Microbiology (1995), 141, 1601-1 607
Printed in Great Britain
Differential transcription of the MPB7O genes
in two major groups of Mycobacteriurn bovis
BCG substrains
Takemitsu Matsuo, Sohkichi Matsumoto, Naoya Ohara, Hideki Kitaura,
Akio Mizuno and Takeshi Yamada
Author for correspondence: Takeshi Yamada. Tel:
Department of Oral
Microbiology, School of
Dentistry, Nagasaki
University, 1-7-1 Sakamoto,
Nagasaki 852, Japan
Substrains of Mycobacterium bovis BCG (BCG) have been divided into two
major groups, high and low producers, on t h e basis of the amount of secretion
of the MPB70 protein. The antigen is produced in high concentration by BCG
Tokyo, Moreau, Russia and Sweden (high-producer substrains), whereas in BCG
Pasteur, Copenhagen and Tice (low-producer substrains) it is detected a t 1OO/
(whnr) or less of the concentration of BCG Tokyo. To investigate why this
protein is secreted differently, the MPB7O genes of BCG Tokyo and Pasteur
were cloned, sequenced and compared. The MPB7O genes in two substrains
showed exactly the same sequence. Even the upstream and downstream
regions of the MPB7O gene were identical. MPB7O gene expression was
assessed by means of Northern hybridization analysis and reverse
transcriptase polymerase chain reaction. The mRNA was clearly detected in
BCG Tokyo, but a t a very low level in BCG Pasteur. On the basis of these
results, the difference in the secretion of the MPB7O protein between BCG
Tokyo and Pasteur was attributed to differential transcription efficiencies.
1
Keywords : BCG substrains, MPB70, RT-PCR, transcription
INTRODUCTION
The MPB70 protein was originally isolated from the
Tokyo substrain of Mycobacteritlm bovis BCG (BCG) by
Nagai etal. (1981). This protein accounted for about 10 %
(w/w) of the total secreted protein content in Sauton
culture medium (Nagai e t al., 1981). Amounts of secretion
of this protein differ between BCG substrains (Miura e t
al., 1983). On the basis of differential secretion, BCG has
been divided into two major groups. BCG Tokyo,
Moreau, Russia and Sweden (high-producer substrains)
secrete a lot of the MPB70 protein, whereas BCG Pasteur,
Copenhagen, Glaxo and Tice (low-producer substrains)
secrete little. The two groups of BCG substrains also
differ in mycolic acid patterns (Minnikin e t al., 1984), a
DNA restriction fragment length polymorphism (Collins
& De Wit, 1987), the copy number of insertion sequence
IS986 (Fomukong e t al., 1992), and the presence or
absence of the MPB64 gene (Li e t al., 1993).
...................................................................................... ....................................................................
Abbreviations: BCG, bacillus Calmette-Guerin; RT-PCR, reverse transcriptase polymerase chain reaction.
The GSDB/DDBJ/EMBUNCBI accession numbers for t h e sequences reported
in this paper are D38229 and D38230.
0001-9568 0 1995 SGM
+ 81 958 49 7648. Fax: + 81 958 49 7650.
The amino acid sequence of MPB70 from M . bovis BCG
was reported by Patarroyo e t al. (1986). Radford e t al.
(1988) first described the nucleotide sequence of the
MPB70 gene from M. bovis AN5. It did not contain a
signal region and corresponded to the sequence from
position 91 to 582. The complete nucleotide sequence of
the MPB70 gene from BCG Tokyo was first reported by
Terasaka e t al. (1989). It was from position - 173 to 597.
Radford e t a/. (1990) reported the sequence of an
analogous gene from M. bovis AN5 from position - 81 to
582, including a signal region. Matsumoto e t al. (1995)
reported the nucleotide sequence from position - 157 to
726 in Mycobacteritlm ttlberctllosis. Epitope mapping of
MPB70 from M. bovis was reported by Radford e t al.
(1990) and Pollock e t al. (1994).
Recently, D N A amplification of a region of the MPB70
gene was carried out for rapid identification of M . bovis
and M . tubercdosis by PCR. The PCR consistently
demonstrated a positive PCR with the MPB70 primers in
all BCG substrains tested, regardless of whether-they were
high Or low producers (Li et
1993). However, the
authors made no comparison of the sequence of the
MPB70 gene, including the non-coding region, between
substrains.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:08:13
1601
T. M A T S U O a n d O T H E R S
[a-32P]dCTP, [y-32P]ATP and the ECL direct nucleic acid
labelling and detection system were from Amersham. M-MLV
reverse transcriptase was from GIBCO BRL Life Technologies.
RNasin was from Promega. Tag D N A polymerase and deoxynucleotide triphosphate were from Pharmacia P-L Biochemicals.
kb
23.1 -
Bacterial strains and plasmids. BCG Pasteur and Tokyo were
grown in Sauton medium (Suzuki e t al., 1987). Escherichia coli
K12 strain JM109 was used as a host for plasmid pUC19; it was
grown in NZYM medium [l YO(w/v) N Z amine, 0.5 YO(w/v)
yeast extract, 0.5% (w/v) NaC1, and 0.2% (w/v)
M g S 0 , . 7 H 2 0 : Sambrook e t al., 19891.
9.42 6.56 4.36 -
Probes. Two kinds of D N A probes were obtained from the
cloned SalI fragment containing the MPB70 gene (Terasaka e t
al., 1989) : a 265 bp Sau3AI fragment containing the N-terminal
sequence (probe A) and the other was a 625 bp SmaI-SalI
fragment corresponding to the C-terminal sequence (probe B)
of the MPB70 gene and 149 bp beyond the coding sequence.
2.32 2.03 -
Probe A
Probe B
Fig. 1. Southern hybridization analysis of BCG Tokyo and
Pasteur. One microgram of chromosomal DNA was loaded in
each lane. Hybridizations were carried out at 42 "C by probe A
or B, and washing was carried out three times for 10min at
55 "C in 0.4% (w/v) SDS, 0.5 x SSC and twice for 5 min at room
temperature in 2 x SSC. The numbers on the left indicate sizes
of standard DNA fragments.
MPB64 is another of the secreted proteins (Harboe e t al.,
1992; Wiker e t a/., 1991), and is specific to the M .
tabercnlosis complex. It was purified from the culture fluid
of BCG substrain Tokyo (Harboe e t a/., 1986). The
absence of the MPB64 gene in some substrains of BCG
was reported by Li e t al. (1993). The PCR product of the
MPB64 gene was found in BCG Tokyo, Moreau, Russia
and Sweden, in the virulent M . bovis AN5, and in M.
tnbercnlosis H37Rv and H37Ra, whereas it was not found
in BCG Pasteur, Copenhagen, Glaxo and Tice. The
MPB70 gene was found in both the MPB64-positive and
MPB64-negative groups, though the MPB64-positive
groups secreted a large amount of the MPB70 protein and
negative groups secreted little. The amount of the MPB70
protein thus seemed to be related to the presence of the
MPB64 gene or other factors.
It was also thought that the coding or non-coding region
of the MPB70 gene may differ between substrains, leading
to the observed differences in MPB70 secretion. In this
study, we compared the sequences of the MPB70 genes
from BCG Tokyo and Pasteur. We also assessed MPB70
gene expression by Northern hybridization analysis and
reverse transcriptase-PCR (RT-PCR).
METHODS
Reagents. Restriction endonucleases, modifying enzymes,
vectors (pUC19), the 7-deaza sequence kit, the nick-translation
k i t and the ligation kit were purchased from Takara Shuzo Co.
1602
DNA cloning. Cells of BCG Tokyo and Pasteur were harvested
by filtration. Genomic D N A of BCG Pasteur and Tokyo was
extracted as described previously (Suzuki e t al., 1987). Approximately 1 pg genomic DNA was digested with SalI and
fractionated by 0.8 YO(w/v) agarose gel electrophoresis. Fractionated D N A fragments, denatured with 0-5 M NaOH, were
transferred to a nylon membrane (Gene Screen Plus, N E N
Research Products). Hybridizations were accomplished by using
the ECL direct nucleic acid labelling and detection system as
described in the manufacturer's instructions. The DNA fragments of about 3.6 kbp which gave a clear hybridization band
with the labelled probes A and B were harvested, cloned into
plasmid vector pUCl9, and transformed into competent E. coli
JM109 cells. The ampicillin (50 pg ml-l) resistant white colonies
on the NZYM plates containing 0.1 mM IPTG and 0.004%
(w/v) X-Gal were screened by the colony hybridization
technique (Grunstein & Wallis, 1977). Approximately 1 pg each
of probes A and B was nick-translated by using a nick translation
kit and [ C ~ - ~ ~ P ] ~(3000
C T PCi mmol-' ; 111 TBq mmol-l) as
described previously (Matsuo e t al., 1988).
DNA sequencing. The sequencing strategy is presented in Fig.
2. Sau3AI fragments with BCG Tokyo or Pasteur DNA insert
were subcloned into the BamHI site of pUC19. In the same way,
Ace1 fragments were subcloned into the AccI site, AccI-SmaI
fragments were subcloned into the AccI-SmaI site, AccI-Sac1
fragments were subcloned into the AccI-Sac1 site, SmaI-SalI
fragments were subcloned into the SmaI-SalI site and SacI-SalI
fragments were subcloned into the SacI-SalI site of pUCl9. The
nucleotide sequences of these subcloned DNA fragments were
determined by the dideoxy chain-termination method using
pUC plasmids (Hattori & Sakaki, 1986) and M13 primer M3 and
RV (Takara Shuzo Co.). Additionally, synthetic primer p-70s
(5'-GAAGGTAAAGAACACAATTG-3')wasused sothat the
sequencing fully overlapped on both strands. The sequence data
were analysed by DNASIS (Hitachi Software Service).
Extraction of total RNAs and analysis. Cells were disrupted
with glass beads. Total RNAs were extracted according to the
method of Chomczynski & Sacchi (1987) and stored at -80 "C
after being dissolved in diethyl-pyrocarbonate-treated H,O
[O-2% (w/v)]. Concentrations of total RNAs were determined
spectrophotometrically at 260 nm and verified by judging the
intensities of bands after electrophoresis in 1.2 YO(w/v) agarose
gels.
The total RNAs (20 pg per well) were separated by electrophoresis on agarose gel containing 2.2 M formaldehyde
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:08:13
Differential regulation of the MPB70 gene
Probe A
Sall
Smal Sau3Al Accl
I
I
l
_..&........._..
Cloned fragment
Sau3Al
Accl Sau3Al
Sequenced region
* - I
Sau3Al Smal
Sall
I
'-.
I
L.1
I
U
100 bp
........4
-*- I
I-. .I-.
-*.
..........................
t
1............................................
Sequencing strategy
...-4
.*-I
200 bp
san
Accl
MPB7O gene
M
u
'\
Sac1
--
Signal
1.. ...................
. * -L.
1
4
1
Smal
l
..--..-.__.-.-
Probe B
.....................
I
___ .___
I
M
I-..__.
I-*.
(Lehrach e t al., 1977), then transferred to a nylon membrane
(Hybond-N , Amersham) in 20 x SSC (3 M NaC1, 0.3 M
sodium citrate). After transfer, RNAs were covalently crosslinked to the membrane by UV irradiation. Northern
hybridization was carried out with probe B, using the ECL
direct nucleic acid labelling and detection system.
+
Synthetic oligonucleotides. Four oligonucleotides for PCR
were synthesized on the basis of the sequence of the MPB70
gene (Terasaka e t al., 1989; Radford e t al., 1990) and the 16s
rRNA gene of BCG (Suzuki e t al., 1988), using a DNA
synthesizer (model 391, Applied Biosystems). Oligonucleotides
p-70N (5'-TGCAGGGAATGTCGCAGGAC-3') and p-70C
(5'-CGGAGGCATTAGCACGCTGT-3') corresponded to
positions 155 to 174 and 557 to 576, respectively, of the
sequence of the MPB70 gene of BCG Pasteur and Tokyo
(Terasaka e t a/., 1989). Oligonucleotides p-16N (5'CTGAGATACGGCCCAGACTC-3') and p-16C (5'-GCCCCCGTCAATTCCTTTGA-3') corresponded to positions 320
to 339 and 696 to 715 of the sequence of the 16s rRNA gene of
BCG (Suzuki et al., 1988).
Oligonucleotides p-70s (5'-GAAGGTAAAGAACACAATTG-3') and p-70P (5'-GGTTGCCGCAATTGTGTTCT-3')
were synthesized in the same way; they corresponded to
positions 3 to 22 and - 16 to 4 on the basis of the sequence of
the MPB70 gene.
Reversetranscription and amplificationreaction. Total RNAs
(2.0 pg) were heated for 5 min at 75 "C, then total RNAs were
transcribed into cDNAs in 20 p1 50 mM Tris/HCl (pH 8*3),
75 mM KCl, 3 mM MgC1, containing 100 pmol random
hexamer, 200 U M-MLV reverse transcriptase, and 40 U RNasin
by incubation for 60 min at 37 "C.
To assess the expression of the MPB70 gene, RT-PCR was
performed in a total volume of 100 pl with 20 pl reverse
transcriptase reaction mixture containing 2.5 U Taq polymerase,
50 mM KC1,25 mM Tris/HCl (pH 8-3),1.5 mM MgCl,, 0.01 YO
(w/v) gelatin, 100 pmol each of four primers and 25 mM of each
deoxynucleotide triphosphate (dATP, dGTP, dCTP and
dTTP). The thermal profile involved 30 cycles of denaturation
at 94 "C for 1 min (the first cycle was for 3 min), primer
annealing at 55 "C for 2 min, and extension at 72 "C (the last
cycle was for 5 min).
The amplified products were analysed by electrophoresis on
1.2 YO (w/v) agarose gels containing ethidium bromide
............................................................................................................
Fig. 2. Restriction endonuclease map of the
cloned 3.6 kbp Sall fragment, sequenced
region, subcloned fragments, sequencing
strategy and probes. Various restriction
fragments were cut out from these plasmids
and cloned into pUC19 by random cloning
for sequencing. Dotted lines indicate
sequenced fragments. Solid arrows indicate
sequencing with M13 or M13 RV primers.
The open arrow indicates the sequencing
with primer p-705.
(1 ng ml-l) and the products were identified by Southern
hybridization by using probe B.
Primer extension. About 50pg total RNA and 10pmol
oligonucleotide primer p-70P labelled with [Y-~,P]ATP
at the 5'
end were dissolved in 100 p10-4 M NaC1,40 mM PIPES, 1 mM
EDTA. The solution was incubated at 95 "C for 5 min and
cooled to 42 "C. The nucleic acids were then precipitated with
ethanol, washed with 80 YO(v/v) ethanol, dried, and redissolved
in 20 p150 mM Tris/HCl (pH 8.3), 120 mM KC1,8 mM MgCl,,
2 mM dithiothreitol, 0-5 mM deoxynucleotide triphosphates
with 200 U of reverse transcriptase. After incubation at 42 "C
for 1 h, the reaction was stopped by ethanol precipitation; the
precipitate was washed with 80% (v/v) ethanol, dried, redissolved in 7.5 p1 double-distilled water, and then subjected to
8 M urea/6 % (w/v) polyacrylamide gel electrophoresis.
RESULTS
Southern hybridization analysis
Chromosomal DNA from BCG Tokyo and Pasteur was
digested with SalI and fractionated by 0.8% (w/v)
agarose gel electrophoresis. Fragments of 3.6 k b p gave
clear hybridization with probes A and B (Fig. 1). The
fragments were harvested, cloned into pUC19, and used
for further study.
Nucleotide sequencing
T h e DNA sequencing strategy is shown in Fig. 2, and the
nucleotide sequence in Fig. 3. T h e sequence data were
stored and analysed by DNASIS. T h e DNA sequence of the
MPB70 gene o f BCG Pasteur was identical to the sequence
of the MPB70 gene of BCG Tokyo. T h e DNA sequence
contained a 579 bp open reading frame beginning with
ATG at position 1 and ending with a TAA stop codon at
position 580. A Shine-Dalgarno (SD) sequence was found
upstream o f the initiation codon (Fig. 3).
Northern hybridization analysis
The expression of the MPB70 gene was examined by
Northern hybridization analysis. T w o clear hybridization
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:08:13
1603
T. M A T S U O a n d O T H E R S
GTCTACATCCTTGTCCCTGGCACCGGCACCCTCACGGT
CGTGAGGGACGGAAAGCCACCCACACTACCGATCAGCGGGCCGCCGACCACCCATCAGGT
C(;TTTTTTCCITCACCTACGGATGMTATCCATCCAAGACCCGGACGCCTCCGAAGAAAT
CATGTCGGGGGTAGCGAGACGGCACAACCCGCCGTCTCCGGCAGCCAACGAGTGAACGGC
18
28
30
40
50
58
23s 60
ATGAAGCTAAACAACACCGCCAACCAG~CCCGCCGGCCGGCCTGCCGGCTCTC
1 MetLysVal LysAsnThrIleAlaAlaThrSerPheAlaAlaAlaGlyLeuAlaAlaLeu
n
88
90
100
110
120
16s -
GCGGTGGCTGTCTCACCGCCGGCGGCCGCAGGCGATCTGGTGGGCCCGGGCTGCGCGGAA
21 AlaVal AlaVal SerProProAl aAl aAlaGlyAspLeuValGl yProGlyCysAlaG1u
130
140
158
160
170
180
TACCCGGCAGCCAATCCCACTGCGCCGGCCTCCCTGCAGGGAATGTCGCAGGCCCGGTC
41 TyrAlaAlaAlaAsnProThrGlyProAlaSerValGlnGl~tSerGlnAspProVal
190
200
210
220
230
248
GCGGTGGCGGCCTCGAACAATCCGGAmGACAACGCTGACGGCTGCACTGTCGGGCCAG
uLeuThrThrLeuThrAlaAlaLeuSerGlyGln
6 1 AlaValAlaAlaSerAsnAsnPr~l
250
268
270
280
290
300
CTCAATCCGCAAGTAAACCTGGTGGACACCCTCAACAGCGGTCAGTACACGGTGTTCGCA
81 LeuAsnProGl nValAsnLeuValAspThrLeuAsnSerGlyGlnTyrThrValPheAla
310
320
330
348
350
360
CCGACCAACGCGCCA~AGCAACCTCCCGCCATCCACGATCGACGAGCTCAAGACCAAT
101 ProThrAsnAlaA1aPheSe r L ysLeuP r d laSe rThr IleAspCl uLeuLysTh rAsn
370
380
398
400
410
420
Fig. 4. Northern hybridization analysis, using probe B, of BCG
Tokyo and Pasteur. Twenty micrograms of total RNA was
loaded in each lane. 165 rRNA and 235 rRNA were used as size
markers,
TCGTCACTGCTGACCACCATCCTGACCTACCACGTAGTGGCCGGCCAAACCAGCCCGGCC
121 SerSerLeuLeuThrSerIleLeuThrTyrHi sValVal AlaGlyGlnThrSrProAla
430
440
458
460
470
480
AACGTCGTCGGCACCCGTCAGACCCTCCAGGGCGCCAGCGTTGACGGTGACCGGTCACGGT
141 AsnValValGlyThrArgGlnThrLeuGlnGlyAlaSerValThrValThrGlyGlnGly
490
500
510
520
530
540
AACACCCTCAAGGTCGGTAACGCCGACGTCGTCTGTGGTGGGGTGTCTACCCCCAACCCG
161 AsnSer LeuLysValClyAsnAlaAspValValCysGlyGlyVal SerThrAlaAsnAla
550
568
570
580
590
688
ACGCTGTACATGArrCACAGCGTGCTAATGCCTCCGGCGTAATCGTCCGCGCACGCCGCC
181 ThrValTyrMet IleAspSerValLeuMetProProAla
610
620
630
640
650
660
ACCCGCCCTGAGAGCCACTGAGCATGTGCCAGAATG~CCGGCAGTCGCA(;TTCTGACCTCA
670
688
698
700
710
720
GTCCAACCGCAGGAATCGCCGTGGCAAGTACCGAGGTGCAGCA~CGCCCCCTCGCAAC
730
ATGACGTCGAC
................................................................................ ..........................................................................
Figrn3. Nucleotide and deduced amino acid sequence of the
MPB70 gene from BCG Tokyo and Pasteur. The SD sequence is
underlined. Asterisks indicate the transcriptional start sites.
Numbers above the alignment indicate the nucleotide
sequence, whereas those at the side refer t o the deduced
amino acid sequence.
bands were detected by probe B in BCG Tokyo but not in
Pasteur (Fig. 4). The size of the mRNA of the MPB70
gene was similar to that of 16s rRNA. Under these
conditions, 16s rRNA was detectable in both substrains
using the 603 bp 16s rRNA PCR product as a probe (data
not shown) .
1604
Amplification
Primers p-70N and p-70C amplified a 422 bp MPB70 PCR
product from the coding sequence of the MPB70 gene.
Primers p-l6N and p-l6C amplified a 603 bp 16s rRNA
PCR product from the coding sequence of the 16s rRNA
gene. Two pairs of the primers co-amplified a 422 bp
MPB70 and a 603 bp 16s rRNA product from genomic
DNA of both BCG Tokyo and Pasteur. These two
products were almost the same in quantity after 30 cycles
of amplification. Under these conditions, gene expression
was compared by the RT-PCR method between BCG
Tokyo and Pasteur (Fig. 5a). In BCG Tokyo, a 603 bp 16s
rRNA PCR product and a 422 bp MPB70 PCR product
were detected. In BCG Pasteur, a 603 bp rRNA PCR
product was detected and the quantity of the product was
almost equal to that of BCG Tokyo, but a 422 bp MPB7O
PCR product was not observed. However, when an
additional 30 cycles of amplification were performed, the
422 bp MPB70 PCR product was detectable. When the
RNAs were treated with RNase A, PCR products were
not detected. The amplified product from MPB70 gave a
clear hybridization band by Southern hybridization analysis (Fig. 5b).
Primer extension
For primer extension, the primer was hybridized to
MPB70 mRNA of BCG Tokyo and then extended by
reverse transcriptase. Two elongation products were
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:08:13
Differential regulation of the MPB70 gene
b
p
1
2
3
4
5
6
7
8
1357 1078 872 603 -
4 603 bp
4 422 bp
310 281 -
422 bp
detected, at positions - 57 and - 49, by the primer p-70P
(Fig. 6).
DISCUSSION
The MPB70 genes of BCG Tokyo and Pasteur were
cloned, sequenced, and compared to investigate why this
protein is secreted differently in these substrains. Southern
hybridization patterns of the two substrains were identical
in all cases when tested with probes derived from the
MPB70 gene. The MPB70 gene sequences of the two
substrains were identical, including their promoter-like
sequences. The sequence of the mature protein was
perfectly identical with that determined in our previous
work (Terasaka e t al., 1989). Furthermore, the upstream
region, including the promoter-like sequence, and the
downstream region of the MPB70 gene were perfectly
identical. When compared with other MPB70 sequence
data (Terasaka e t al., 1989; Radford e t al., 1990;
Matsumoto e t al., 1995), the mature protein regions were
perfectly identical. However, there were a few differences
in the upstream or downstream regions. The DNA
sequence of the M. bovis MPB70 gene was reported from
position - 81 to 582 (Radford e t al., 1990). In comparison
with our data, there was a single deletion at position - 28
and a single insertion between positions - 31 and - 30 in
the region upstream of the SD sequence. In the signal
peptide region, there was a single deletion at position 47
and a single insertion between positions 49 and 50. The
DNA sequence of the M. tzlberczllosis MPB70 gene was
reported from position - 157 to position 726 (Matsumoto
e t al., 1995). The sequence of the MPB70 gene including
the non-coding region or expected regulatory region was
identical to that of BCG Tokyo and Pasteur, but the
amount of secretion was quite different. In M. bovis AN5,
there were a few mutations, but these seemed not to
influence MPB70 gene expression.
The nucleotide sequences of various BCG and M.
tuberculosis genes have been reported. The 65 kDa gene
..................................................................... ...............................
........
Fig, 5. RT-PCR or PCR analysis (a) and
Southern hybridization analysis (b) of BCG
Tokyo and Pasteur. Lanes: 1, PCR, BCG
Tokyo; 2, RT-PCR, BCG Tokyo; 3, RT-PCR
(additional amplification), BCG Tokyo; 4, RTPCR (treated with RNase A), BCG Tokyo; 5,
PCR, BCG Pasteur; 6, RT-PCR, BCG Pasteur;
7, RT-PCR (additional amplification), BCG
Pasteur; 8, RT-PCR (treated with RNase A),
BCG Pasteur. The numbers on the left indicate
sizes of standard DNA fragments.
sequences reported by two groups (Thole e t al., 1987;
Shinnick, 1987) were completely identical. The MPB/
MPT64 genes (Yamaguchi e t al., 1989; Oettinger &
Andersen, 1994) were identical except for one silent
mutation. The B component of 85-complex genes (Matsuo
e t al., 1988) was also identical except for a single nucleotide
sequence. The A component of 85-complex genes (De
Wit e t al., 1990; Borremans e t al., 1989) was different only
in a few nucleotide changes. In all cases, these genes were
highly conserved and presumed to play functionally
important roles. Comparing the genes of BCG Tokyo and
Pasteur in the present study, the MPB64 gene was absent
in BCG Pasteur but the MPB70 genes were completely
identical and the gene expression was obviously found in
both BCG Tokyo and Pasteur. It was thus thought that
MPB70 may play some physiologically important role.
Next, we investigated which steps concerned differential
gene expression of MPB70 by Northern analysis and RTPCR. To extract pure RNA from mycobacteria it is
important to lyse the cell wall quickly, but the complex
structure and impermeability of the cell walls of mycobacteria make the lysis difficult (Boddinghaus e t al., 1990).
We disrupted the cells mechanically using glass beads
with denaturing solution for about 2 min. Then total
RNAs were extracted according to the method of
Chomczynski & Sacchi (1987). This procedure was simple
and rapid compared to other methods for lysing mycobacterial cell walls.
Northern hybridization analysis gave a clear-cut difference
between the two substrains. Two clear hybridization
bands were observed in BCG Tokyo, but not in BCG
Pasteur (Fig. 4). Since probe B contained 149 bp downstream from the stop codon of the MPB70 gene, it may
have hybridized to RNA irrelevant to the MPB70 gene.
The primer extension experiment with BCG Tokyo
revealed two transcriptional initiation signals. These
results suggested that two kinds of mRNA, different in
size, were synthesized.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:08:13
1605
T. M A T S U O a n d O T H E R S
G
A
A
G
A
A
A
T
C
A
-57- - -.-
BT
C
G
G
G
G
A
G
C
G
Fig. 6. Primer extension analysis. Lanes: P, 10pmol of primer
was used; TCGA, dideoxy sequencing. The sequence indicated is
the transcribed strand. The same primer was hybridized t o the
template containing the Accl fragment in the Accl site of
pUCl9.
The RT-PCR method was so sensitive that great care had
to be taken to avoid contamination of DNAs even in trace
amounts (Yamaguchi e t a/., 1992). RNA samples were
carefully examined for contamination of genomic DNAs
by two means. One was that RNA samples were examined
for no amplification of the 16s rRNA gene by primers
without the reverse transcriptase reaction. The other was
that RNA samples were treated with RNase A and then
examined for no amplification by RT-PCR. RT-PCR data
indicated that MPB70 gene expression was seen in BCG
Pasteur, but very weakly. This conclusion was confirmed
by RT-PCR-Southern hybridization and additional amplification. The additional amplification for BCG Pasteur
detected a trace amount of MPB70 gene expression, and
non-specific PCR products were also detectable (Fig. 5).
These products were concluded to be dimers from the size
of the fragments. In the additional amplification, it was
thought that the depletion of reaction components and
accumulation of products may induce a non-specific
reaction.
In conclusion, this study suggests that the difference in
secretion of the MPB70 antigen proteins between BCG
1606
Tokyo and Pasteur is due to differential efficiencies of
transcription. There was no difference in the immediate
upstream region between the two substrains ; regulatory
protein(s) may be concerned with differential initiations of
transcription. Finally, it has to be stressed that there is
another possibility, of differences in mRNA stability. The
biological and immunological significance of MPB70 is as
yet unknown. Further study on these points is necessary.
ACKNOWLEDGEMENTS
This work was partly supported by a grant from the Sasagawa
Memorial Health Foundation.
REFERENCES
Boddinghaus, B., Rogall, T., Flohr, T., Blocker, H. & Bottger, E. C.
(1990). Detection and identification of mycobacteria by ampli-
fication of rRNA. J Clin Microbiol28, 1751-1759.
Borremans, M., De Wit, L., Volckaert, G., Ooms, J., de Bruyn, J.,
Huygen, K., van Vooren, J., Stelandre, M., Verhofstadt, R. &
Content, 1. (1989). Cloning, sequence determination, and expression of a 32-kilodalton-protein gene of Mycobacterium tuberculosis. Infect Immun 57, 3123-3130.
Chomczynski, P. & Sacchi, N. (1987). Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162, 156-159.
Collins, D. M. & De Wit, L. (1987). BCG identification by DNA
restriction fragment patterns. J Gen Microbioll33, 1431-1434.
De Wit, L., de la Cuvellerie, A., Ooms, J. & Content, J. (1990).
Nucleotide sequence of the 32 kDa-protein gene (antigen 85 A) of
Mycobacterium bovis BCG. Nuclei Acids Res 18, 3995.
Fomukong, N. G., Dale, 1. W., Osborn, T. W. & Grange, 1. M.
(1992). Use of gene probes based on the insertion sequence IS986 to
differentiate between BCG vaccine strains. J Appl Bacteriol 72,
126-133.
Grunstein, M. & Wallis, 1. (1979). Colony hybridization. Methods
E n ~ m o l 6 8379-389.
,
Harboe, M., Nagai, S., Patarroyo, M. E., Torres, M. L., Ramirez,
C. & Cruz, N. (1986). Properties of proteins MPB64, MPB70, and
MPB80 of Mycobacterium bovis BCG. Infect Immun 52, 293-302.
Harboe, M., Wiker, H. G. & Nagai, 5. (1992). Protein antigens of
mycobacteria studied by quantitative immunologic techniques. Clin
Infect Dis 14, 313-319.
Hattori, M. & Sakaki, Y. (1986). Dideoxy sequencing method using
denatured plasmid templates. Anal Biochem 152, 232-238.
Lehrach, H., Diamond, D., Wozney, J. M. & Boedtker, H. (1977).
RNA molecular weight determinations by gel electrophoresis
under denaturing conditions, a critical reexamination. Biochemisty
16, 4743-4751.
Li, H., Ulstrup, J. C., Jonassen, T. O., Melby, K., Nagai, S. &
Harboe, M. (1993). Evidence for absence of the MPB64 gene in
some substrains of Mycobacterium bovis BCG. Infect Immun 61,
1 7 3 M734.
Matsumoto, S., Matsuo, T., Ohara, N., Naito, M., Minami, J. &
Yamada, T. (1995). Cloning and sequencing of the MPT70 from
Mycobacterium tuberculosis H37Rv and expression in mycobacteria
using E . coli-Mycobacteria shuttle vector. Scand J Immunol 41
281-287.
Matsuo, K., Yamaguchi, R., Yamazaki, A., Tasaka, H. & Yamada,
T. (1988). Cloning and expression of the Mycobacterium bovis BCG
gene for extracellular alpha antigen. J Bacterioll70, 3847-3854.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:08:13
Differential regulation of the MPB70 gene
Minnikin, D. E., Parlett, 1. H., Magnusson, M., Ridell, M. & Lind, A.
(1984). Mycolic acid patterns of representatives of Mycobacterium
Suzuki, Y., Yoshinaga, K., Ono, Y., Nagata, A. & Yamada, T.
(1987). Organization of rRNA genes in Mycobacterium bovis BCG. J
Bacteriof 169, 839-843.
Miura, K., Nagai, S., Kinomoto, M., Haga, 5. & Tokunaga, T.
(1983). Comparative studies with various substrains of Mycobacterium bovis BCG on the production of an antigenic protein,
MPB70. Infect Immun 39, 54&545.
Suzuki, Y., Nagata, A., Ono, Y. & Yamada, T. (1988). Complete
nucleotide sequence of the 16s rRNA gene of Mycobacterium bovis
BCG. J Bacteriof 170, 2886-2889.
bovis BCG. J Gen Microbiof 130, 2733-2736.
Nagai, S., Matsumoto, J. & Nagasuga, T. (1981). Specific skin-
reactive protein from culture filtrate of Mycobacterium bovis BCG.
Infect Immun 31, 1152-1160.
Oettinger, T. & Andersen, A. B. (1994). Cloning and B-cell epitope
mapping of MPT64 from Mycobacterium tuberculosis H37Rv. Infect
Immun 62, 2058-2064.
Patarroyo, M. E., Parra, C. A., Pinilla, C., del Portillo, P., Torres, M.
L., Clavijo, P., Salazar, L. M. & Jimenez, C. (1986). Immunogenic
synthetic peptides against mycobacteria of potential immunodiagnostic and immunoprophylactic value. Leprog Rev 2, 163-168.
Pollock, J. M., Douglas, A. J., Mackie, D. P. & Neill, 5. D. (1994).
Identification of bovine T-cell epitopes for three Mycobacterium bovis
antigens: MPB70, 19,000 MW and MPB57. Immunology 82, 9-15.
Radford, A. J., Duffield, B. J. & Plackett, P. (1988). Cloning of a
species-specific antigen of Mycobacterium bovis. Infect Immun 56,
921-925.
Radford, A. J., Wood, P. R., Billman, 1. H., Geysen, H. M., Mason,
T. J. & Tribbick, G. (1990). Epitope mapping of the Mycobacteritlm
bovis secretory protein MPB70 using overlapping peptide analysis.
J Gen Microbiof 136, 265-272.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). MofecufarCloning:
Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory.
Shinnick, T. M. (1987). The 65-kilodalton antigen of Mycobacterium
tubercufosis.J Bacteriof 169, 839-843.
Terasaka, K., Yamaguchi, R., Matsuo, K., Yamazaki, A., Nagai, 5.
& Yamada, T. (1989). Complete nucleitde sequence of immunogenic
protein MPB70 from Mycobacterium bovis BCG. F E M S Microbiof
Lett 49, 273-276.
Thole, J. E., Keulen, W. J., De, B. J., Kolk, A. H., Groothuis, D. G.,
Berwald, L. G., Tiesjema, R. H. & van Embden, J. D. (1987).
Characterization, sequence determination, and immunogenicity of a
64-kilodalton protein of Mycobacterium bovis BCG expressed in
Escbericbiu cofi K-12. Infect Immun 55, 1466-1475 [erratum in Infect
Immtrn 55, 19491.
Wiker, H. G., Harboe, M. & Nagai, 5. (1991). A localization index
for distinction between extracellular and intracellular antigens of
Mycobacterium tuberculosis. J Gen Microbiof 137, 875-884.
Yamaguchi, R., Matsuo, K., Yamazaki, A,, Abe, C., Nagai, S.,
Terasaka, K. & Yamada, T. (1989). Cloning and characterization of
the gene for immunogenic protein MPB64 of Mycobacterium bovis
BCG. Infect Immun 57, 283-288.
Yamaguchi, M., Dieffenbach, C. W., Connolly, R., Cruess, D. F.,
Baur, W. & Sharefkin, J. B. (1992). Effect of different laboratory
techniques for guanidinium-phenol-chloroformRNA extraction
on A,,,/A,,, and on accuracy of mRNA quantitation by reverse
transcriptase-PCR, PCR Methods A p p f 1, 286-290.
u
Received 20 October 1994; revised 27 February 1995; accepted 14 March
1995.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Thu, 15 Jun 2017 14:08:13
1607