that
expresses the conclusion that the divergence between species #2 and #3 occurred earlier than the divergence between species #1 and #4.
Following the construction of the phylograms, but before
we move to the final discussion, we “resurrect” the outlier
chromosomes previously set aside because they did not
form part of a homologue set shared by all species. It is
obvious that the real outlier is the very long chromosome
from species #4. We ask students to set this chromosome in
front of them and compare to the other outlier chromosomes, especially those from the species that is most related,
which they now know is species #1. The realization being
sought is that the lone outlier chromosome from species #4,
which has no homologue in the other species, has regions of
very substantial similarity with two of the other outlier chromosomes from the other species, as shown in Figure 3F.
Ayala and Coluzzi (2005) inferred that an ancestor of species
#4 possibly suffered a mitotic catastrophe that was repaired
erroneously through the fusion of two different chromosomes together. This opens a discussion of chromosomal
breakage and repair phenomena such as fusions, translocations, etc.
Because the activities are now finished and the session is
about to proceed to the postlab discussion, this is a perfect
opportunity to “break the code” and tell the students that
“species #4” in activity three is actually Homo sapiens. Humans indeed have one fewer pair of chromosomes (23) than
all other living primates (Zhu et al., 2007). From these analyses, scientists have concluded that the second longest human chromosome is actually the result of a fusion between
two smaller chromosomes (#12 and #13 in chimps and great
apes), which occurred in a primate ancestor of humans
within the last 3 million years (Ijdo et al., 1991). This conclusion is strongly supported by extensive DNA evidence, such
as the presence of two telomere-like stretches arranged endto-end within chromosome #2 and the remnants of an additional centromere (Wienberg et al., 1994; Navarro and Barton, 2003; Zhang et al., 2004). All of these concepts, especially
if they have previously been covered in lecture, provide an
excellent discussion with the students to connect this exercise to other material covered in introductory biology.
The Postactivity Discussion
The discussion at the end of the activity is crucial for “driving home” the main points of this pedagogical method.
Several points should be explicitly stressed during this discussion (see Supplemental Material 2). First, the sequences
shown in Figure 1, A and B were selected for this exercise
essentially at random. There is no reason to think that these
genes are somehow exceptional and that selecting other
genes would paint a significantly different picture. In fact, if
an Internet connection is available, these sequences can
actually be used to break the code of which species is
which, using the BLAST bioinformatics search tool at the
National Library of Medicine’s website (http://blast.ncbi.
nlm.nih.gov/Blast.cgi). This means that the hypothetical
phylograms built in activity one can now be redrawn with
the species names shown in Figure 4A.
The second activity involves five species, and once again
the protein sequences shown in Figure 2 are real, and the
identity of these can be revealed through a protein BLAST
search. At this point in the discussion, we point out that the
SCML1 protein sequences and the GULO pseudogene sequences both led students to conclude that humans and
chimpanzees are more related to each other than to macaque
and orangutan and vice versa. This reinforces the concept of
“multiple lines of evidence.” However, because gorilla was
not included, the activity one phylograms cannot help re-
Figure 4. (A) The phylograms derived from the three exercises
with the species identities revealed. (B) A representative cladogram
expressing the current scientific consensus regarding the shared
ancestry of the five genera examined in this exercise.
Vol. 9, Winter 2010
519
Downloaded from http://www.lifescied.org/ by guest on June 30, 2015
N. H. Lents et al.
solve the unanswered question of how gorilla best fits into
the evolutionary scheme. For evidence on this question, we
move on to activity three.
For activity three, one cannot easily do a bioinformatics
search with the chromosome maps. However, an Internet
search with the terms “chromosome map [species name]”
will show similar examples of these maps so that students
can see that these are indeed real maps from these four
species. Further, with the addition of the third phylogram,
students can now address the question left unresolved from
activity two—where gorillas fit into the evolutionary scheme
of the apes. The annotated phylogram shown in Figure 4A
argues that gorilla and orangutan share a more recent common ancestor than gorilla does with humans and chimps.
Thus, the students can return to the sequence data from
activity two and observe that, although there were three
incidents of gorilla sequence matching humans and chimps
and only two where the gorilla sequenced matched with the
orangutan and macaque sequence, the chromosome density
maps argue that the gorilla is more closely related to orangutans than to humans or chimps. This demonstrates the
need for more and longer sequences for comparisons and
how evolutionary relationships are explored through many
overlapping methods in order to reach a more solidly
founded conclusion.
At this point in the discussion, it is often powerful to
demonstrate how the phylograms constructed by the students compare with phylograms drawn by experts in the
evolutionary biology of apes and humans (Zhu et al., 2007).
If an Internet connection is present, simple Internet searches
for “phylogram [species names]” will produce hits that link
to different phylograms. Importantly, many different phylograms will be found, with different groupings based on
which species and taxonomic groups are included. This
helps to underscore the concept that phylograms are drawn
to express relationships between species of interest: they are
not meant to be all-inclusive. Figure 4B shows the current
scientific consensus regarding the evolutionary history of
the five genera involved in this activity.
ASSESSMENT OF THE ACTIVITY
As this activity was designed, implemented, and refined, we
took efforts to assess the degree to which it accomplishes the
original goal of gains in student learning through explicitly
engaging the scientific process. Toward that end, we monitored several aspects of the student experience. First, each
term we collected student work and assessed how successful
they were at completing each activity as expected. This
resulted in substantial revisions of the activity worksheets
and refinement of the activity itself. These revisions to the
exercise improved the students’ ability to understand and
complete the challenges such that, in the present form, the
success rate is ⬎80%, ⬎70%, and ⬎60%, respectively, for the
three activities (data not shown). The lower rate of success
indicates progressively challenging activities, but we observe that even students who are unable to reach the expected conclusions on their own are able to comprehend the
methodologies during the postactivity discussions. We have
wondered whether guided inquiry or a problem-based research approach assist the students with these challenges.
A second form of assessment that we analyzed was the
performance on lecture exam questions related to this topic.
For this comparison, we arranged a case-control experimental design and two different sections of Bio104 were selected.
Both groups had 28 students and the same instructor for the
lecture part of the course, in which all course topics are
taught. The control group completed a traditional laboratory
exercise on evolution, phylogeny, and classification: chapters 20 and 21 of Biology in the Laboratory (Helms et al., 1998),
while the experimental group completed the exercise described here. Then, we compared performance on the course
exam, which is common among all sections and is relatively
unchanged year to year.
As Figure 5A shows, the two groups’ general exam scores
indicate that the control group was composed of measurably
higher-performing students than the experimental group.
However, because this difference is ⬍10% and within the
95% confidence interval for each group, we considered the
groups comparable for the purposes of this assessment. We
identified three questions on exam one that specifically address the issue of phylogenetics and the deduction of evolutionary relationships (described in Experimental Methods).
Importantly, both groups were taught this material by the
same instructor, and both groups worked from the same
textbook, from which these three questions derived (Biology,
7th ed. (Campbell and Reece, 2005). Figure 5A shows that,
despite scoring lower on the exam overall, the experimental
section slightly outperformed the control group on all three
of these select exam questions. Although these differences
are not dramatic, they are consistent, especially when considering that phylogeny was just one concept on an exam
covering four weeks’ worth of material.
Finally, we performed a third mode of assessment aimed at
inferring student perceptions regarding evolution. As part of
an ongoing assessment project regarding teaching the process
and nature of science, we utilized pre- and postsurveys to
scrutinize student perceptions regarding the scientific theory of
evolution by natural selection, how those perceptions are affected by learning more about the theory in a formal biology
course, and what role, if any, this activity plays in the alteration
of those perceptions. For this inquiry, we used the same control
and experimental groups described above. At the beginning of
the semester, both groups were given a survey instrument
previously validated to reveal student perceptions regarding
evolution and natural selection. Then, both groups were
surveyed again 2 wk after the first examination, which
was thus 1 mo after the execution of this experimental
laboratory activity. More detail regarding the composition
and scoring of the survey instrument is included in the
Experimental Methods section. Briefly, all survey responses
were scaled 1–5 and calculations were performed to yield
a “percent change” value for each question, with a positive value indicating an increase in acceptance of the
scientific theory of evolution by natural selection.
As seen in Figure 5B, a noticeable difference between the
two groups was observed. In the control group, depending
on the particular question, group responses sometimes reflected slightly increased acceptance of evolution and sometimes indicated slightly decreased acceptance of evolution.
The experimental group, however, responded to instruction
about evolution in a dramatically more consistent manner.
Regardless of the question, the average scores on all ques-
520
CBE—Life Sciences Education
Downloaded from http://www.lifescied.org/ by guest on June 30, 2015
Teaching Molecular Phylogeny
Figure 5. (A) Performance of the control and experimental sections of students on all course exams, the first
exam, both with error bars indicating the 95% confidence interval, together with three specific exam questions that explicitly test comprehension of phylogeny
and natural selection. (B) Percent change of average
student responses to eight questions on a pre- and
posttest survey measuring acceptance of the modern
theory of evolution by natural selection. Positive values
indicate an overall group change toward more acceptance of modern evolutionary theory, while negative
values indicate change toward less acceptance. The text
of the survey questions and a description of the calculations are found in the Experimental Methods.
tions concerning the acceptance of evolution showed an
upward deflection, indicating that, as a whole, the group
more consistently came to accept the scientific validity of
modern evolutionary theory. This provides support for a
breakthrough study (Lombrozo et al., 2008) that found that
student perceptions and acceptance of the theory of evolution are directly impacted by their understanding of the
nature and process of science and research.
CONCLUSIONS
The inquiry-based student activity described herein is a
novel approach toward the instruction of the practice of
molecular phylogeny and systematics. Such approaches are
strongly mandated, both because of recent threats to proper
biology education in our country due to poor understanding
of evolutionary theory (Miller et al., 2006; Ayala, 2008) and
because this approach has been shown to be more effective
than traditional approaches to teaching (O’Hara, 1997; Robbins and Roy, 2007; Lombrozo et al., 2008). Although the
skills that are required and reinforced by this group exercise
are part and parcel of most any introductory biology curriculum, these activities may also be applicable to students in
biology courses at the nonmajor and even secondary education levels. No advanced quantitative skills are necessary,
nor is a high-level understanding of molecular biology or
evolutionary theory. In fact, these exercises are designed to
help enlighten these very concepts to students.
Educators who use educational innovations involving student-centered learning modalities have often encountered
student resistance (Giroux, 2001). This has been specifically
noted in various inquiry-based methods in science education (Anderson, 2002; Hofstein and Lunetta, 2004) and in
efforts to explicitly teach the process and nature of science
(McComas et al., 2006). Indeed, in our implementation of
these activities, we encountered some initial resistance
among our students. This is not surprising, given that introductory science students are often accustomed to being
given precise experimental protocols and being told exactly
how to proceed in their laboratory courses. Thus, the resistance and confusion we observed was generally limited to
the first initiation of the activity as students are instructed to
examine the DNA sequences in activity one. During this
period, we consider it crucial that the instructor not give in
and simply walk them through the activity. One of they key
features of our educational approach is that students must
actively consider the data, contrive different possible methods of analysis, and decide on the strategy they think is best.
That there may be a multitude of approaches used by a
given class of students is a strength of inquiry-based learning, helping students learn to think for themselves regarding
the interpretation of data (Hanauer et al., 2006).
Vol. 9, Winter 2010
521
Downloaded from http://www.lifescied.org/ by guest on June 30, 2015
N. H. Lents et al.
By completing these exercises, students will mimic the
scientific process engaged by contemporary biologists. First
of all, the technique of comparative genomics is at the forefront of evolutionary biology, anthropology, structural and
molecular biology, and even medical genetics. The first activity provides students with a familiarity of concepts and
techniques that they are likely to read or hear about in
reports of scientific discoveries in scientific journals and the
popular press. Second, students also execute several distinct
comparisons, with completely different sources of data, in
an effort to explore a single concept: the descent of humankind from primate ancestors. This underscores the scientific
practice of pursuing multiple lines of evidence when approaching unresolved scientific questions. Third, the collaborative, cooperative nature of science is illustrated because
students are encouraged to work in small groups but also
collaborate with other groups. Fourth and perhaps most
important, in these exercises, students are not working toward a preconceived conclusion, using a predetermined
series of steps, only to reveal something that they probably
already learned about as a “known fact.” Instead, students
are encouraged to use their prior scientific knowledge, design their own approaches, draw their own unique conclusions, and identify the data that support those conclusions.
Such pedagogical approaches have been shown in a variety
of contexts to facilitate significant gains not just in content
learning but in the understanding and internalization of
broad concepts.
In addition, by withholding the identities of the species in
question, students who may have been resistant to the concept of human evolution from primate ancestors are encouraged to let their guard down and work freely on the project
at hand. While this aspect of the exercise is by no means
required, it is our hypothesis that this could help break
through the psychological resistance that some students
have to the biological understanding of human origins. We
are bolstered in that belief by our survey results, which
reveal that, on average, students who explore the concept of
phylogeny in this manner are more likely to make gains in
their acceptance of modern evolutionary theory than those
who complete a more traditional laboratory exercise. We
hope that this laboratory exercise will inspire further such
approaches and that the arsenal of process-oriented inquirybased tools for teaching evolutionary theory will continue to
grow. In so doing, we can help reverse some of the disturbing trends regarding public acceptance of evolutionary theory, as well as help to educate more budding young scientists about the true nature, process, and practice of science.
Alles, D. L. (2001). Using evolution as the framework for teaching
biology. Am Biol. Teach. 63, 20 –23.
Anderson, R. D. (2002). Reforming science teaching: what research
says about inquiry. J. Sci. Teach. Educ. 13, 1–12.
Ayala, F. J. (2008). Science, evolution, and creationism. Proc. Natl.
Acad. Sci. USA 105, 3.
Ayala, F.J., and Coluzzi, M. (2005). Chromosome speciation: humans, Drosophila, and mosquitoes. Proc. Natl. Acad. Sci. USA 102,
6535– 6542.
Baum, D. A., Smith, S. D., and Donovan, S.S.S. (2005). EVOLUTION:
The tree-thinking challenge. Science 310, 979 –980.
Campbell, N.A., and Reece, J.B. (2005). Biology. 7th ed., San Francisco: Pearson Education.
Clough, M.P. (1994). Diminish students’ resistance to biological
evolution. Am. Biol. Teach. 56, 409 – 415.
Dagher, Z.R., and BouJaoude, S. (1997). Scientific views and religious beliefs of college students: the case of biological evolution. J.
Res. Sci. Teach. 34, 429 – 445.
Evans, E. M. (2001). Cognitive and contextual factors in the emergence of diverse belief systems: creation versus evolution. Cogn.
Psychol. 42, 217–266.
Eyre-Walker, A., and Keightley, P. D. (1999). High genomic deleterious mutation rates in hominids. Nature 397, 344 –347.
Giroux, H.A. (2001). Theory and Resistance in Education: Towards
a Pedagogy for the Opposition, Santa Barbara, CA: Greenwood
Publishing Group.
Gosser, D. K. (2003). Dynamics of peer-assisted active learning.
Abstracts of Papers of the American Chemical Society 226, U258 –
U258.
Hanauer, D. I., Jacobs-Sera, D., Pedulla, M. L., Cresawn, S. G.,
Hendrix, R. W., and Hatfull, G. F. (2006). Inquiry learning: teaching
scientific inquiry. Science 314, 1880.
Helms, D. R., Helms, C. W., Kosinski, R. J., and Cumings, J. R.
(1998). Biology in the Laboratory, New York: WH Freeman.
Hofstein, A., and Lunetta, V. N. (2004). The laboratory in science
education: foundations for the twenty-first century. Sci. Educ. 88,
28 –54.
Ijdo, J. W., Baldini, A., Ward, D. C., Reeders, S. T., and Wells, R. A.
(1991). Origin of human chromosome 2, an ancestral telomeretelomere fusion. Proc. Natl. Acad. Sci. USA 88, 9051–9055.
Labov, J. B., and Kline Pope, B. (2008). Understanding our audiences: the design and evolution of science, evolution, and creationism. CBE Life Sci. Educ. 7, 20 –24.
Lederman, N. G. (1992). Students’ and teachers’ conceptions of the
nature of science: a review of the research. J. Res. Sci. Teach 29,
331–359.
Lederman, N. G. (1999). Teachers’understanding of the nature of
science and classroom practice: factors that facilitate or impede the
relationship. J. Res. Sci. Teach. 36, 916 –929.
ACKNOWLEDGMENTS
For this work, N.H.L. was supported by the CCRAA-HSI program
of the U.S. Department of Education (grant P031C080210) and A.C.
was supported by the FIPSE program of the U.S. Department of
Education (grant P116B060183).
The authors thank Daniel Cocris and Ron Pilette for their crucial
help in launching, assessing, and refining these activities.
REFERENCES
Alberts, B., and Labov, J. B. (2004). From the National Academies:
teaching the science of evolution. Cell Biol. Educ. 3, 75– 80.
Lombrozo, T., Thanukos, A., and Weisberg, M. (2008). The importance of understanding the nature of science for accepting evolution.
Evol. Educ. Outreach 1, 290 –298.
Matthews, M. R. (1994). Science Teaching: The Role of History and
Philosophy of Science, New York: Routledge.
McComas, W. F., Clough, M. P., and Almazroa, H. (2006). The role
and character of the nature of science in science education. Sci.
Educ. 7, 511–532.
Meadows, L., Doster, E., and Jackson, D. F. (2000). Managing the
conflict between evolution and religion. Am. Biol. Teach. 62, 102–
107.
522
CBE—Life Sciences Education
Downloaded from http://www.lifescied.org/ by guest on June 30, 2015
Teaching Molecular Phylogeny
Miller, J. D., Scott, E. C., and Okamoto, S. (2006). Public acceptance
of evolution. Science 313, 765–766.
Murphy, W. J., et al. (2005). Dynamics of mammalian chromosome
evolution inferred from multispecies comparative maps. Am. Assoc.
Adv. Sci. 309, 613– 617.
Nachman, M. W., and Crowell, S. L. (2000). Estimate of the mutation
rate per nucleotide in humans. Genetics 156, 297–304.
Navarro, A., and Barton, N. H. (2003). Chromosomal speciation and
molecular divergence-accelerated evolution in rearranged chromosomes. Science 300, 321–324.
Nishikimi, M., and Yagi, K. (1991). Molecular basis for the deficiency in humans of gulonolactone oxidase, a key enzyme for ascorbic acid biosynthesis. Am. J. Clin. Nutr. 54, 1203–1208.
O’Hara, R. J. (1997). Population thinking and tree thinking in systematics. Zoologica Scripta 26, 323–329.
Ohta, Y., and Nishikimi, M. (1999). Random nucleotide substitutions in primate nonfunctional gene for Image-gulono-lactone oxidase, the missing enzyme in Image-ascorbic acid biosynthesis. Biochim. Biophys. Acta 1472, 408 – 411.
Perry, J., Meir, E., Herron, J. C., Maruca, S., and Stal, D. (2008).
Evaluating two approaches to helping college students understand
evolutionary trees through diagramming tasks. CBE Life Sci. Educ.
7, 193–201.
Robbins, J. R., and Roy, P. (2007). The natural selection: identifying and correcting non-science student preconceptions through
an inquiry-based, critical approach to evolution. Am. Biol. Teach.
69, 460 – 466.
Rudolph, J. L., and Stewart, J. (1998). Evolution and the nature of
science: on the historical discord and its implications for education.
J. Res. Sci. Teach. 35, 1069 –1089.
Schwartz, R. S., and Lederman, N. G. (2002). “ It’s the nature of the
beast”: the influence of knowledge and intentions on learning and
teaching nature of science. J. Res. Sci. Teach. 39, 205–236.
Scott, E. C., and Branch, G. (2009). Don’t call it “Darwinism.” Evol.
Educ. Outreach 2, 90 –94.
Shetlar, R. (2005). The effect of active learning strategies in undergraduate biology education. Integr. Comp. Biol. 45, 1193–1193.
Smith, M. U. (1994). Counterpoint: belief, understanding, and the
teaching of evolution. J. Res. Sci. Teach. 31, 591–597.
Soloway, E., Grant, W., Tinger, R., Roschelle, J., Mills, M., Resnick,
M., Berg, R., and Eisenberg, M. (1999). Log on education: science in
the palms of their hands. Commun. ACM 42, 21–26
Staver, J. R. (1998). Constructivism: sound theory for explicating the
practice of science and science teaching. J. Res. Sci. Teach. 35,
501–520.
van de Vosse, E., et al. (1998). Characterization ofSCML1, a new gene
in Xp22, with homology to developmental polycomb genes. Genomics 49, 96 –102.
Wienberg, J., Jauch, A., Lüdecke, H. J., Senger, G., Horsthemke, B.,
Claussen, U., Cremer, T., Arnold, N., and Lengauer, C. (1994). The
origin of human chromosome 2 analyzed by comparative chromosome mapping with a DNA microlibrary. Chromosome Res. 2,
405– 410.
Wise, K. C., and Okey, J. R. (1983). A meta-analysis of the effects of
various science teaching strategies on achievement. J. Res. Sci.
Teach. 20, 419 – 435.
Wu, H., and Su, B. (2008). Adaptive evolution of SCML 1 in primates, a gene involved in male reproduction. BMC Evol. Biol. 8, 192
Yunis, J. J., and Prakash, O. (1982). The origin of man: a chromosomal pictorial legacy. Science 215, 1525–1530.
Zhang, J., Wang, X., and Podlaha, O. (2004). Testing the Chromosomal Speciation Hypothesis for Humans and Chimpanzees, vol.
14, Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press,
845– 851.
Zhu, J., Sanborn, J. Z., Diekhans, M., Lowe, C. B., Pringle, T. H., and
Haussler, D. (2007). Comparative genomics search for losses of
long-established genes on the human lineage. PLoS Comput. Biol. 3,
e247
Vol. 9, Winter 2010
523
Downloaded from http://www.lifescied.org/ by guest on June 30, 2015
The gene sequences are from a so-called “broken gene” or pseudogene, the evolutionary remnant of a gene, which is now
nonfunctional, in a given species or group of related species. In this case, the gene is called GULO (L-gulonolactone oxidase), which
codes for the enzyme which catalyzes a key step in the synthesis of ascorbic acid (vitamin C). Along the way, some animals have lost
the function of this gene (by random mutation) and must consume vitamin C in their diet.
-
Page 1
3. Together with your lab partner, make an hypothesis about the ancestry of these four species in the form of a phylogenetic tree.
Draw this tree on a separate sheet of paper and make a few notes explaining why you drew it this way.
2. Discuss the following questions with your lab partner: Do you notice any specific pattern? What could this pattern mean regarding
the ancestry/relatedness of the four species?
#4 GGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGGG
#3 GGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAGG
#2 GGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAGG
#1 GGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAGG
_
Procedure:
1. Examine the four gene sequences below and mark any differences among the sequences that you can find.
•
Activity #1 – Molecular phylogenetics using a pseudogene
• Below are four gene sequences. These are taken from four animals that are believed to have “recent shared ancestry” (are closely
related).
Molecular Phylogenetics Activity
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
Page 2
Procedure:
1. Examine the five amino acid sequences above and mark any differences among the sequences that you can find.
2. As in activity #1, use the differences in amino acid sequence to retrace the ancestry of these five mammals. Make an hypothesis in
the form of a phylogenetic tree. Draw this tree on a separate piece of paper, along with your notes explaining it.
-
#5 MSSS…/…VVKT…/…DDDTI…/…EQQKTVND…/…DAMQN…/…RFRARSLWTNRKRYG…/…KKYSYRLVA…/…YESF…
#4 MSNS…/…VVKT…/…DDDTI…/…EQLKTVND…/…DAMQN…/…RFHARSLWTNRKRYG…/…KKYSYRLVA…/…YESF…
#3 MSNS…/…VVKT…/…DDDTI…/…EQLKTVND…/…DAMQN…/…RFHARFLWANRKRYG…/…KKHSYRLVL…/…YETF…
#2 MSDS…/…VVKT…/…DDNTI…/…EQLRTVND…/…DALQN…/…RFYARSLWTNRKRSG…/…KKHSYRPVL…/…YETF…
#1 MSNS…/…VIKT…/…DDNTI…/…EQLKTVDD…/…DALQN…/…RFHARSLWTNHKRYG…/…KKHSYRLVL…/…YETF…
_
Activity #2 – Molecular phylogenetics using a coding sequence (protein)
• While noncoding DNA sequences are extremely useful in analyzing the shared ancestry of different species, protein-coding DNA
sequences are also useful.
• However, the mutation and evolution of protein-coding sequences of DNA is more “constrained.” Why might this be?
• Below is the amino acid sequence for a protein called SCML1, an enzyme necessary for male embryonic development and male fertility
in mammals. It is encoded by a gene on the X-chromosome.
• The amino acid sequence is only slightly different amongst five mammals, as shown below: ( “…/…” represents a stretch of identical
amino acids, and is this omitted.)
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
Page 3
Activity #3 – Evolution of Gross Chromosomal Structure
• Not all genetic changes are as subtle as single base-pair changes in DNA. Sometimes, large chromosomal rearrangements occur.
• These large rearrangements occur as errors in meiosis, often in the form of chromosomal breakage, followed by imperfect repair.
• Imperfect repair introduces a major structural change to the chromosome. Some examples include:
• Translocation – when part of one chromosomes breaks loose, and is inadvertently glued back on to the end of a different
chromosome.
• Inversion – when part of a chromosome breaks loose and is glued back in place, but in the backwards orientation.
• Duplication – When errors in DNA replication cause a certain region of a chromosome to be inadvertently repeated.
• Deletion – When errors in DNA replication (or meiosis) cause the permanent loss of part of a chromosome.
• It may seem difficult to imagine how such a drastic change in chromosomal structure, resulting in large alterations to genes and
genetic material, could possibly tolerated. However, such changes would not always be lethal for the cell or individual in which this
error occurs.
• Consider a simple hypothetical example:
o
Suppose a small region of chromosome #14 in a certain animal breaks off during the formation of gametes (meiosis).
o
This small region contains many crucial genes.
o
The exact point of chromosomal breakage is just upstream of a certain gene involved with cellular metabolism and energy
consumption. Let’s call this gene METAB1. The coding region of METAB1 is intact, but it is now separated from most of its
“regulatory sequences” (promoters, enhancers, etc.).
o
The cell detects this error and acts to fix the error by “gluing” the small chromosome piece back in place. However, it commits an
error and glues the piece back onto a different chromosome.
o
The chunk of DNA is rescued and intact, but now in a new location. With the exception of METAB1, all genes on the small
“breakaway” piece of chromosome are still surrounded by their normal regulatory sequences and everything would work normally
with these genes.
o
The coding region of METAB1, however, is now found in a new genomic “neighborhood” with different DNA sequence upstream,
meaning a different promoter and regulatory sequences.
o
Perhaps the new upstream sequences of METAB1 cause this gene to be expressed at twice the level as before.
o
In all cells of this organism, there would now be twice the amount of the product of the METAB1 gene.
o
With twice the expression of METAB1, perhaps organisms with this chromosomal rearrangement are able to run faster for a longer
length of time, generate more body heat during cold winters, or other beneficial effects of a faster metabolism. (This hypothetical
example assumes that the animals have plentiful access to food, which would be required by a faster metabolism.)
o
In this case, natural selection would favor those individuals with the new chromosomal arrangement and over time, the species
would evolve as this new chromosomal arrangement took over in the population.
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
On the attached sheet are drawings of the gross chromosomal structure of some chromosomes of four related animals. These are
called cytogenetic ideograms and the patterns of bands on the chromosome represent alternating degrees of electron density.
Inactive regions of a chromosome (heterochromatin) are packed more densely than active areas (euchromatin), giving the banding
pattern shown.
Page 4
Procedure:
1. Examine the chromosomes on the attached handout. Keep in mind that you are looking only at a few of the larger chromosomes
for the four species, and although all of these species are diploid, we are only looking at one chromosome of each pair.
2. Using scissors, cut out all of the chromosomes, but be sure to label each one as to which species it comes from.
3. Now, match up the chromosomes that very obviously are “homologous.” Once you have the homologue from all four of the
species, place those homologous chromosomes in separate piles.
4. Some chromosomes may be leftover, meaning you cannot identify a clear homologue for all four species. Set these aside in a
separate pile, and your instructor will discuss those later.
5. For those chromosomes that have an obvious homologue in all four species, as in the previous exercises, use the differences you
see in the chromosomal structure to retrace the ancestry of these four animals.
6. The best strategy is to first consider each chromosome separately. Looking only at the first chromosome, which two or three
species look the most similar, etc.? Then after you have completed each chromosome individually, see how each of your analyses
compare, and then draw a larger conclusion, if you can.
7. As before, make your hypothesis about the relatedness of these animals in the form of a phylogenetic tree.
8. Your instructor will discuss the other chromosomes, those you could not identify a clear homologue for all species, at the end of
the period. But if you have time, look closely at these and see if you can identify similarities between species.
•
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
Page 5
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
II.
Page 6
6) Which kinds of scientific methodologies (as you learned about them in the recitation session) were present in the four activities
completed in this lab? Refer to the hand out on scientific practice if necessary.
5) Give a purely hypothetical, but detailed example of how an error in meiosis could lead to a beneficial genetic change in a species.
4) Give one example of how a “neutral” genetic variant (allele) could become fixed in a population.
3) Discuss what is meant by “molecular clock” in terms of DNA sequences and how this “clock” is different amongst coding and
noncoding DNA sequences.
2) While the GULO gene shows significant differences between these four species, the β-globin gene (used to make hemoglobin)
shows only very rare differences that are “silent” (the hemoglobin protein is identical) among these four species. Why do you
suppose this is?
1) Why are psuedogenes and other noncoding DNA sequences so commonly used by evolutionary biologists to determine relatedness
between species?
Discussion/Homework questions:
Post-lab discussion of the Phylogenetic Trees
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
If the students have already had lectures on systematics, cladistics, and phylogeny, you can keep your introduction very
brief. But even if so, be sure to review how a phylogram is drawn and what it means. The practice of cladistics builds
hierarchical classification based on observable shared and derived characteristics, while phylogenetics explores
evolutionary relationships based on molecular data. Both have the goal of revealing shared ancestry. It’s very important
that the multiple approaches to evolutionary biology not result in confusion for the students. The multiple approaches
complement each other and scientists in different fields learn from one another.
•
Instructor Guide – Page 1
Q: Why are pseudogenes so useful to biologists in examining ancestry of closely related species?
A: A DNA sequence that is not expressed can suffer changes over time, often without any negative effects.
pseudogenes have much higher mutation rates in a species over time. (More on this at the end.)
Thus,
Q: Can you name a species with a functional GULO gene and some with a nonfunctional version? How can you tell?
A: Species that require Vitamin C in their diet might have a broken GULO gene. Humans are an example – Vitamin C is
called “essential” because we must get it from our diet. Dogs and cats, however, do not need fruit or any other vitamin C
supplement in their diet. This is because their GULO gene works and they produce their own Vitamin C in their cells.
Q: If the GULO gene is needed for the synthesis of Vitamin C, and Vitamin C is so important to life, how would the mutation
destroying this gene have been tolerated? In other words, why would it not have been quickly eliminated from the
population by natural selection?
A: If the mutation occurred in an individual or population that already had an abundance of citrus fruit in their diet (say, in
Africa, or other tropical regions), there would be no real disadvantage of a “broken allele” for the “vitamin C gene.” With
no selection against this allele, the DNA would persist in the population as a pseudogene.
Before setting the students loose on the activity, lead a small discussion of what a “pseudogene” is and how a gene could
become “broken” through random mutations. Here are some good questions to pose to students, either as pre-lab
homework, or to ponder right now.
Activity #1:
•
Before the Exercise Begins:
Instructor Guide and Heuristics: Molecular Phylogenetics
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
▲
▲ ▲
Another way to simply this activity for them – tell them to ignore all mutations that exist in just one species. This is because
this one obviously occurred after it diverged from the others are not helpful for retracing shared ancestry with other species.
However, this is an opportunity to discuss the “molecular clock;” the number of mutations being useful for determining the
time that has passed since the divergence of two species.
I could not find the gorilla GULO pseudogene (perhaps it isn’t sequenced to date), but that’s okay. They will build other
trees that include Gorilla, and they will assemble a final tree that combines the results of all three activities. This mimics
how the science of systematics actually works, so point this out to them. Also, at the end, after the species identities are
•
•
Instructor Guide – Page 2
Thus, if they were to build a phylogentic tree, the rule of parsimony (without doing the full calculations) would dictate that the
divergence between the ancestor of #1 and #3 and the ancestor of #2 and #4 occurred before the further divergence of
these species. And the hypothetical tree that they draw should reflect that.
•
3:4= 9
In addition to the laborious math above, you might also point out there are three examples (or four bases) where #1 and #3
have one thing, but #2 and #4 have something else ( shown as “ ▲ ” above).
2:4= 4
•
2:3= 5
But what does this mean? It may not jump out at students, but the point is that, the fewer the difference between two
species, the more closely related they likely are. This, #2 and #4 are and #1 and #3 are the most closely related pairs.
1:4= 10
•
1:3= 3
They will like start doing “counts” of the differences between species. Although there is an easier way, let them do this,
because it can be helpful. The counts of difference between two species are as follows:
1:2= 6
•
▲
4 GGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGGG
3 GGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAGG
2 GGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAGG
1 GGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAGG
• As the students begin the activity, here are the differences that the students are going to find:
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
Code: But do not break this until the very end!!!!
#1 = Pan troglodytes (chimpanzee)
#3 = Homo sapiens (humans)
•
Instructor Guide – Page 3
#2 = Pongo pygmaeus (orangutan)
#4 = Macaca mulatta (macaque or Rhesus monkey)
It might even be worth telling them (and this is no lie or exaggeration) that this particular stretch of sequence was picked
pretty much at random. The gene was chosen on purpose (a pseudogene), but the person who designed this activity (Prof.
Lents) did not try out a bunch of sequences and then choose the stretch that “worked best” for this activity. This stretch was
the first one he selected and although perhaps others might work even better and show the ancestry in an even more
obvious way, he decided to keep this “first attempt,” as a demonstration that the molecular evidence for shared ancestry is
not hard to find!
•
#4
The major point to discuss here is that this is just a short stretch of DNA, less than 100bp, and still, the relatedness of the
four species can be deduced. Molecular evolutionary biologists generally analyze millions of basepairs of DNA sequence to
help them retrace ancestry.
#2
•
#3
BEFORE MOVING ON TO Activity #2 - have them hand in the tree that they draw, with whatever essential math or
explanation is necessary to defend why they drew it that way.
#1
Thus, the phylogenetic tree that they draw should look like this:
•
•
revealed, you can tell them why Gorilla wasn’t included in activity #1: the sequence hasn’t been reported yet. You could
then also challenge the students to use the trees to predict what the Gorilla GULO gene might look like.
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
One idea for the final wrap-up discussion, if there is time, is to do a BLAST search, or genome browser search for the
human sequence and show how the human genome sequence is now fully available and searchable online. Just a short
demo of bioinformatics can really “wow” them.
•
•
Instructor Guide – Page 4
Below the differences that they are going to find are highlighted:
Q: So wait, if many mutations are silent or neutral, how do they result in a permanent change in all members of a certain
species? How do neutral alleles take over an entire population?
A: Remember that, during speciation, the “founders” of a new species are generally a very small group of individuals. In a
phenomenon called “genetic drift,” these individuals might have combinations of “neutral” alleles that are not necessarily
reflective of the larger population. Thus, some neutral alleles, even rare ones, could become fixed in the new population
only because it happened to be present in the founders, not because they give any adaptive advantage to the
population.
Q: Can mutations ever actually improve the function of the gene and help the organism survive?
A: Yes! While this is rare, occasional advantageous mutations are the basis of adaptation! Such are often called “gain of
function” mutations because they enhance the function of a gene, or even give a new function or property to a gene.
Q: Why is a protein sequence more evolutionarily “constrained?”
A: All mutations are random and thus, most mutations in a functioning gene would diminish or disrupt the function of the
gene product. In most cases, a gene product with diminished function would reduce the viability or health of the
organism. Thus, most of these mutations would be quickly removed from the population through the death of the
organism. However, silent or conservative mutations would be tolerated.
Before setting the students loose on the activity, lead a small discussion of how using a protein sequence is different from
using a DNA sequence. Protein is the expressed product of a gene. There could be lots of silent mutations lurking in this
gene, which do not result in a change to the protein. Here are some possible discussion questions.
Activity #2:
•
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
There are three instances where #3 is similar to #1-#2 and only two instances where #3 is similar to #4-#5, so there is
slightly more evidence that #3 is more closely related to #1-#2 than with #4-#5. However, students will likely be divided on
the issue. This is totally okay – do not try to correct this – the students can debate this!
o Putting all these together, the students will get one of the phylogenies below:
•
Instructor Guide – Page 5
The pattern that they should hopefully discover is that species #1-#2 and #4-#5 are the most similar pairs to each other.
This should be relatively easy for them to see.
o The problem will be – where to put #3? Likely some will put it with #1-#2, others will put it with #4-#5.
•
*
The ones that are the most helpful are marked with “*” but only give them this hint if it looks like no one is getting anywhere.
*
•
*
Again, the trick to make it easier is to ignore all of the cases where there is a change only in ONE species, since it likely
occurred after it diverged from all the others (and is thus, recent, and not helpful in tracing backward.) The trick is to look for
patterns, which is much faster than detailed numerical calculations. (Although in reality, a subjective analysis is never a
complete substitute for quantitative analysis.)
*
•
*
Once again, the goal is to get them to see how certain pairs are closer than other pairs. Counting up all the individual
differences will be very laborious (but still get them to the right answer). This one is a bit harder for them to see, but let
them search for it for a while.
*
•
-
#5 MSSS…/…VVKT…/…DDDTI…/…EQQKTVND…/…DAMQN…/…RFRARSLWTNRKRYG…/…KKYSYRLVA…/…YESF…
#4 MSNS…/…VVKT…/…DDDTI…/…EQLKTVND…/…DAMQN…/…RFHARSLWTNRKRYG…/…KKYSYRLVA…/…YESF…
#3 MSNS…/…VVKT…/…DDDTI…/…EQLKTVND…/…DAMQN…/…RFHARFLWANRKRYG…/…KKHSYRLVL…/…YETF…
#2 MSDS…/…VVKT…/…DDNTI…/…EQLRTVND…/…DALQN…/…RFYARSLWTNRKRSG…/…KKHSYRPVL…/…YETF…
#1 MSNS…/…VIKT…/…DDNTI…/…EQLKTVDD…/…DALQN…/…RFHARSLWTNHKRYG…/…KKHSYRLVL…/…YETF…
_
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
#4
#5
Instructor Guide – Page 6
Again, you could do a protein BLAST search with one of the stretches that is long enough, to show them the databases.
You could even use one of the nonhuman sequences and search against the human proteome. The search result will be
the “best hit” (human SCLM1) but it will mark the differences, that should match up with what is seen here.
#3
•
#2
Code: But do not break this until the very end – when you are doing the final wrap-up!
#1 = Homo sapiens (humans)
#2 = Pan troglodytes (chimpanzee)
#3 = Gorilla gorilla (Gorilla)
#4 = Pongo pygmaeus (orangutan) #5 = Macaca mulatta (macaque or Rhesus monkey)
#1
•
#5
3,4,5
Once again, you can tell them that this protein was picked pretty much at random, as one whose protein sequence was
easy to find online for all these species. We did not try out a bunch of proteins and then choose the one that “worked best”
or gave us the result we wanted for this activity.
#4
1,2
•
#3
OR
OR
Once again, remind them that this is just a short stretch of protein sequence, but biologists would analyze the sequence of
hundreds of proteins, as more data becomes available.
#2
4,5
•
#1
1,2,3
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
Instructor Guide – Page 7
#3
#1
#4
However, before simply branching the two sides into symmetrical final branches, give a new challenge:
o Which of the two pairs is more similar, which are more different? How could this be communicated in the phylogram?
o The conclusion of this is that #2 and #3 have been evolving separately from each other for a longer period of time
than #1 and #4. Thus, they should get something like this for their phylogenetic tree:
•
#2
Once the students have found the three homologous chromosomes shared by all four species, they can proceed with the
attempt to dissect the ancestry of the four species. This will not be a trivial task for them – remind them to consider the
entire length of the chromosomes. But if they take each chromosome set one at a time, they point to the same relationship:
#1 and #4 are considerably closer to each other than either is to #2 and #3.
•
1,4
Students will also notice that one species has one fewer chromosome, to which we respond that a) this is not important for
building the phylograms, and b) it is true that species #4 indeed has one fewer chromosome than the other three species
(although all four have many more chromosomes than are shown here).
•
2,3
When searching for the homologous chromosomes (share by all four), there will be a common tendency to match up, then
stick with, regions of only partial homology. You will have to constantly remind students that for chromosomes to be
considered true homologues, they must share significant homology throughout the length of the chromosome, and for this
exercise, we are only interested in homologues shared by all four species.
•
1,4
This activity is much more subjective, and it’s more likely that they will have a hard time making the big separations and
instead see the changes as more of a gradual transition from one to the other. Students will need more guidance.
•
2,3
In this activity, much more “content” in the form of background information is included in the handout. However, if preferred,
this could be deleted from the student handout and the information could be given as a lecture or a student-driven
discussion.
•
Activity #3:
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
There will almost certainly be some in the class that will notice what is going with the “leftover chromosomes.” The secondto-largest chromosome in species #4 (humans!) has no true homologue in the other species.
However, if you take the smallest two chromosomes of the other three species (this works best with #1, chimps, but you can
see it with any of them), and fuse them together (one upside down compared to the other), the resulting fused
chromosome… viola!! It looks almost identical to that lone second chromosome #2 of species #4.
o I would only reveal the following points if some student has already heard about this and begins to speak openly
about it… (otherwise, do it at the end)
•
•
•
Instructor Guide – Page 8
You should have collected the students’ phylograms and notes for each exercise as they go. Hand the papers back to the
students, but tell them NOT to correct or change anything (they need not be graded on getting them “correct.”). Now you
can “break the code” and have the students re-write the three phylograms on these sheets, but instead of the unnamed
species numbers, have them write the actual species names on the three phylograms from the three exercises. Now they
can compare the results from the three exercises to see if they agree.
Final Discussion
o If this discussion happens now, rather than after the end, go ahead and break the code for activity #3:
#1 = Chimpanzees;
#2 = Orangutan;
#3 = Gorilla;
#4 = Humans;
o The reality here is that humans have 23 pairs of chromosomes, while all other great apes have 24. Where did this
missing chromosome go in the Homo sapiens lineage? Nowhere! Our chromosome #2 is the result of the fusion
between two other chromosomes in a human ancestor some time after the divergence from our most recent common
ancestor with chimpanzees, our closest relatives.
Explain that this theory is strongly supported by extensive DNA evidence, such as the presence of two telomerelike stretches arranged end-to-end within chromosome #2 and the remnants of an additional centromere.
Interestingly, some anthropologists propose that this chromosomal fusion event contributed to the reproductive
isolation of the human ancestor population from the ancestor population of the modern chimpanzee, solidifying
the unique genetic divergence of our ancestors
This process will be more laborious than the others, but the real trick to see this is to look at one set of chromosomal
homologues at a time, make an hypothesis, then look at another set and refine the hypothesis continually.
•
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
chimp
•
go rilla
o rang utan
human
orangutan
ma caque
Or
macaque
hum an
gorilla
orangutan
chimp
gorilla
Exercise 3
chimp
ora ngutan m acaq ue
hum an
Instructor Guide – Page 9
The exercises above involve REAL data, real DNA sequence, etc. Nothing was fabricated or exagerated.
examples were chosen largely at random, NOT because they happen to uphold current scientific dogma.
These
One neat thing to point out to them – the results of exercise #3 help to clarify the dispute in exercise #2. Even though there
was, perhaps, slightly more data supporting gorillas being closer to humans and chimps, the chromosomal maps argue the
opposite. This is scientific controversy! Conflicting results tell a slightly different story, but the more data that is gathered, a
clearer picture emerges and the scientific community incremental advances toward a more complete and correct
understanding of the natural world.
h uma n
Exercise 2
chimp
Exercise 1
Students’ phylograms will look something like this:
This mimics the multi-disciplinary nature of biology. Some scientists work with DNA sequences and build phylograms.
Others study anatomical structures and build cladograms. Scientists all over the world study the biochemistry, nutrition,
lifestyle, behavior, and physiology of all the biodiversity on the planet, past and present. These “multiple lines of evidence”
all cooperate to help scientists retrace the ancestry of species.
More Discussion Points:
•
•
•
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.
•
•
•
•
•
•
•
Hominini
Ponginae
Gorillini
Homininae
(apes)
Hominoidea
Primates
(old world monkeys)
Cercopithecidae
Instructor Guide – Page 10
Anthropologists examine DNA and protein sequences and
chromosomal maps, but they also consider skeletal shapes Homo Pan Gorilla
Pongo
Macaca
and features, anatomy of organs and tissues, physiology,
diet and nutrition, and even behavioral patterns and social structures. Thus, the cladogram shown here, while technically a
“hypothesis,” is anything but a wild guess. It is based on mountains of data from countless sources and disciplines.
Further, the diagram here supports the conclusion drawn in
activity #3 that Gorillas are more closely related to humans
and chimps than they are to Orangutans, but only slightly.
This is why this issue was somewhat difficult to resolve by
only looking at short stretches of DNA and protein.
Shown here is the currently accepted phylogenetic tree that
shows the relationships among the five genera considered
today. It is worthwhile to put this on the board, to show
them how their results helped to uphold the current theory of
human origins.
As more fossilized remains and DNA sequences become available, our knowledge about the evolutionary history of life on
earth becomes more complete. Although phylogenies are considered “hypotheses,” some are supported by so much data
from a whole variety of disciplines that scientists have a great deal of confidence that they are correct. On the other hand,
occasionally, existing phylogenetic trees have to be refined in light of new data. Even more rarely, new data challenges a
currently dominant hypothetical phylogeny. In this way, the collaborative, skeptical, and self-correcting nature of scientific
research continually advances our knowledge.
There is no one complete and correct phylogenetic tree. They are made to convey relationships between a few species,
even many species.
The sequence comparisons of this exercise involved only a short stretch of data. Evolutionary scientists use tens of
thousands or hundreds of thousands of DNA base-pairs, or even whole genomes to conduct their research, which can take
years. In general, the more data one considers, the more likely they are to “get it right” and capture the true ancestry.
You can use BLAST searching or one of the genome browser to demonstrate a) the validity of the data, and b) the
bioinformatics tools available to scientists.
Molecular Phylogenetics Activity
Lents, et. al. John Jay College, C.U.N.Y.