DNA Fingerprint DNA Fingerprint • technique to identify people based on DNA Gel Electrophoresis • technique to separate fragments by size + sample well gel Tandem Repeats • sequences of DNA that repeat Short Tandem Repeats (STR) - 1,2,3 bases repeat 15-100 times GACGACGACGACGAC Variable Number of Tandem Repeats (VNTR) - 10-40 bases repeat 10’s to 1000’s GACTTACAGCGACTTACAGCGACTTACAGC e.g. DS180 (16 long, 16-40x) Each Individual has 2 Alleles Person A Chromosome 1a GACGACGACGACGAC Chromosome 1b GACGACGAC Person B Chromosome 1a GACGACGACGACGACGAC Chromosome 1b GACGACGACGAC RFLP Analysis Restriction Fragment Length Polymorphism GACGACGACGACGAC CTGCTGCTGCTGCTG GACGACGAC CTGCTGCTG restriction enzyme RFLP Analysis Restriction Fragment Length Polymorphism Southern Blot transfer to nylon sheet to make single stranded Add ProbeDNA complementary to fragment CTGCTG** radioactive Expose with X-ray film PCR • amplify TR region with PCR • stain directly GACGACGACGACGAC CTGCTGCTGCTGCTG GACGACGAC CTGCTGCTG Polymerase Chain Reaction (PCR) • Heat DNA to open • Primers attach and Taq polymerase extends GGTTCCGACCGACCGACCGACCGACCGAGGTT CCAA CCAAGGCTGGCTGGCTGGCTGGCTGGCTCCAA GGCTGGCTGGCTGGCTGGCTGGCTCCAA GGTTCCGACCGACCGACCGACCGACCGAGGTT CCAAGGCTGGCTGGCTGGCTGGCTGGCTCCAA PCR Fingerprint Gel Electrophoresis Stain Ethidium Bromide PCR Fingerprint Gel Electrophoresis Stain Ethidium Bromide Lab 13 • • • • • • • Add loading dye and warm Put in gel wells - 25 microliters Add standard and control if available Run gel for about 1 hour Dry lab - Paternity suit Dry lab - Criminal Case Stain and photograph gel Activity 21 • No class on Weds. or Fri. • Obtain photographs of gels from website • Complete activity 21 for Monday Ideal Results Ladder proteins of known size Molecular Weight Students' PCR products should show one or two bands with lengths be- tween 360 and 800 base pairs. Activity 21 Ladder proteins of known size Molecular Weight Activity 21 Measure Distances for Ladder e.g. 200 - 40 mm 400 - 35 mm (do all!) Activity 21 Ladder proteins of known size 40 35 Molecular Weight Graph Ladder 50 45 Distance Moved (mm) Distance Moved (mm) 40 35 30 25 20 15 10 5 0 0 120 240 360 480 600 720 840 Number of Base Pairs Molecular Weight 1000’s 960 1080 1200 Draw Best Line 50 45 Distance Moved (mm) Distance Moved (mm) 40 35 30 25 20 15 10 5 0 0 120 240 360 480 600 720 840 Number of Base Pairs Molecular Weight 1000’s 960 1080 1200 Measure Sample Lines e.g. 36 mm 25 mm Activity 21 Me 3 Ladder proteins of known size 40 35 36 25 Molecular Weight Determine Base Pairs 50 45 Distance Moved (mm) Distance Moved (mm) 40 35 36 30 25 25 20 15 10 5 0 650 360 0 120 240 360 480 600 720 840 Number of Base Pairs Molecular Weight 1000’s 960 1080 1200 Activity 21 Me 3 Ladder proteins of known size 40 35 36 25 Molecular Weight 360 650
© Copyright 2026 Paperzz