Microbiology (2004), 150, 2221–2227
DOI 10.1099/mic.0.27000-0
Ancient genes of Saccharomyces cerevisiae
P. Veiga-Crespo, M. Poza, M. Prieto-Alcedo and T. G. Villa
Department of Microbiology, Faculty of Pharmacy, University of Santiago de Compostela,
A Coruña, Spain
Correspondence
T. G. Villa
[email protected]
Received 22 December 2003
Revised 17 March 2004
Accepted 24 March 2004
Amber is a plant resin mainly produced by coniferous trees that, after entrapping a variety of
living beings, was subjected to a process of fossilization until it turned into yellowish,
translucent stones. It is also one of the best sources of ancient DNA on which to perform
studies on evolution. Here a method for the sterilization of amber that allows reliable ancient
DNA extraction with no actual DNA contamination is described. Working with insects taken
from amber, it was possible to amplify the ATP9, PGU1 and rRNA18S ancient genes of
Saccharomyces cerevisiae corresponding to samples from the Miocene and Oligocene. After
comparison of the current genes with their ancient (up to 35–40 million years) counterparts it
was concluded that essential genes such as rRNA18S are highly conserved and that even
normal ‘house-keeping’ genes, such as PGU1, are strikingly conserved along the millions
of years that S. cerevisiae has evolved.
INTRODUCTION
In the last two decades, studies with fossil DNA have
increased considerably as molecular biology techniques have
become available in the different fields of enquiry. These
studies, however, are subject to serious potential drawbacks
because ancient DNA may very easily become contaminated
with current DNA and because it is normally degraded.
Moreover, studies are often hampered by the uniqueness
of the specimens, which evidently cannot be destroyed by
DNA extraction.
Ancient DNA – although more resistant than RNA – is
subject to the degradative action of different exogenous
agents (Cano, 1996; Henwood, 1993; Poinar, 1994, 2002;
Service, 1996), water being the most important one, plus the
action of free radicals and UV light; base conversion
phenomena due to hydrolytic deamination are also
common.
Amber is a mixture of terpenes, organic acids, alcohols and
sugars secreted by higher plants (mostly conifers) and has
been subject to polymerization and fossilization for millions
of years, this affording what is known as amber or retinite.
During this process, micro-organisms, pollen, or insects are
entrapped and remain in a ‘frozen’ state up until now, as
widely reported in the literature (Cano et al., 1992; Cano &
Poinar, 1993; DeSalle et al., 1993; Schultz, 2000). The
relationships between insects and micro-organisms have
been also addressed (Wier et al., 2002).
It is possible to differentiate the origin of amber stones
according to their resin composition (Lambert & Poinar,
2002). Thus, conifers are the oldest amber-producing fossils
found in Central Europe, whereas members of the
Leguminosae produced the amber from Mexico and the
Dominican Republic in the Americas (Poinar & Brown,
2002). Recently, new techniques based on NMR have
allowed the unambiguous geographic characterization of
amber samples (Lambert & Poinar, 2002). The high level of
sugars in amber provides a hyperosmotic medium and
hence induces sample dehydration. The development of
specific procedures for molecular biology such as PCR has to
a large extent facilitated studies with ancient DNA in a field
already known as ‘molecular palaeontology’. As recovered
from amber, ancient DNA is already degraded to a certain
extent but this, in turn, facilitates the detection of
contamination with current DNA because it is difficult to
obtain long-chain amplicons (Handt et al., 1994). ‘JumpingPCR’ may represent another drawback in this type of study
(DeSalle et al., 1993; Handt et al., 1994; Taylor, 1996). The
inhibitory action of some amber compounds, such as tannic
substances, may be overcome by the addition of bovine
serum albumin (Pääbo, 1990). Initial studies addressed the
direct cloning of fossil DNA, but this soon fell into disuse
and was replaced by PCR, thus avoiding the undesired DNA
repair that occurs in direct cloning (Pääbo et al., 1989).
METHODS
Amber samples. The present work was carried out with two types
The GenBank accession numbers for the sequences reported in this
paper are AY484433, AY484434, AY484435, AY484436 and
AY484437.
0002-7000 G 2004 SGM
of amber stones: (i) amber collected in the Santiago de Los
Caballeros Mountains (Dominican Republic), stratigraphically dated
as ~15–30 million years old, and (ii) amber collected in Poland and
dated as ~40–50 million years old (Poinar, 1992).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:46:20
Printed in Great Britain
2221
P. Veiga-Crespo and others
Table 1. Oligonucleotides used in the present work
Gene (source)
ATP9
(S. cerevisiae)
Fragment I
PGU1 (S. cerevisiae)
Fragment II
PGU1 (S. cerevisiae)
Fragment III
PGU1 (S. cerevisiae)
rRNA18S
(S. cerevisiae)
Fragment I
ATP5 (S. cerevisiae)
Fragment II
ATP5 (S. cerevisiae)
RCBL
(Pinus edulis)
ODA4
(C. reinhardtii)
rRNA16S
(Wolbachia spp.)
CYTB
(mammals)
GenBank
accession no.
Forward
primer
Reverse
primer
Temp (6C)
AF114937
ATGCAATTAGTATTAGCAGC
TTATACACCGAATAATAATAAG
55
NC_001142
ATGATTTCTGCTAATTCACTTATT
AACCCATCCGTATTATGTCCAC
55
NC_001142
AAGCAGTGGTACTACTGTTACG
TTAACAGCTTGCACCAGATCCA
64
NC_001142
AAGCAGTGGTACTACTGTTACG
AACCCATCCGTATTATGTCCAC
54
NC_001144
TATCTGGTTGATCCTGCCAGT
TCCTTGGATGTGGTAGCCGT
65
NC_001136
ATGTTTAATAGAGTCTTTACC
GGAAAGACCTTCAATAGG
54
NC_001136
GAAAATAACAGACTGGGATG
TTAAATGCTGTCCTCTAAGA
57
X58137
ATGTCACCAAAAACAGAGAC
CCATATTTGTTCAATTTATCTC
56
U02963
TGCCTGTGCATCACGCCCCT
GCGGTTGAACTCGTCGAAGCA
64
AJ422184
CGTAGGCGGATTAGTAAGTTAAA
CACGACACGAGCTGACGACA
64
Universal primers CCATCCAACATCTCAGCATGATGAAA GCCCCTCAGAATGATATTTGTCCTCA
Sterilization and opening of the amber. The accomplishment
of surface sterilization and the opening of the amber were generally
as recommended by Lambert et al. (1998). Sterilization was accomplished by a thorough surface wash with sterile water. Then, the
samples were maintained in 2 % glutaraldehyde (Merck) at 40 uC for
48 h and subjected to periodic ultrasonic treatment (30 min).
Following this, the stones were incubated in the presence of 10 %
CaCl2 (Merck) at 25 uC for 24 h and also ultrasonicated. Finally,
they were incubated in 70 % ethanol (Merck) at 22 uC for 24 h and
again subjected to ultrasonication. Once frozen in liquid N2, the
stones were ground in a sterile mortar. The powder was resuspended
in liquid brain heart infusion (BHI) broth (Pronadisa), aliquotted
and stored at 280 uC until use.
55
1 cycle of 5 min at 94 uC, 35 cycles of 1 min at 94 uC, 30 s at X uC
(where X depended on the oligonucleotide pair) and 1 min at 72 uC.
The process was completed with one cycle of 10 min at 72 uC. For
each amplification cycle, the appropriate controls were conducted
using each primer alone.
Extraction of PCR products and sequence analyses. PCR
products were purified using the Wizard PCR Purification Systems
Kit (Promega) and sequence analyses were performed using the
BLAST 2.0 application (Altschul et al., 1997) from the National
Center for Biotechnology Information. Phylogenetic relationships,
specific rates of nucleotide substitution, and alignments were established with the CLUSTALW program included in the VectorNTI
Advanced v. 9.0 (Informax) program.
DNA extraction. DNA from S. cerevisiae was prepared using the
Wizard Genomic DNA Purification System (Promega). DNA from
Chlamydomonas reinhardtii was prepared as indicated at www.
biology.duke.edu/chlamy/methods/dna.html and DNA from Pinus
edulis was extracted with the DNeasy Plant Mini Kit (Qiagen). Fossil
DNA from amber stones was prepared using the Ancient DNA Kit
(GeneClean; Bio 101). The powdered stones were resuspended in
10 ml 0?5 M EDTA (Merck), 200 ml 10 % SDS (Merck) and 200 ml
Proteinase K (20 mg ml21; Fluka) and kept at 37 uC for 15 h. After
this, the kit instructions were followed.
Oligonucleotides and amplification techniques. The oligo-
nucleotides used to amplify ancient DNA are listed in Table 1. The
amplification reaction mixture was as follows: 1 U Taq polymerase
(Takara Shuto), 2 ng BSA ml21 (Promega), 0?5 mM each oligonucleotide (Invitrogen), 2 mM MgCl2 (Takara Shuto), 0?2 mM
dNTPs mix (Takara Shuto), 50 ng fossil DNA, Taq polymerase
buffer (Takara Shuto) and deionized sterile water to a final volume
of 50 ml. When the ODA4 gene was to be amplified, the MgCl2
concentration was 1?5 mM. The reaction was carried out using a
Robocycler Gradient 96 (Stratagene) and the programme was:
2222
Controls of contamination. Working surfaces were periodically
treated with ethanol (70 %) and before and after each work session
they were treated with 10 % sodium hypochlorite (Merck). All
culture media were maintained for 15 days at 21, 30 and 37 uC
before use. All solutions used to sterilize the amber stone surfaces
were previously filtered through 0?22 mm membranes (three times)
that had been treated against microbial contamination. Before stone
grinding, the samples were incubated in liquid BHI medium and
subjected to the same temperature cycle to discard any possible contamination. After grinding, microbial contamination was investigated again. The solutions used in DNA extraction and PCR were
periodically controlled for fortuitous contamination. Throughout
the process, particular care was taken to not use glassware or equipment that had previously been in contact with current DNA.
RESULTS AND DISCUSSION
PCR-gene amplification in ancient samples such as
those found in fossil amber must be accompanied by
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:46:20
Microbiology 150
Ancient genes of S. cerevisiae
strict sterilization procedures from the very beginning of stone manipulation right up to the final DNA
amplification to avoid contamination with present-day
DNA (Handt et al., 1994; Taylor, 1996). Here, the
procedure described by Lambert et al. (1998), modified
as specified in Methods, was adopted throughout
and yielded the best results as regards control of
contamination.
Fig. 1. DNA alignments between ancient
and current gene sequences. (a) ATP9
alignment; (b) rRNA18S alignment; (c) fragment III of PGU1 alignment.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:46:20
2223
P. Veiga-Crespo and others
Six powdered aliquots were prepared from each amber stone
and one of them was used to test the sterilization status by
inoculation in both BHI broth and solid medium. Although
Austin et al. (1997) have reported different methods suitable
for amber DNA extraction, in our hands the commercial kit
for fossil DNA extraction was very effective, affording
samples of fair purity and also avoiding problems during
amplification. Extraction efficiency was about 20 ng DNA
ml21 and purity (A260/A280) was 1?6; although both these
parameters varied from stone to stone, it was observed that
younger samples yielded more DNA than older ones.
The approaches to sequence validity must be established a
priori and must not be changed during the course of the
work. In this case, the following criteria were adopted: (i)
DNA was extracted only from stones that had passed all the
contamination checks; (ii) samples from the same stones
had to show similar results; (iii) ancestral sequences had to
show homology with current ones and had to display
phylogenetic coherence; and (iv) large DNA fragments
(longer than 1 kb) had to be discarded to avoid either
sample contamination with current DNA or jumping-PCR
phenomena.
Based on direct observation of the stones employed in the
present work, the entrapped insects strongly resembled ants.
As happens in today’s insects, yeast cells are mainly
associated with the legs and possibly the lower parts of
the body, hence being transported from plant to plant.
Other yeast strains detected here were probably indigenous
to the plant. All these yeast strains plus the insects were
finally entrapped and subjected to amberization.
Genes essential for the organisms were chosen as a means to
ensure pressure through natural selection, so that the
amplified DNA could be easily recognized in comparison
with present-day genes. It was not possible to amplify whole
genes, except for ATP9 from S. cerevisiae. For the remaining
genes, intra-ORF oligonucleotides had to be synthesized.
Thus, for the rRNA18S gene from S. cerevisiae, the
oligonucleotides flanked the coding region 1–420 bp. For
the ATP5 gene of this yeast, two oligonucleotide couples
were synthesized flanking coding regions from nt 1 to 330
(fragment I) and from nt 331 to the end of the coding region
(fragment II). For the PGU1 gene of S. cerevisiae, three
oligonucleotide couples were used: fragment I (from nt 1 to
542 of the coding region), fragment II (from nt 192 to the
end of the coding region) and fragment III (an internal
sequence that goes from nt 192 to 542 of the coding region).
The oligonucleotides for the RCBL gene (large subunit of
RuBisCo) of Pinus edulis flanked nucleotides 1–500 of the
coding region and the oligonucleotides of the rRNA16S gene
of Wolbachia sp. flanked nucleotides 501–1000 of the coding
region. In the case of the gene ODA4 from C. reinhardtii, the
oligonucleotides were synthesized to specifically amplify the
region encoding the GK4 region of the dynein heavy bchain. This is a highly conserved and small sequence
(Mitchell & Brown, 1994). The oligonucleotides reported by
Kocher et al. (1989) for mammal cytochrome c were used.
2224
All the oligonucleotides described above are shown in
Table 1.
It was possible to amplify the complete S. cerevisiae ATP9
mitochondrial gene (230 bp) in samples both from the
Dominican Republic and from Poland. It was not possible,
however, to amplify the whole PGU1 gene but, instead,
fragments I, II and III in younger samples; older samples
only allowed the amplification of fragment III. Regarding
the rRNA18S genes from S. cerevisiae and RCBL from Pinus
edulis (data not shown), it was only possible to amplify
500 bp and always in the youngest samples (i.e. amber from
the Dominican Republic). It was not possible to amplify the
nuclear ATP5 gene from S. cerevisiae, the GK region of
ODA4 from C. reinhardtii, or the mammalian CYTB and
Table 2. Similarity (%) between present-day and fossil
DNA sequences
(a) ATP9 from S. cerevisiae
Current ATP9
Miocene ATP9
Oligocene ATP9
Current
ATP9
Miocene
ATP9
Oligocene
ATP9
100
59
100
40
74
100
(b) Rebuilt Miocene PGU1 gene
Actual PGU1
Miocene PGU1
100
69
100
Actual PGU1
Miocene PGU1
(c) Fragment III of PGU1 gene
Current fragment
III PGU1
Miocene fragment
III PGU1
Oligocene fragment
III PGU1
Current
fragment
III PGU1
Miocene
fragment
III PGU1
Oligocene
fragment
III PGU1
100
43
32
100
39
100
(d) rRNA18S gene
Current
rRNA18S (500 bp)
Miocene rRNA18S
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:46:20
Current rRNA18S
(500 bp)
Miocene
rRNA18S
100
65
100
Microbiology 150
Ancient genes of S. cerevisiae
rRNA16S from Wolbachia. Although we cannot categorically
rule out the (remote) possibility of contamination with
current fungal DNA, we are confident that the controls
introduced along the sterilization process were sufficient for
us to be able to disregard such a notion.
Consensus sequences were elaborated with all these ancient
sequences (GenBank accession nos: AY484433, AY484434,
AY484435, AY484436 and AY484437). At least six different
amplicons had to be collected to obtain good sequence
resolution. Thus, it was possible to establish a consensus
sequence for the ATP9 gene of S. cerevisiae for both the
Miocene and Oligocene. Length variation in the sequences
was not taken into account because the end portions of the
sequences were completely discarded, not only since they
showed a high variation index but also because they showed
a high sequence indetermination index. Next, the consensus
sequences of ancient genes were compared with those of
current genes to see the degree of similarity and coherence
(Fig. 1). In this sense, ancient ATP9 from the Miocene
exhibited 59 % similarity as compared to the current gene
whereas the fragment from the Oligocene showed 40 %
similarity. Upon comparing both ancient sequences, a
similarity of 74 % was observed (Table 2a). In the case of the
ancient PGU1 gene, it was possible to rebuild almost the
complete gene sequence from the Miocene samples by
assembling fragments I, II and III. The sequences showed
69 % homology with the present-day one (Table 2b).
Fig. 2. Phylogenetic trees. (a) ATP9 gene;
(b) PGU1 gene; (c) rRNA18S gene.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:46:20
2225
P. Veiga-Crespo and others
Fragment III from the Oligocene had 32 and 39 % homology
with the current one and Miocene one, respectively
(Table 2c). The consensus sequences for the Miocene
rRNA18S gene from S. cerevisiae showed 65 % homology
with the present-day one (Table 2d).
The next step was to perform a phylogenetic analysis (Fig. 2)
using the neighbour-joining method with the lowest
possible number of evolutionary events. Ambiguous residues were resolved as ‘gaps’ and greater importance was
given to nucleotide substitution (especially transversion)
than insertion/deletion events. After that analysis, it was
concluded that the variability of the S. cerevisiae ATP9
gene is greater between the current and Miocene sequences
than between the Oligocene and the Miocene sequences
(Table 2a). When the phylogenetic tree was plotted
(Fig. 2a), it was seen that the sequences corresponding to
different Saccharomyces species were all clustered on the
same branch and were clearly differentiated from other
organisms. In the case of PGU1 (Fig. 2b), the ancient genes
are clustered on the same branch and chronologically and
logically grouped together with the current gene; the origin
of this gene for both plants and Saccharomyces must be
sought in an ancestor older than our Oligocene samples.
The rRNA18S phylogenetic tree (Fig. 2c) again revealed
that the branch grouping S. cerevisiae and the Miocene
sequence appeared separated from the rest, thus suggesting
an older origin, except for Pichia segobiensis, Tetrapisispora
nanseiensis and Arxiozyma telluris.
The degree of gene sequence conservation was not the same
for the different genes studied (Table 2). In the case of S.
cerevisiae, a higher conservation value for the ATP9 and
rRNA18S genes than for the PGU1 gene should be expected;
the first two are assumed to have been subjected to greater
evolutionary pressure than the latter. The results, however,
were the opposite (Table 2). One explanation for this could
be that the PGU1 and rRNA18S genes are nuclear while
ATP9 is located mitochondrially and the specific mutation
rate is different in both genomes (higher for mitochondrial
genes).
Traditional studies propose either 2 % genomic variation
per million years for two lineages separated by less than 10
million years, or 161028 nucleotide substitution per
nucleotide site per year for mitochondrial DNA (Avise,
1994). Thus, the tendency in the specific mutation rates for
these extranuclear genomes is exponential, after which a
plateau is reached (the genome is saturated in the variable
substitution sites). These assumptions apply mainly for
organisms with long doubling times, although they also
seem to apply for S. cerevisiae, which has a short generation
time.
The highest intersequence divergences occurred during the
last 10 million years and the highest homology would lie
among the older sequences. This phenomenon may be
ascribed to the fact that the amber samples were from
different geoclimatic regions of the planet. It is now quite
2226
clear that work done with fossil DNA extracted from
amber, such as described here, may shed light onto the
precise aspects involved in the genetic differentiation of
species.
Future research will include an expansion of the number
of genes studied in S. cerevisiae – both nuclear and
mitochondrial – in more closely related (both in time and
space) amber samples.
ACKNOWLEDGEMENTS
The authors wish to express their gratitude to the Ramon Areces
Foundation of Madrid and Dr J. Barros for the CYTB primers. They
also thank Dr J. Civis from Salamanca University for helping with
stone dating.
REFERENCES
Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, Z., Miller, W.
& Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids Res 25,
3389–3402.
Austin, J. J., Ross, A. J., Smith, A. B., Fortey, R. A. & Thomas, R. H.
(1997). Problems of reproducibility – does geologically ancient DNA
survive in amber-preserved insects? Proc R Soc Lond B Biol Sci 264,
467–474.
Avise, J. C. (1994). Molecular Markers, Natural History and Evolution.
New York: Chapman & Hall.
Cano, R. J. (1996). Analysing ancient DNA. Endeavour 20, 162–167.
Cano, R. J. & Poinar, H. N. (1993). Rapid isolation of DNA from
fossil and museum specimens suitable for PCR. BioTechniques 15,
432–436.
Cano, R. J., Poinar, H. N. & Poinar, G. O., Jr (1992). Isolation and
partial characterisation of DNA from the bee Proplebeia dominicana
(Apidae: Hymenoptera) in 25–40 million year old amber. Med Sci
Res 20, 249–251.
DeSalle, R., Barcia, M. & Wray, C. (1993). PCR jumping in clones of
30-million-year-old DNA fragments from amber preserved termites
(Mastotermes electrodominicus). Experientia 49, 906–909.
Handt, O., Hoss, M., Krings, M. & Pääbo, S. (1994). Ancient DNA:
methodological challenges. Experientia 50, 524–529.
Henwood, A. (1993). Recent plant resins and the taphonomy of
organisms in amber: a review. Mod Geol 19, 35–59.
Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Pääbo, S.,
Villablanca, F. X. & Wilson, A. C. (1989). Dynamics of mitochondrial
DNA evolution in animals: amplification and sequencing with
conserved primers. Proc Natl Acad Sci U S A 86, 6196–6200.
Lambert, J. B. & Poinar, G. O., Jr (2002). Amber: the organic
gemstone. Acc Chem Res 35, 628–636.
Lambert, L. H., Cox, T., Mitchell, K., Rossello-Mora, R. A.,
Del Cueto, C., Dodge, D. E., Orkand, P. & Cano, R. J. (1998).
Staphylococcus succinus sp. nov., isolated from Dominican amber.
Int J Syst Bacteriol 48, 511–518.
Mitchell, D. R. & Brown, K. S. (1994). Sequence analysis of the
Chlamydomonas alpha and beta dynein heavy chain genes. J Cell Sci
107, 635–644.
Pääbo, S. (1990). Amplifying ancient DNA. In PCR Protocols.
A Guide to Methods and Applications, pp. 159–166. Edited by
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:46:20
Microbiology 150
Ancient genes of S. cerevisiae
M. A. Innis, D. Gelfand, J. Sninsky & T. White. San Diego: Academic
Press.
Poinar, H. N. (2002). The genetic secrets some fossils hold. Acc Chem
Res 35, 676–684.
Pääbo, S., Higuchi, R. G. & Wilson, A. C. (1989). Ancient DNA
Service, R. F. (1996). Just how old is that DNA, anyway? Science
and the polymerase chain reaction. The emerging field of molecular
archaeology. J Biol Chem 264, 9709–9712.
272, 810.
Poinar, G. O., Jr (1992). Life in Amber. Stanford: Stanford University
Press.
Poinar, G. O. (1994). The range of life in amber: significance and
implications in DNA studies. Experientia 50, 536–542.
Schultz, T. R. (2002). In search of ant ancestors. Proc Natl Acad Sci
U S A 97, 14028–14029.
Taylor, P. G. (1996). Reproducibility of ancient DNA sequences
from extinct Pleistocene fauna. Mol Biol Evol 13, 283–285.
Poinar, G. O., Jr & Brown, A. E. (2002). Hymenaea mexicana sp. nov.
Wier, A., Dolan, M., Grimaldi, D., Guerrero, R., Wagensberg, J. &
Margulis, L. (2002). Spirochete and protist symbionts of a termite
(Leguminosae: Caesalpinoideae) from Mexican amber indicates Old
World connections. Bot J Linn Soc 139, 125–132.
(Mastotermes electrodominicus) in Miocene amber. Proc Natl Acad Sci
U S A 99, 1410–1413.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:46:20
2227