From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
Characterization of Seven Low Incidence Blood Group Antigens Carried by
Erythrocyte Band 3 Protein
By P. Jarolim, H.L. Rubin, D. Zakova, J. Storry, and M.E. Reid
Recent studies have demonstrated that band 3 carries antigens of the Diego blood group system and have elucidated
the molecular basis of several previously unassigned low
incidence and high incidence antigens. Because the available
serological data suggested that band 3 may carry additional
low incidence blood group antigens, we screened band 3
genomic DNA encoding the membrane domain of band 3 for
single-strand conformational polymorphisms. We found that
the putative first ectoplasmic loop of band 3 carries blood
group antigen ELO, 432 Arg=Trp; the third putative loop
harbors antigens Vga (Van Vugt), 555 Tyr=His, BOW 561
Pro=Ser, Wu (Wulfsberg), 565 Gly=Ala, and Bpa (Bishop),
569 Asn=Lys; and the putative fourth ectoplasmic loop
carries antigens Hga (Hughes), 656 Arg=Cys, and Moa (Moen),
656 Arg=His. We studied erythrocytes from carriers of five of
these blood group antigens. We found similar levels of
reticulocyte mRNA corresponding to the two band 3 gene
alleles, normal content and glycosylation of band 3 in the red
blood cell membrane, and normal band 3-mediated sulfate
influx into red blood cells, suggesting that the mutations do
not have major effect on band 3 structure and function. In
addition to elucidating the molecular basis of seven low
incidence blood group antigens, these results help to create
a more accurate structural model of band 3.
r 1998 by The American Society of Hematology.
B
the cytoplasmic domain of band 3 underlies the abnormal
electrophoretic mobility of a polymorphic band 3 variant known
as band 3 Memphis.15,16 Yet another variant of band 3, known as
band 3 Memphis II, displays, in addition to the abnormal
electrophoretic mobility, an increased binding of the anion flux
inhibitor dihydrodiisothiocyanatodisulfonate, disodium salt
(H2DIDS).17 Spring et al18 reported that the Memphis II variant
of band 3 carries the Dia blood group antigen.
Dia is a low incidence blood group antigen in Caucasians that
is antithetical to Dib.19 Prevalence of Dia is much higher in
American Indians, reaching up to 54% in some groups of South
American Indians.20 The underlying polymorphism is a single
amino acid substitution in position 854, with proline of the
wild-type band 3 corresponding to the Dib antigen and leucine
to the Dia antigen.21,22 Dia and Dib became the first fully
characterized antigens of the Diego blood group system assigned to the band 3 protein.21 Subsequently, Bruce et al23 and
our group24 have mapped the low incidence blood group antigen
Wra to the C-terminal end of the fourth ectoplasmic loop.
Glutamic acid 658 from the wild-type band 3 sequence underlies the high incidence antigen, Wrb, whereas the low incidence
antigen, Wra, has lysine in the same position.
Recently, we and others have shown25,26 that three additional
low incidence antigens, Rba,27 WARR,28 and Wda,29 are associated with different single point mutations on band 3 and
therefore belong to the Diego system. The amino acid changes
associated with these three antigens are, respectively,
548Pro=Leu,30,31 552Thr=Ile,32,33 and 557Val=Met.30,31,34,35
Although only one subject has been studied for another low
incidence antigen, Tra, the experimental evidence strongly
suggests that it is also located on the erythroid band 3 protein,
with the underlying polymorphism being 551Lys=Asn.31
Discovery of the molecular basis of these antigens yielded
the first insight into the Diego blood group system as well as
valuable information on the position and size of the external
loops of band 3. In addition, in the case of Wrb, it helped to
characterize the site of the band 3-glycophorin A interaction,
because the Wrb antigen requires the presence of both these
proteins for its expression.24,36,37 These results also suggested
band 3 might carry additional low incidence antigens. We
therefore reviewed the list of remaining low incidence antigens
that had serological characteristics consistent with the possibility of their being carried by band 3 and that we had in liquid
AND 3 (anion exchanger 1 [AE1]) is the most abundant
integral protein of the red blood cell (RBC) membrane,
being present in more than 1 million copies per RBC. It consists
of two structurally and functionally largely independent domains. The N-terminal cytoplasmic domain of band 3 links the
membrane to the underlying spectrin-based membrane skeleton
and interacts with several glycolytic enzymes, hemoglobin, and
hemichromes. The main function of the C-terminal membrane
domain is to mediate exchange of chloride and bicarbonate
anions across the plasma membrane. Current structural models
predict that the membrane domain consists of 12 to 14
transmembrane helices connected by ectoplasmic and endoplasmic loops.1-4 The longest, fourth loop of band 3 is Nglycosylated1,4 and the carbohydrate chain carries more than
half of the RBC ABO blood group epitopes.5
Mutations of band 3 protein have been implicated in the
pathogenesis of Southeast Asian ovalocytosis,6,7 hereditary
spherocytosis,8-11 congenital acanthocytosis,12 and, recently,
distal renal tubular acidosis.13,14 An amino acid substitution in
From the Department of Pathology, Brigham and Women’s Hospital,
Harvard Medical School, Boston, MA; the Institute of Hematology and
Blood Transfusion, Prague, Czech Republic; the Department of Biomedical Research, St. Elizabeth’s Medical Center, Tufts University School of
Medicine, Boston, MA; and the Immunohematology Laboratory, New
York Blood Center, New York, NY.
Submitted May 26, 1998; accepted August 11, 1998.
Supported in part by a grant from the National Blood Foundation
(P.J.), by Grant No. 4118-3 from the Grant Agency of the Ministry of
Health, Czech Republic (P.J.), and by a National Institutes of Health
Specialized Center of Research (SCOR) grant in Transfusion and
Medicine (HL 54459; M.E.R.).
Presented in part at the 49th Annual Meeting of the American
Association of Blood Banks, Orlando, FL, October 6-10, 1996.
Address reprint requests to P. Jarolim, MD, PhD, Department of
Pathology, Brigham and Women’s Hospital, Harvard Medical School,
75 Francis St, Boston, MA 02111; e-mail: [email protected].
edu.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to indicate
this fact.
r 1998 by The American Society of Hematology.
0006-4971/98/9212-0026$3.00/0
4836
Blood, Vol 92, No 12 (December 15), 1998: pp 4836-4843
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD GROUP ANTIGENS ON ERYTHROCYTE BAND 3
nitrogen storage. We found that antigens Bpa (Bishop),38 Wu
(Wulfsberg),39 Moa (Moen),40 Vga (Van Vugt),41 Hga (Hughes),42
BOW,43 and ELO44 fulfilled these criteria and proceeded with
characterization of their molecular basis.
MATERIALS AND METHODS
Subjects. Samples were obtained through the Serum, Cell and Rare
Fluid (SCARF) exchange program or as gifts from numerous colleagues. Initial testing was performed on DNA isolated from blood
samples stored in liquid nitrogen; additional testing was performed on
freshly drawn blood samples shipped on ice to Boston. The subjects
were heterozygotes for the studied blood group antigens.
DNA preparation. DNA was isolated from blood samples (,150
µL) that had been stored in liquid nitrogen or that had been obtained as
fresh samples using the QIAamp Blood Kit (QIAGEN Inc, Chatsworth,
CA). The manufacturer’s procedure for DNA isolation from whole
blood was followed. The eluted DNA was used directly for polymerase
chain reaction (PCR) amplification.
Single-strand conformational polymorphism (SSCP) analysis and
sequencing of band 3 genomic DNA. SSCP screening was performed
according to Orita et al,45,46 with minor modifications. Exons encoding
the membrane domain of band 3 were PCR-amplified using pairs of
intronic primers flanking the exons (Table 1; 35 cycles of 1 minute at
94°C and 1 minute at 60°C). To each 10 µL PCR reaction, 2.5 µCi
32P-dATP (3,000 µCi/mmol; ICN, Costa Mesa, CA) was added. The
PCR products were diluted in formamide loading buffer (86% formamide, 10% glycerol, 20 mmol/L EDTA, 0.25% bromophenol blue,
0.25% xylene cyanol), heat-denatured by boiling for 5 minutes, and
quickly cooled on ice. Samples were electrophoresed for 16 hours at
room temperature in a nondenaturing polyacrylamide mutation detection enhancement (MDE) gel (FMC BioProducts, Rockland, ME).
Briefly, 25 mL MDE gel solution was mixed with 69 mL deionized
water, 6 mL 103 TBE, 0.4 mL 10% ammonium persulfate, and 40 µL
TEMED, and electrophoresis was performed at 8 W in the presence and
at 4 W in the absence of 10% glycerol. The gel was exposed to Kodak
XAR-5 film (Eastman Kodak, Rochester, NY) overnight at 280°C
using intensifying screens. The band 3 gene exons displaying the SSCP
were directly sequenced using the Sequenase version 2.0 DNA Sequencing Kit (Amersham, Arlington Heights, IL). We limited our SSCP
screening to exons 11 to 20 of the band 3 gene, because these 10 exons
encode the whole membrane domain of band 3 and mutations causing
altered immunogenicity of band 3 are to be expected only in this portion
of band 3.
Sequence comparisons and structural predictions. All 12 currently
known amino acid sequences of human,1,4 mouse,2 rat,47 chicken,48,49
and trout50 erythroid band 3 proteins (AE1) and of the related anion
exchangers AE2 from human,51,52 mouse,53 rat,48 and rabbit54 and AE3
from human,55 mouse,56 and rat48 were retrieved from Genbank and
aligned using the program CLUSTAL (PCGene; Intelligenetics, Mountain View, CA). Predictions of the number and position of band 3
4837
transmembrane helices were made using programs RAOARGOS,
HELIXMEM, and SOAP (PCGene) based on the reported human AE1
cDNA sequence.1,4 Based on these predictions, sequence comparisons,
and available data on band 3 modifications by enzymes and chemicals
with known cleavage and binding sites, we created a model of band 3
with 14 transmembrane helices.
Detection of band 3 mRNA alleles in reticulocyte RNA. Total
reticulocyte RNA was isolated by ammonium chloride lysis57 and
reverse transcribed using random primers. cDNA was PCR-amplified
using primers flanking the mutations, and the PCR product was digested
with the appropriate restriction endonuclease. The digested PCR
product was visualized by electrophoresis in agarose gels stained by
ethidium bromide and the amount of DNA of individual bands was
quantitated by densitometric scanning using the Eagle Eye II system
(Stratagene, La Jolla, CA) and the ONE-Dscan 1.0 program (Scanalytics, Billerica, MA).
Sulfate fluxes and di-isothiocyano-dihydrostilbene disulphonate
(DIDS) titration curves. Cells were washed three times at 4°C in 140
mmol/L NaCl, 10 mmol/L Na phosphate, pH 7.4 (PBS), and three times
in 84 mmol/L trisodium citrate, 1 mmol/L EGTA, pH 6.5, and subjected
to assays of unidirectional disodium 35S-sulfate (ICN, Costa Mesa, CA)
uptake in the absence or in the presence of increasing concentrations of
the anion transport inhibitor DIDS (Molecular Probes, Eugene, OR), as
described.10 Each flux study in RBCs carrying the studied antigens was
performed in parallel using RBCs from unrelated subjects not carrying
the antigens. The dependence of the sulfate influx on the increasing
concentrations of DIDS was obtained using the linear least squares fit.
Enzyme treatment of intact RBCs. One volume of washed RBCs
was treated with 4 vol of a-chymotrypsin (5 mg/mL) for 1 hour at 37°C.
Enzyme-treated cells were washed three times with PBS. Both treated
and untreated antigen-positive RBCs were tested in parallel with the
appropriate antisera.
Quantitation of erythrocyte membrane proteins. Freshly drawn
blood anticoagulated in acid citrate/dextrose was shipped on ice to
Boston. Within 48 hours of phlebotomy, erythrocyte ghosts were
prepared using the method of Dodge et al,58 with minor modifications
described in Jarolim et al.8 Erythrocyte membrane proteins were
analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) followed by densitometry as described,9 and the relative
amounts of RBC membrane proteins were expressed as ratios of
integrated densitometric peaks of individuals’ proteins to the peak of
band 3. The biochemical findings were correlated with the clinical data
and the results were statistically evaluated.
RESULTS
SSCP are detected in three exons. We detected SSCP
polymorphisms in exon 12 in the carrier of the ELO antigen; in
exon 14 for Vga, BOW, Wu, and Bpa; and in exon 16 for Hga and
Moa (Fig 1).
Table 1. Intronic Primers Used for PCR Amplification of Exons Encoding the Membrane Domain of Band 3
Exon
11
12
13
14
15
16
17
18
19
20
Sense Primer (58 to 38)
11A
12A
13A
14A
15A
16A
17A
18A
19A
20A
TCCTCCAGCTACTCCCTCTGA
CCTGGAAATGATCTCCTGACCT
CCTTGCCCCAAGACCCTTTGA
CCAAGCCAAAGCTGGGAGAGA
GGGGAGTGACTGGGCACTGA
CCATCCTCCTGCCCTTGGCA
GGAGAACCCTGCTTACCCCTC
AACCTGGGCTGAGAGTGTGCG
GGGGTGTGATAGGCACTGACC
CTCTTCTGGCCCCAGGGTCT
Antisense Primer (58 to 38)
11B
12B
13B
14B
15B
16B
17B
18B
19B
20B
CAGAGGGTCAGAGGCAAGAGT
ACCATGCATCAGGCAGGTGGT
CTTATACACAACCTCCCGTGTG
GGGCTGGGATAGGGCAGTGT
ATGAGGACCTGGGGGGTATCA
GCCAGGGAAAGGTCTCTGCC
GAGGATGGTGAAGACGCGACC
TCTACCACCCCAGGCTGGGC
CCCTCGCATGCTCCCAGCTC
TGCTCCAGGAGGATCCTGAGT
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
4838
JAROLIM ET AL
Fig 1. Detection of seven SSCPs. SSCP screening detected
polymorphisms in exon 12 in genomic DNA from the ELO heterozygote, four polymorphisms in
exon 14, and two polymorphisms
in exon 16. Two normal bands (n)
visible in wild-type (wt) homozygotes correspond to complementary strands of PCR-amplified
DNA. Heterozygosity is reflected
by the presence of an additional
1 to 2 bands.
Sequence analysis of genomic DNA shows seven amino acid
substitutions. We PCR-amplified and directly sequenced exons containing the SSCPs. The detected mutations are summarized in Table 2. We have verified the presence of these
mutations in additional unrelated carriers of these seven blood
group antigens with the exception of Vga, for which only related
individuals were available. All seven mutations either create or
abrogate restriction sites (Table 2). In six cases, we used PCR
amplification followed by restriction digestion with an appropriate restriction endonuclease to confirm the presence of the
mutation in additional carriers of the blood group antigen.
Because endonuclease Tth 2 is not commercially available, we
directly sequenced genomic DNA from the additional Bp(a1)
subject.
Position of the mutated amino acids in band 3. Figure 2
schematically depicts the membrane domain of band 3. The
seven newly characterized blood group antigens are shown in
bold. Previously characterized blood group antigens residing on
band 3 are also shown. According to this scheme, six of seven
mutated amino acids are located in the putative first, third, and
fourth ectoplasmic loops of band 3, whereas asparagine 569,
which is mutated to lysine in Bp(a1) subjects, is located at the
external end of the sixth transmembrane segment. Proline 561,
mutated to serine in the BOW-positive subject, is also relatively
highly conserved; however, the degree of evolutionary conser-
vation in the region of the third external loop shown in Table 2
changes to some extent with variations in the alignment
parameters.
Evolutionary conservation of mutated amino acids. We
aligned the five known AE1 amino acid sequences of the
erythroid band 3 homologues as well as all 12 available
sequences from the AE gene family and evaluated the conservation of individual amino acids. The results show (Table 2) that
most of the mutated amino acids are not conserved in evolution.
The only exception again appears to be the Bpa antigen (569
Asn=Lys) that is conserved in all 12 aligned amino acid
sequences. Consequently, mutation of Asn 569 would be most
likely to affect band 3 structure and anion exchange function.
Effects of enzyme treatment on RBC agglutinability. We
have digested intact RBCs from the carriers of all seven studied
blood group antigens by trypsin, a-chymotrypsin, pronase, and
ficin. The results of testing untreated and enzyme-treated
antigen-positive RBCs are shown in Table 3. At least two sera
containing antibodies to the seven low incidence antigens were
tested on two independent experiments. Whereas the results for
Vga, BOW, Wu, Hga, and Moa are expected, the results with
ELO and Bpa were not and will be discussed later.
Similar quantities of normal and mutant mRNA alleles are
detected in reticulocyte RNA. We isolated and reversetranscribed total reticulocyte RNA and amplified the cDNA as
Table 2. Summary of Detected Band 3 Mutations
Blood
Group
No. of
Subjects
Codon
Triplet
Amino
Acid
Band
3 Loop
Conserved
ELO
Vga
BOW
Wu
Bpa
Hga
Moa
2
2*
2
6
2
4
2
432
555
561
565
569
656
656
CGG = TGG
TAC = CAC
CCC = TCC
GGC = GCC
AAC = AAA
CGT = TGT
CGT = CAT
Arg = Trp
Tyr = His
Pro = Ser
Gly = Ala
Asn = Lys
Arg = Cys
Arg = His
1
3
3
3
3
4
4
4/5, 4/12
N/A, N/A†
3/5, 10/12
3/5, N/A†
5/5, 12/12
1/5, 1/12
3/5, 3/12
Restriction
Site Abrogated
Restriction
Site Created
Msp I,NciI
BstNI
Dra III
BstEII
Ban I
Apa I
Tth 2‡
Cac8I
Bsm I
*Both subjects from the same family.
†Because of deletions and insertion in band 3 homologues from evolutionarily older species, the degree of conservation cannot be established
in this region of putative third ectoplasmic loop.
‡Restriction endonuclease Tth 2 is not commercially available.
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD GROUP ANTIGENS ON ERYTHROCYTE BAND 3
4839
Fig 2. Antigens of the Diego blood group system. Schematic representation of the membrane domain of band 3 based on the structural
predictions described in the Materials and Methods and Results. Positions of all antigens of the Diego blood group system are indicated; the
seven antigens described in this report are shown in bold.
described. The PCR products were digested with the appropriate restriction endonuclease and electrophoresed in an ethidium
bromide-stained gel. Densitometric scanning of the gel allowed
us to estimate the relative content of mRNA corresponding to
the two band 3 alleles of the heterozygous subjects. Using this
semiquantitative technique, we have not detected significant
differences between the content of the two band 3 cDNA alleles,
suggesting that the mutations affect neither the transcription of
the band 3 gene alleles nor the subsequent RNA processing
(data not shown).
The mutations do not affect band 3 expression and function.
SDS-PAGE electrophoresis showed a normal electrophoretic
pattern of band 3 protein in the carriers of the blood group
antigens, including similar profiles of band 3 glycosylation (not
shown). Subsequent densitometric scanning detected normal
content of band 3 and other RBC membrane proteins. Because
band 3 is the principal anion exchange protein of the RBC
Table 3. Agglutination of Normal and Enzyme-Treated
Antigen-Positive Cells
Untreated
Cells
ELO
Vga
BOW
Wu
Bpa
Hga
Moa
21
31
21
11
31
31
11
Treated Cells
Trypsin
21
31
21
11
0
31
11
a-Chymotrypsin
Pronase
21/0
0
0
0
0
31
11
21/0
0
0
0
0
31
11
Ficin
21
31
21
11
0
31
11
membrane, we compared anion fluxes in erythrocytes from
carriers of the studied blood group antigens with those in
normal RBCs. We did not detect significant differences between
heterozygotes for the seven studied antigens and control
subjects. Results of the DIDS titration of sulfate influx in the
cells expressing the ELO, Wu, and Hga antigens are shown in
Fig 3.
DISCUSSION
As of 1995, 37 low incidence antigens were recognized as
being discrete genetic characteristics unassigned to a particular
blood group system.59 Many of the antibodies to these low
incidence antigens occur together in multispecific sera.60 Often
these same sera contain antibodies to glycophorin A determinants or to Wra, whose antithetical antigen Wrb has been shown
to result from the interaction between glycophorin A and band
3.23,24,36 Thus, we undertook a concerted effort to identify band
3 polymorphisms recognized by these multispecific sera.
This work has led to the identification of seven new band 3
mutations. All substitutions were studied in more than one
subject and the molecular basis of some of them was evaluated
by enzyme treatment of intact, antigen-carrying erythrocytes.
Based on these results, the International Society for Blood
Transfusion (ISBT)/Working Party on Blood Group Terminology assigned the antigens to the Diego blood group as 010008
(ELO), 010009 (Wu), 010010 (Bpa), 010011 (Moa), 010012
(Hga), 010013 (Vga), and 010015 (BOW).
The clinical significance of the seven characterized antigens
and their corresponding antibodies is unclear. The antigens do
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
4840
JAROLIM ET AL
Fig 3. Band 3-mediated influx of radiolabeled sulfate. Influx of radiolabeled sulfate into control cells and cells from carriers of the seven low
incidence blood group antigens was measured as described. No differences between the control wild-type cells and cells expressing the blood
group polymorphisms were detected. Results are shown for the ELO, Wu, and Hga antigens.
not represent a major problem in blood transfusion, because the
majority of donors will lack the antigen. With the exception of
ELO,61,62 they have not been reported in association with a
hemolytic disease of the newborn.
Because it is not clear whether amino acids in the immediate
vicinity of the mutated amino acid residues are sufficient to
form the epitope of the blood group antigen or whether the
epitope depends on the conformation of other portions of band
3, we treated RBCs with enzymes known to modify external
loops of band 3. a-Chymotrypsin cleaves band 3 at tyrosines
553 and 555 of the third ectoplasmic loop and, quite predictably,
a-chymotrypsin treatment abrogated agglutination of the Vga-,
Wu-, and BOW-positive cells with the corresponding antibodies. The agglutination of Hga- and Moa-positive cells was not
affected, because their epitopes are not located in the third loop.
The reactivity of both examples of anti-ELO was unaffected by
trypsin or ficin treatment of antigen-positive RBCs. However,
whereas one anti-ELO was unaffected by a-chymotrypsin or
pronase, the other was nonreactive with RBCs treated with
either of these enzymes. Although this has been observed
previously,63 the reason has not been determined. Perhaps some
anti-ELO antibodies recognize an epitope formed by the
interaction of loop 1 of band 3 with another membrane
component that is a-chymotrypsin or pronase sensitive (such as
the third loop of band 3). Unexpectedly, neither example of
anti-Bpa agglutinated antigen-positive RBCs that had been
treated with any of the enzymes. Again, it is possible that the
epitope recognized by anti-Bpa requires an interaction of the
third loop of band 3 with another, enzyme-sensitive component.
Comparison of the 12 known AE1, AE2, and AE3 sequences
predicts a relatively low degree of conservation for the ectoplasmic loops compared with the transmembrane segments. Accordingly, five mutations occur in poorly conserved amino acids,
whereas one, asparagine 569, that is mutated to Lys in the
Bp(a1) subjects is conserved in all 12 AE homologues. The
high degree of evolutionary conservation of asparagine 569 and
its position at the beginning of the sixth transmembrane
segment in the band 3 model (Fig 2) suggested that its
substitution by positively charged lysine may have major
structural and functional consequences. However, we have
observed neither morphological abnormalities of the Bp(a1)
RBCs nor differences between DIDS titration of sulfate influx
in the Bp(a1) and control RBCs. Proline 561, mutated in BOW,
is conserved in AE1 and AE2; however, only 3 of 5 AE1
sequences contain proline in the corresponding position. With
the exception of BOW, we have studied DIDS-inhibitable
sulfate influx in fresh erythrocytes from carriers of the other
band 3 mutations and found no effect on sulfate influx. Based on
these results, we propose that the first, third, and fourth
ectoplasmic loops are not involved in the regulation of band
3-mediated anion exchange.
The main contributions of this work, besides clarifying the
molecular basis of seven blood group antigens, are twofold.
First, the results strongly support extracellular localization of
the mutated amino acids. Because available serological data
suggest that additional low incidence blood group antigens may
be carried by band 3, ongoing characterization of such antigens
may further improve the structural model of band 3.
Second, some of the antigens are located in the regions that
have been implicated in the adhesion of modified RBCs to
vascular endothelium.64-71 Band 3 was hypothesized to function
as a receptor during invasion of human erythrocytes by
Plasmodium falciparum.64 Naturally occurring anti-band 3
autoantibodies were found to recognize modified band 3 protein
on the surface of Plasmodium falciparum-infected erythrocytes.65 Cytoadherence-related neoantigens on Plasmodium
falciparum-infected human erythrocytes, resulting from the
exposure of normally cryptic regions of the band 3 protein,66
were placed into the third ectoplasmic loop of band 3.67,68 The
antibodies in sera of individuals living in a malaria-endemic
region recognize peptide motifs from the extracellular loops of
band 3,69 and the immune response to these band 3 neoantigens
is associated with low parasite density.70 Monoclonal antibodies
that react with human band 3 residues 542-555 from the third
external loop recognize different band 3 conformations in
uninfected and Plasmodium falciparum-infected erythrocytes.71
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD GROUP ANTIGENS ON ERYTHROCYTE BAND 3
The cytoadherence of Plasmodium falciparum could be blocked
both with synthetic peptides corresponding to motifs from the
third ectoplasmic loop of band 3.67 Erythrocytes from carriers of
low incidence blood group antigens in ectoplasmic loops of
band 3 may serve as a model for evaluation of the sequence
requirements for adhesion of Plasmodium falciparum-infected
erythrocytes to the vascular endothelium.
Kay72 assigned the senescent RBC antigen to the third
ectoplasmic loop, specifically amino acids 538-554. Erythrocytes carrying polymorphisms in the external loops of band 3
will again be useful for evaluation of the role of band 3 in
erythrocyte cell aging. It is interesting to note that multiple
antibodies to these low prevalence antigens are often found
concomitantly in sera that contain autoreactive erythrocyte
antibodies as well as in sera from individuals who have not
received any prior RBC stimulus.
Finally, in a recent communication, Thevenin et al73 reported
that synthetic peptides derived from the second and third
ectoplasmic regions of band 3 completely inhibited adherence
of sickle cells to an endothelial monolayer in a static assay.
These results again suggested that the third external loop of
band 3 plays a role in the sequence-specific adhesion of
modified RBCs to the vascular endothelium.
The majority of the data on the adhesion of parasitized and
sickled erythrocytes have been obtained from in vitro studies
using antibodies and synthetic peptides. Both these experimental approaches are prone to artifacts. Large antibody molecules
may interfere with numerous interactions upon binding to the
RBC surface. Inhibition of interactions by synthetic peptides is
also frequently nonspecific, and the peptides may mimic other
yet unknown antigens with similar or identical amino acid
sequences. Erythrocytes from donors with substitutions in the
ectoplasmic loops of band 3 represent therefore a valuable
system for testing of the role of this portion of band 3 in
erythrocyte aging, in cytoadherence of malarial parasites, or in
adhesion of parasitized and sickled RBCs to the endothelium.
ACKNOWLEDGMENT
The authors thank the many colleagues who, over many years, sent us
samples of RBCs expressing low incidence antigens. We also thank the
following people who recently responded to requests for blood samples
from selected donors: Ranjan Malde from the National Blood Service
(London and the South East), London, UK; Graham Rowe from the
National Blood Service (Wales), Cardiff, Wales; Judy Martin from the
American Red Cross (Badger Region), Madison, WI; and Marilyn
Moulds from Gamma Biologicals, Inc (Houston, TX). We thank Dr Jiri
Zavadil. Milena Pohlova from the Institute of Hematology and Blood
Transfusion (Prague, Czech Republic) for help with DNA sequencing
and for preparation of the figures.
REFERENCES
1. Lux SE, John KM, Kopito RR, Lodish HF: Cloning and characterization of band 3, the human erythrocyte anion-exchange protein (AE1).
Proc Natl Acad Sci USA 86:9089, 1989
2. Kopito RR, Lodish HF: Structure of the murine anion exchange
protein. J Cell Biochem 29:1, 1985
3. Kopito RR, Lodish HF: Primary structure and transmembrane
orientation of the murine anion exchange protein. Nature 316:234, 1985
4. Tanner MJA, Martin PG, High S: The complete amino acid
sequence of the human erythrocyte membrane anion-transport protein
deduced from the cDNA. Biochem J 256:703, 1988
4841
5. Fukuda M, Fukuda MN: Changes in red cell surface glycoproteins
and carbohydrate structures during the development and differentiation
of human erythroid cells. J Supramol Struct 17:324, 1981
6. Jarolim P, Palek J, Amato D, Hassan K, Sapak P, Nurse GT, Rubin
HL, Zhai S, Sahr KE, Liu SC: Deletion in erythrocyte band 3 gene in
malaria-resistant Southeast Asian ovalocytosis. Proc Natl Acad Sci
USA 88:11022, 1991
7. Schofield AE, Tanner MJA, Pinder JC, Clough B, Bayley PM,
Nash GB, Dluzewski AR, Reardon DM, Cox TM, Wilson RJM, Gratzer
WB: Basis of unique red cell membrane properties in hereditary
ovalocytosis. J Mol Biol 223:949, 1992
8. Jarolim P, Palek J, Rubin HL, Prchal JT, Korsgren C, Cohen CM:
Band 3 Tuscaloosa: Pro327=Arg327 substitution in the cytoplasmic
domain of erythrocyte band 3 protein associated with spherocytic
hemolytic anemia and partial deficiency of protein 4.2. Blood 80:523,
1992
9. Jarolim P, Rubin HL, Liu S-C, Cho MR, Brabec V, Derick LH, Yi
SJ, Saad STO, Alper S, Brugnara C, Golan DE, Palek J: Duplication of
10 nucleotides in the erythroid band 3 (AE1) gene in a kindred with
hereditary spherocytosis and band 3 protein deficiency (band 3PRAGUE).
J Clin Invest 93:121, 1994
10. Jarolim P, Rubin HL, Brabec V, Chrobak L, Zolotarev AS, Alper
SL, Brugnara C, Wichterle H, Palek J: Mutations of conserved arginines
in the membrane domain of erythroid band 3 protein lead to a decrease
in membrane-associated band 3 and to the phenotype of hereditary
spherocytosis. Blood 85:634, 1995
11. Rybicki AC, Qiu JJH, Musto S, Rosen NL, Nagel RL, Schwartz
RS: Human erythrocyte protein 4.2 deficiency associated with hemolytic anemia and a homozygous 40glutamic acid=lysine substitution in
the cytoplasmic domain of band 3 (band 3Montefiore). Blood 81:2155,
1993
12. Bruce LJ, Kay MMB, Lawrence C, Tanner MJA: Band 3 HT, a
human red-cell variant associated with acanthocytosis and increased
anion transport, carries the mutation Pro-868=Leu in the membrane
domain of band 3. Biochem J 293:317, 1993
13. Bruce LJ, Cope DL, Jones GK, Schofield AE, Burley M, Povey
S, Unwin RJ, Wrong O, Tanner MJA: Familial distal renal tubular
acidosis is associated with mutations in the red cell anion exchanger
(band 3, AE1) gene. J Clin Invest 100:1693, 1997
14. Jarolim P, Shayakul C, Prabakaran D, Jiang LW, Stuarttilley A,
Rubin HL, Simova S, Zavadil J, Herrin JT, Brouillette J, Somers MG,
Seemanova E, Brugnara C, Guaywoodford LM, Alper SL: Autosomal
dominant distal renal tubular acidosis is associated in three families
with heterozygosity for the R589H mutation in the AE1 (band 3)
Cl-/HCO3- exchanger. J Biol Chem 273:6380, 1998
15. Yannoukakos D, Vasseur C, Driancourt C, Blouquit Y, Delaunay
J, Wajcman H, Bursaux E: Human erythrocyte band 3 polymorphism
(band 3 Memphis): Characterization of the structural modification
(Lys56=Glu) by protein chemistry methods. Blood 78:1117, 1991
16. Jarolim P, Rubin HL, Zhai S, Sahr KE, Liu SC, Mueller TJ, Palek
J: Band 3 Memphis: A widespread polymorphism with abnormal
electrophoretic mobility of erythrocyte band 3 protein caused by
substitution AAG=GAG (Lys=Glu) in codon 56. Blood 80:1592,
1992
17. Hsu L, Morrison M: A new variant of the anion transport protein
in human erythrocytes. Biochemistry 24:3086, 1985
18. Spring FA, Bruce LJ, Anstee DJ, Tanner MJA: A red cell band 3
variant with altered stilbene disulphonate binding is associated with the
Diego (Dia) blood group antigen. Biochem J 288:713, 1992
19. Thompson PR, Childers DM, Hatcher DE: Anti-Dib. First and
second examples. Vox Sang 13:314, 1967
20. Levine P, Robinson EA, Layrisse M, Arends T, DominguezSisco R: The Diego blood factor. Nature 177:40, 1956
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
4842
21. Bruce LJ, Anstee DJ, Spring FA, Tanner MJA: Band 3 Memphis
variant II. Altered stilbene disulfonate binding and the Diego (Dia)
blood group antigen are associated with the human erythrocyte band 3
mutation Pro854=Leu. J Biol Chem 269:16155, 1994
22. Jarolim P, Rubin HL, Moulds JM: Molecular characterization of
the Diego blood group antigen. Blood 84:237a, 1994 (abstr, suppl 1)
23. Bruce LJ, Ring SM, Anstee DJ, Reid ME, Wilkinson S, Tanner
MJA: Changes in the blood group Wright antigens are associated with a
mutation at amino acid 658 in human erythrocyte band 3: A site of
interaction between band 3 and glycophorin A under certain conditions.
Blood 85:541, 1995
24. Jarolim P, Moulds JM: Molecular characterization of the Wright
blood group antigens. Academy of Clinical Laboratory Physicians and
Scientists, 30th Annual Meeting, Syracuse, NY. Syracuse, NY, SUNY
Health Science Center, 1995, p 33 (abstr)
25. Jarolim P, Murray J, Rubin H, Smart E, Zelinski T, Moulds JM:
The low incidence antigens Wda, Rba, and WARR are located on band 3.
Abstracts of the 24th Congress of the International Society of Blood
Transfusion. Makuhari, Japan, ISBT, 1996, p 73 (abstr)
26. Bruce LJ, Zelinski T, Ridgwell K, Tanner MJA: The lowincidence blood group antigen, Wda, is associated with the substitution
Val557=Met in human erythrocyte band 3 (AE1). Vox Sang 71:118,
1996
27. Contreras M, Stebbing B, Mallory DM, Bare J, Poole J,
Hammond W: The Redelberger antigen Rba. Vox Sang 35:397, 1978
28. Coghlan G, Crow M, Spruell P, Moulds M, Zelinski T: A ‘new’
low-incidence red cell antigen, WARR: Unique to native Americans.
Vox Sang 68:187, 1995
29. Lewis M, Kaita H: A ‘‘new’’ low incidence ‘‘Hutterite’’ blood
group antigen Waldner (Wda). Am J Hum Genet 33:418, 1981
30. Jarolim P, Murray JL, Rubin HL, Smart E, Moulds JM: Wda and
Rba blood group antigens are located in the third ectoplasmic loop of the
erythroid band 3 protein. Blood 86:445a, 1995 (abstr, suppl 1)
31. Jarolim P, Murray JL, Rubin HL, Smart E, Moulds JM: Blood
group antigens Rba, Tra, and Wda are located in the third ectoplasmic
loop of erythrocyte band 3 protein. Transfusion 37:607, 1997
32. Jarolim P, Murray J, Rubin HL, Coghlan G, Zelinski T: A
Thr552=Ile substitution in erythroid band 3 gives rise to the Warrior
blood group antigen. Transfusion 36:49S, 1996 (abstr, suppl)
33. Jarolim P, Murray JL, Rubin HL, Coghlan G, Zelinski T: A
Thr552=Ile substitution in erythroid band 3 gives rise to the Warrior
blood group antigen. Transfusion 37:398, 1997
34. Bruce LJ, Tanner MJA, Zelinski T: The low incidence blood
group antigen, Wda, is associated with the substitution Val557=Met in
human erythrocyte band 3. Transfusion 35:52S, 1995 (abstr, suppl)
35. Bruce LJ, Zelinski T, Ridgwell K, Tanner MJA: The lowincidence blood group antigen, Wd(a), is associated with the substitution Val(557)=Met in human erythrocyte band 3 (AE1). Vox Sang
71:118, 1996
36. Telen MJ, Chasis JA: Relationship of the human erythrocyte Wrb
antigen to an interaction between glycophorin A and band 3. Blood
76:842, 1990
37. Huang CH, Reid ME, Xie SS, Blumenfeld OO: Human red blood
cell Wright antigens: A genetic and evolutionary perspective on
glycophorin A-band 3 interaction. Blood 87:3942, 1996
38. Liotta I, Purpura M, Dawes BJ, Giles CM: Some data on the low
frequency antigens Wra and Bpa. Vox Sang 19:540, 1970
39. Kornstad L, Howell P, Jorgensen J, Heier Larsen AM, Wadsworth LD: The rare blood group antigen, Wu. Vox Sang 31:337, 1976
40. Kornstad L, Brocteur J: A new, rare blood group antigen, Moa
(MOEN), in Transfusion Congress: American Association of Blood
Banks XXV Annual Meeting and International Society of Blood
Transfusion XIII International Congress. Washington, DC, American
Association of Blood Banks, 1972, p 58
JAROLIM ET AL
41. Young S: Vga: A new low incidence red cell antigen. Vox Sang
41:48, 1981
42. Rowe GP, Hammond W: A new low-frequency antigen, Hga
(Hughes). Vox Sang 45:316, 1983
43. Chaves MA, Leak MR, Poole J, Giles CM: A new low-frequency
antigen BOW (Bowyer). Vox Sang 55:241, 1988
44. Coghlan G, Green C, Lubenko A, Tippett P, Zelinski T:
Low-incidence red cell antigen ELO (700.51): Evidence for exclusion
from thirteen blood group systems. Vox Sang 64:240, 1993
45. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T:
Detection of polymorphisms of human DNA by gel electrophoresis as
single-strand conformation polymorphisms. Proc Natl Acad Sci USA
86:2766, 1989
46. Orita M, Suzuki Y, Sekiya T, Hayashi K: Rapid and sensitive
detection of point mutations and DNA polymorphisms using the
polymerase chain reaction. Genomics 5:874, 1989
47. Kudrycki KE, Shull GE: Primary structure of the rat kidney band
3 anion exchange protein deduced from a cDNA. J Biol Chem
264:8185, 1989
48. Kudrycki KE, Newman PR, Shull GE: cDNA cloning and tissue
distribution of mRNAs for two proteins that are related to the band 3
Cl2/HCO23 exchanger. J Biol Chem 265:462, 1990
49. Cox JV, Lazarides E: Alternative primary structures in the
transmembrane domain of the chicken erythroid anionic transporter.
Mol Cell Biol 8:1327, 1988
50. Hubner S, Michel F, Rudloff V, Appelhans H: Amino acid
sequence of band-3 protein from rainbow trout erythrocytes derived
from cDNA. Biochem J 285:17, 1992
51. Gehrig H, Muller W, Appelhans H: Complete nucleotide sequence of band 3 related anion transport protein AE2 from human
kidney. Biochim Biophys Acta 1130:326, 1992
52. Alper SL, Kopito RR, Libresco SM, Lodish HM: Cloning and
characterization of a murine band 3-related cDNA from kidney and
from a lymphoid cell line. J Biol Chem 263:17092, 1988
53. Lindsey AE, Schneider K, Simmons DM, Baron R, Lee BS,
Kopito RR: Functional expression and subcellular localization of an
anion exchanger cloned from choroid plexus. Proc Natl Acad Sci USA
87:5278, 1990
54. Chow A, Dobbins JW, Aronson PS, Igarashi P: cDNA cloning
and localization of a band 3-related protein from ileum. Am J Physiol
263:G345, 1992
55. Yannoukakos D, Stuart-Tilley A, Fernandez HA, Fey P, Duyk G,
Alper SL: Molecular cloning, expression, and chromosomal localization of two isoforms of the AE3 anion exchanger from human heart.
Circ Res 75:603, 1994
56. Kopito RR, Lee BS, Simmons DM, Lindsey AE, Morgans CW,
Schneider K: Regulation of intracellular pH by a neuronal homolog of
the erythrocyte anion exchanger. Cell 59:927, 1989
57. Goosens M, Kan YW: DNA analysis in the diagnosis of
hemoglobin disorders. Methods Enzymol 76:805, 1981
58. Dodge JT, Mitchell C, Hanahan DJ: The preparation and
chemical characteristics of hemoglobin-free ghosts of human erythrocytes. Arch Biochem Biophys 100:119, 1963
59. Daniels GL, Anstee DJ, Cartron JP, Dahr W, Issitt PD, Jorgensen
J, Kornstad L, Levene C, Lomasfrancis C, Lubenko A, Mallory D,
Moulds JJ, Okubo Y, Overbeeke M, Reid ME, Rouger P, Seidl S,
Sistonen P, Wendel S, Woodfield G, Zelinski T: Blood Group Terminology 1995—ISBT Working Party on Terminology for Red Cell Surface
Antigens. Vox Sang 69:265, 1995
60. Daniels G: Human Blood Groups. London, UK, Blackwell
Science, 1995
61. Ford DS, Stern DA, Hawksworth DN, Lubenko A, Pope JM,
Chana HS, Better PJ: Haemolytic disease of the newborn probably due
to anti-ELO, an antibody to a low frequency red cell antigen. Vox Sang
62:169, 1992
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
BLOOD GROUP ANTIGENS ON ERYTHROCYTE BAND 3
62. Better PJ, Ford DS, Frascarelli A, Stern DA: Confirmation of
anti-ELO as a cause of haemolytic disease of the newborn. Vox Sang
65:70, 1993
63. Reid M, Lomas-Francis C: The Blood Group Antigen Factsbook.
San Diego, CA, Academic, 1997, p 12
64. Okoye VCN, Bennett V: Plasmodium falciparum malaria: Band
3 as a possible receptor during invasion of human erythrocytes. Science
227:169, 1985
65. Winograd E, Sherman IW: Naturally occurring anti-band 3
autoantibodies recognize a high molecular weight protein on the surface
of Plasmodium falciparum infected erythrocytes. Biochem Biophys Res
Commun 160:1357, 1989
66. Crandall I, Sherman IW: Cytoadherence-related neoantigens on
Plasmodium falciparum (human malaria)-infected human erythrocytes
result from the exposure of normally cryptic regions of the band 3
protein. Parasitology 108:257, 1994
67. Crandall I, Collins WE, Gysin J, Sherman IW: Synthetic peptides
based on motifs present in human band 3 protein inhibit cytoadherence/
sequestration of the malaria parasite Plasmodium falciparum. Proc Natl
Acad Sci USA 90:4703, 1993
68. Iqbal J, Siddique AB, Ahlborg N, Perlmann P, Berzins K:
Cytoadherence-related homologous motifs in Plasmodium falciparum
4843
antigen Pf155/RESA and erythrocyte band 3 protein. Parasitology
110:503, 1995
69. Crandall I, Guthrie N, Sherman IW: Plasmodium falciparum:
Sera of individuals living in a malaria-endemic region recognize
peptide motifs of the human erythrocyte anion transport protein. Am J
Trop Med Hyg 52:450, 1995
70. Hogh B, Petersen E, Crandall I, Gottschau A, Sherman IW:
Immune response to band 3 neoantigens on Plasmodium falciparuminfected erythrocytes in subjects living in an area of intense malaria
transmission are associated with low parasite density and high hematocrit value. Infect Immun 62:4362, 1994
71. Guthrie N, Crandall IE, Marini S, Fasciglione GF, Sherman IW:
Monoclonal antibodies that react with human band 3 residues 542-555
recognize different conformations of this protein in uninfected and
Plasmodium falciparum infected erythrocytes. Mol Cell Biochem
144:117, 1995
72. Kay MMB: Generation of senescent cell antigen on old cells
initiates IgG binding to a neoantigen. Cell Mol Biol 39:131, 1993
73. Thevenin BJM, Crandall I, Ballas SK, Sherman IW, Shohet SB:
Band 3 peptides block the adherence of sickle cells to endothelial cells
in vitro. Blood 90:4172, 1997
From www.bloodjournal.org by guest on June 15, 2017. For personal use only.
1998 92: 4836-4843
Characterization of Seven Low Incidence Blood Group Antigens Carried by
Erythrocyte Band 3 Protein: Presented in part at the 49th Annual Meeting of
the American Association of Blood Banks, Orlando, FL, October 6-10, 1996.
P. Jarolim, H.L. Rubin, D. Zakova, J. Storry and M.E. Reid
Updated information and services can be found at:
http://www.bloodjournal.org/content/92/12/4836.full.html
Articles on similar topics can be found in the following Blood collections
Red Cells (1159 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.