WOX Gene Phylogeny in Poaceae: A Comparative Approach Addressing Leaf
and Embryo Development
Judith Nardmann,* Roman Zimmermann, Diego Durantini,* Erhard Kranz,à and Wolfgang Werr*
*Institut für Entwicklungsbiologie, Universität zu Köln, Köln, Germany; Zentrum für Molekularbiologie für Pflanzen, Universität
Tübingen, Tübingen, Germany; and àEntwicklungsbiologie und Biotechnologie, Universität Hamburg Biozentrum Klein Flottbek
und Botanischer Garten, Hamburg, Germany
The phylogeny based on the homeodomain (HD) amino acid sequence of the WOX (WUSCHEL-related homeobox gene
family) was established in the 3 major radiations of the Poaceae family: Pooideae (Brachypodium distachyon),
Bambusoideae (Oryza sativa), and Panicoideae (Zea mays). The genomes of all 3 grasses contain an ancient duplication
in the WOX3 branch, and the cellular expression patterns in maize and rice indicate subfunctionalization of paralogues
during leaf development, which may relate to the architecture of the grass leaf and the encircling of the stem. The use of
maize WOX gene family members as molecular markers in maize embryo development for the first time allowed us to
visualize cellular decisions in the maize proembryo, including specification of the shoot/root axis at an oblique angle to
the apical–basal polarity of the zygote. All molecular marker data are compatible with the conclusion that the embryonic
shoot/root axis comprises a discrete domain from early proembryo stages onward. Novel cell fates of the shoot and the
root are acquired within this distinct morphogenic axis domain, which elongates and thus separates the shoot apical
meristem and root apical meristem (RAM) anlagen in the maize embryo.
Introduction
Angiosperms, flowering plants, are the largest group of
embryophytes with at least 260,000 living species.
They consist of 2 classes—the monocotyledons and the
dicotyledons—which diverged over 150 MYA (Wikstrom
and Kenrick 2001). Despite their striking diversity, angiosperms share several synapomorphies (Doyle and
Donoghue 1986). For example, sexual reproduction is characterized by a double fertilization event where one sperm cell
fuses with the egg cell that will develop into the embryo and
the second fuses with the binucleate central cell to give rise to
the endosperm. Whereas endosperm development starts with
a syncitial phase, the zygote follows a defined cell division
program (Johansen 1950; Wardlaw 1955). The first division
of the zygote is asymmetric and always perpendicular to the
micropylar/chalazal axis of the embryo sack in all plants
and results in a small apical cell and a larger basal cell.
The plant embryo develops from the small apical cell, and
although cell divisions are mostly unpredictable, the resulting embryos fall into 5 categories (Johansen 1950). Early
embryonic cell divisions in the model dicot plant Arabidopsis thaliana are exceptionally stereotypic and create a crucifer type of embryo (Wardlaw 1955), in which the basal cell
does hardly contribute to embryo development. The 16-cell
Arabidopsis embryo shares only a single cell contact with the
subtending suspensor, the so-called hypophysis (Jurgens
1992; Berleth and Chatfield 2002). Its horizontal cell division gives rise to a quiescent center (QC) precursor cell and
a subtending columella root cap initial (Scheres et al. 2002).
In contrast, the shoot apical meristem (SAM) is established at an apical position of the ‘‘embryo proper’’ (Long
and Barton 1998); the activation of the WUSCHEL gene at
the 16-cell stage provides a first molecular marker (Mayer
et al. 1998). Shortly thereafter, the radial symmetry of the
globular embryo is broken by the specification of 2 cotyleKey words: WOX gene family, Poaceae, embryo patterning, leaf
development.
E-mail: [email protected].
Mol. Biol. Evol. 24(11):2474–2484. 2007
doi:10.1093/molbev/msm182
Advance Access publication September 3, 2007
Ó The Author 2007. Published by Oxford University Press on behalf of
the Society for Molecular Biology and Evolution. All rights reserved.
For permissions, please e-mail: [email protected]
dons. In the mature embryo of nearly all dicots except some
Umbellifera and Ranunculus ficaria, the shoot apex is
found between the bases of the cotyledons (Johansen
1950). Characteristics for the dicot embryo are thus 2 planes
of bilateral symmetry, one through the cotyledon midribs
and the second perpendicular, medial of the SAM. In contrast, monocot embryos have a single plane of bilateral
symmetry as the SAM resides at a lateral position of the
scutellum, considered the single (mono) cotyledon.
Monocots represent approximately 22% of all angiosperm species, and one of the largest monocot families, the
Poaceae, comprises 17% of all 52,000 monocot species and
contains all major cereal crops (Soltis PS and Soltis DE
2004). The Poaceae family is subdivided into 3 major
radiations each containing species regarded as model systems for functional genomics: Pooideae, Bambusoideae,
and Panicoideae.
Zea mays, a member of the Panicoideae family, is
a monocot species where histological and genetic analyses
as well as accumulating genome information are available
today thus allowing the detailed study of embryonic patterning. The basis was laid early in the 20th century by a detailed histological description and staging of maize embryo
development (Randolph 1936; Abbe et al. 1951), which at
its end has elaborated a miniature plantlet with 5–6 true foliage leaves. Genetically, maize embryogenesis was revisited by the description of 51 embryo-specific mutations,
which only affect patterning of the embryo, whereas endosperm development is normal (Clark and Sheridan 1991).
One of these mutants (emb8516) has been cloned and encodes a plastid ribosomal protein (Magnard et al. 2004).
Marker-assisted analyses of other mutants revealed that
the acquisition of dorso/ventral polarity is a crucial transition
prior to the activation of SAM markers (Elster et al. 2000).
Mutants and resulting molecular markers associated
with the acquisition of cell fates in the shoot and root meristems have proven most informative in understanding the
patterning of the Arabidopsis embryo. The KNOTTED1
(KN1) gene in maize, which is considered to be the orthologue to SHOOT MERISTEMLESS (STM) in Arabidopsis
(Kerstetter et al. 1997), starts to be transcribed at a lateral
position (adaxial relative to the axis of the ear inflorescence)
WOX Genes in Maize Embryonic Patterning 2475
Table 1
Primer Pairs to Amplify WOX HD of Brachypodium distachyon (Bd)
Degenerate Forward Primer (5#–3’)
TGGACICCIACIACIGARCARAT
TGGAAYCCIAARCCIGARCARAT
TGGTGYCCIACICCIGARCA
GGIACIACICGITGGAAYCC
TGGAAYCCIACIGTIGARCA
CCIAARCCICGITGGAAYCC
TGGACICCIACIACIGARCARAT
TGGACICCIACIACIGARCARAT
ACICCIATGCARCTICARAT
Degenerate Reverse Primer (5#–3’)
Resulting HD
GCYTTRTGRTTYTGRAACCARTARAA
GCYTTRTGRTTYTGRAACCARTARAA
TTRTGRTTYTGRAACCARTARAA
TTYTGRAACCARTARAAIACRTT
GCYTTRTGRTTYTGRAACCARTARAA
TTYTGRAACCARTARAAIACRTT
GCYTTRTGRTTYTGRAACCARTARAA
GCYTTRTGRTTYTGRAACCARTARAA
TGRAACCARTTRTAIACRTT
BdWUS
BdWOX2
BdNS, BdWOX3
BdWOX4
BdWOX5
BdWOX9
BdWOX11/12A
BdWOX11/12B
BdWOX13
during the transition stage of the maize embryo (Smith et al.
1995). The activation of KN1 when the maize embryo consists of several hundred cells is rather late compared with
that of STM in Arabidopsis, which is activated at the 32-cell
stage (Long and Barton 1998). Although later in development the gene expression patterns appear to be conserved,
there is no prepatterning of the prospective SAM domain in
the maize embryo. A root endodermis marker is provided
by ZmSCR, the maize orthologue of SCARECROW in Arabidopsis in the coleoptilar stage embryo (Lim et al. 2005).
The SAM and RAM transcriptional markers show perception of adaxial and central positional information for establishment of the shoot/root axis in the maize embryo.
In Arabidopsis, members of the WUSCHEL homeobox
(WOX) gene family comprise earliest cell fate markers from
the first zygotic divisions on Haecker et al. (2004). Most
members of the maize WOX gene family have been identified
in the course of the phylogenetic identification of WUS orthologues from rice and maize (Nardmann and Werr 2006).
Their analysis has revealed major adaptations in WUS expression patterns in both grass species relative to the Arabidopsis model and more importantly suggest significant
freedom for the specification of the shoot stem cell niche during angiosperm evolution. However, the WOX gene phylogeny also revealed that this gene family existed prior to the
separation of monocot and dicot species. Based on pioneering work in Arabidopsis, members of the WOX gene family,
therefore, were attractive candidates to be tested as molecular
markers of embryonic patterning in maize. Here we describe
the transcription patterns of patterning WOX gene family
members in the maize embryo. They uncover a significant
degree of pattern conservation between maize and Arabidopsis
embryos and reveal that the shoot/root axis in maize comprises a rather discrete domain from the proembryo stage
on, which is distinct from that of the prospective scutellum.
Materials and Methods
WOX Family Members from Brachypodium distachyon
and Computational or Database Analysis
Homeobox-encoding amplicons of the Brachypodium
distachyon WOX family members were obtained in polymerase chain reactions (PCRs) on genomic DNA with
primers listed in table 1. Analysis of DNA and protein sequences was performed using the Wisconsin GCG software
package version 7.0 (University of Wisconsin Genetics
Computer Group). Homology searches used TBlastN at
http://www.ncbi.nlm.nih.gov/blast/, http://www.ddbj.nig.ac.jp,
or http://www.gov/blast.org with default parameters. Multiple sequence alignment was achieved using ClustalW
(http://www.ebi.ac.uk/clustalw). PHYLIP (http://www.
evolution.genetics.washington.edu/phylip.html) was used
for phylogenetic and molecular evolutionary analyses
based on the maximum likelihood method. MEGA version
3.1 (Kumar et al. 2001) was used for phylogenetic and
molecular evolutionary analyses based on the NeighborJoining (NJ) and maximal parsimony (MP) methods.
Sequences selected for the phylogenetic tree in figure 1
are as follows (accession numbers in parentheses): ZmNS1
(AJ536578), ZmNS2 (AJ472083), and OsWOX5 (Q8WOF1);
AtWOX1—AtWOX14 as published recently (Haecker et al.
2004); and all other accession numbers are listed in table 2.
In Situ Hybridization
Nonradioactive in situ hybridization followed the protocol of Jackson (1991). For fixation, maize kernels were
trimmed on both sides of the embryo axis; nucellar explants
for early embryos were obtained 45–48 h after pollination.
Paraffin-embedded tissue was sectioned by the use of the
Leica RM 2145 rotary microtome (7 lm). Probes for in situ
hybridization comprising sequences downstream of the
homeobox (table 3) were cloned in sense or antisense orientation to the T7 promoter, and digoxigenin-labeled RNA
probes were obtained as described by Bradley et al. (1993).
The KN1 probe corresponded to accession AY312169
(Vollbrecht et al. 1991).
Reverse Transcriptase–Polymerase
Chain Reaction Analysis
For expression analysis of ZmWOX2A and
ZmWOX9A-C, the lMACS One-step cDNA Kit was used
for isolation of total RNA from egg cells and zygotes and
for subsequent cDNA synthesis according to the manufacturer’s protocol (Miltenyi, Bergisch Gladbach, Germany).
Total RNA of later embryonic stages was isolated using
the RNeasy plant mini kit according to the manufacturer’s
protocol (Qiagen, Hilden, Germany). Two micrograms of
DNAse I–treated RNA was used as a template for the
first-strand cDNA synthesis with SuperScript III Reverse
Transcriptase (Invitrogen, Carlsbad, CA). Subsequent PCRs
were performed using standard procedures with 35 or
40 cycles of amplification. ZmWOX2A primers fw (5#CCGCTGCCCGTGCTCTCCATG) and rev (5#-GATCGGCACAGGCTTCTTCCAG) (Tm 5 59 °C, 40 cycles);
2476 Nardmann et al.
FIG. 1.—Phylogeny of the WOX gene family in 3 grasses compared with dicots. Abbreviations are Arabidopsis thaliana (At), Populus trichocarpa
(Pt), Brachypodium distachyon (Bd), Oryza sativa (Os), and Zea mays (Zm). ROA (ROSULATA) and TER (TERMINATOR) are WUS orthologues
from Antirrhinum majus or Petunia hybrida, respectively. The complete dendrogram (right) was obtained by the maximum likelihood method; the blow
ups of the WOX3 and WOX8/9 branches are based on the NJ method, which results in a different branching pattern in the PRS/NS group and in the
positions of Arabidopsis WOX8 or WOX9 members. Bootstrap values are indicated at each branching.
WOX Genes in Maize Embryonic Patterning 2477
Table 2
Accession Numbers of WOX HDs
Name of HD
ZmWOX2A
ZmWOX2B
ZmWOX3A
ZmWOX3B
ZmWOX4
ZmWOX5A
ZmWOX5B
ZmWOX9A
ZmWOX9B
ZmWOX9C
ZmWOX11/12A
ZmWOX11/12B
ZmWOX13A
ZmWOX13B
OsNS
OsWOX2
OsWOX3
OsWOX4
OsWOX9
OsWOX9C
OsWOX11/12
OsWOX13
Table 3
Probes for In Situ Hybridizations
Accession No.
Name of HD
Accession No.
AM234767
AM234778
AM490236
AM491777
AM234768
AM234769
AM234770
AM234771
AM234772
AM234773
AM234774
AM234775
AM234776
AM234777
AM234748
AM234749
AM490244
AM234750
AM234752
AM234753
AM234754
AM234755
PtWOX1A
PtWOX1B
PtWOX2
PtWOX4
PtWOX5/7A
PtWOX5/7B
PtWOX6
PtWOX9
PtWOX11/12A
PtWOX11/12B
PtWOX13
BdNS
BdWUS
BdWOX2
BdWOX3
BdWOX4
BdWOX5
BdWOX9
BdWOX11/12A
BdWOX11/12B
BdWOX13
AM234756
AM234757
AM234758
AM234759
AM234765
AM234766
AM234760
AM234761
AM234763
AM234764
AM234762
AM490245
AM490252
AM490246
AM490247
AM490248
AM490249
AM490250
AM490233
AM490234
AM490251
ZmWOX9A fw (5#GATCACCATCAGCACCACAAGC)
and rev (5#-AATCGGCACACAACACCTACG) (Tm 5
59 °C, 35 cycles); ZmWOX9B fw (5#-CGGCAAGAACAACAACACC) and rev (5#-GCCAGCTGATACCCTAAACC) (Tm 5 59 °C, 35 cycles); ZmWOX9C fw (5#GTGACGCCTCCCAGGAACC) and rev (5#-CCCCAGCCTGGACTTCTCG) (Tm 5 57 °C, 35 cycles). Reverse
transcriptase–polymerase chain reaction (RT–PCR) on the
GAPDH cDNA transcript with primers GAPDH fw (5#CATTCCTAGCAGCACCGGTG) and rev (5#-CAAGCAGCAACCATCCATGAG) served as a control.
Egg Cell and Zygote Isolation
All plant materials were isolated from line A 188. Unfertilized egg cells were isolated and selected as described
in Kranz (1999). In vivo fertilized egg cells were isolated as
described in Okamoto et al. (2005). It was estimated that
fertilization occurred 17–20 h before zygote isolation. After
washing in mannitol solution (0.650 osmolar), cells were
transferred into tubes, snap frozen in liquid nitrogen, and
stored at 80 °C until use.
Light Microscopy and Image Processing
Images were taken using an Axioskop microscope equipped with an Axiocam camera (Zeiss, Oberkochen, Germany).
Pictures were processed using Adobe Photoshop version 7.0.
Name of the
WOX Gene
Probe Size Relative
to Open Reading
Frames
ZmWOX2A
ZmWOX3A
ZmWOX4
ZmWOX5A
ZmWOX5B
ZmWOX9A
ZmWOX9B
ZmWOX9C
OsNS
OsWOX3
352–975
190–777
414–847
528–1023
257–767
967–1639
1154–1873
1014–1758
251–702
270–852
Gene
Accession No.
AM490235
AM490236
AM490237
AM490238
AM490239
AM490240
AM490241
AM490242
AM490243
AM490244
ulus trichocarpa, and O. sativa members were obtained
from the established genome sequences. The isolation of
maize WOX gene family members was described recently
(Nardmann and Werr 2006). WOX gene sequences of
B. distachyon were newly isolated by PCR approach with
degenerate primers targeting conserved polypeptide sequences in WUS or WOX HDs. The informative HD sequences are 41 amino acid long in WOX proteins or 42
amino acid in WUS orthologues due to an extra Y residue.
The phylogenetic tree (fig. 1A) was calculated by the maximum likelihood method (http://www.evolution.genetics.
washington.edu/phylip.html), although branches in the
WOX3 and WOX8/9 subgroup are more consistently resolved by the NJ or MP methods (Kumar et al. 2001).
The duplication of the maize genome is evident as 2 maize
paralogues are often accompanied by only a single rice or
Brachypodium orthologue in individual subbranches
(WUS, WOX2, WOX5, or WOX13).
The situation is different in the WOX3 branch; PRS in
Arabidopsis and the ZmNS1/ZmNS2 paralogues represent
homologous functions single orthologous genes exist in
rice (OsNS) and in Brachypodium (BdNS). However, in
contrast to Arabidopsis, the grass genomes contain further
members, which root outside of the PRS/NS branch. This
duplication existed prior to the allotetraploidization of the
maize genome because 2 maize paralogues (ZmWOX3A/B)
relate to a single rice (OsWOX3) or Brachypodium (BdWOX3)
orthologue. Significant divergence also exists in the WOX8/9
branch; no close AtWOX8 relative exists in Populus or grasses,
but all genomes contain AtWOX9 orthologues. Close relatives
to AtWOX1 or AtWOX6 are absent in grasses, whereas orthologues are found in Populus. However, the Populus and the
grass genomes lack orthologues to AtWOX10/AtWOX14,
which indicates a branch unique to the Arabidopsis lineage.
In contrast, AtWOX5/AtWOX7 or AtWOX11/AtWOX12 are
close relatives in Arabidopsis but root with orthologues in
Populus or grasses and therefore may occupy ancient branches
in the WOX gene family.
Results
Phylogeny of WOX HDs
The WOX phylogenetic tree based on the homeodomain (HD) amino acid sequence (fig. 1) contains members
of the 3 major radiations of the Poaceae family: Pooideae
(B. distachyon; Bd), Bambusoideae (Oryza sativa; Os), and
Panicoideae (Zea mays; Zm). Arabidopsis thaliana, Pop-
ZmWOX2A Expression Prepatterns the SAM Position
and Shifts from an Apical to a Lateral Position in the
Embryo Proper
In Arabidopsis, AtWOX2 provides a molecular marker
for the apical domain of the globular embryo, which gives
2478 Nardmann et al.
FIG. 2.—Expression pattern of the ZmWOX2A paralogue. RNA in situ hybridization experiments performed with the ZmWOX2A probe in embryos
of different stages: (A) 45–48 h after fertilization, (B) proembryo 4 dap, (C) 5 dap proembryo, (D) 8 dap early transition stage, and (E) ZmWOX2A
expression in the L1 layer of the crown of the SAM in a leaf stage 2 embryo; the depicted area is schematically indicated by the frame in the schematic
drawing to the right.
rise to the SAM (Haecker et al. 2004). Gene expression becomes restricted to the apical cell of the 2-cell stage embryo
and is later confined to the upper cell tier in the 8-cell embryo. RNA in situ hybridization experiments on the maize
embryo revealed that ZmWOX2A is transcribed in the apical
domain of the early embryo proper (45–48 h after fertilization to 4 days after pollination (dap); fig. 2A and B). Slightly
later, ZmWOX2A expression becomes confined to a few
cells at a lateral position of the proembryo facing toward
the axis of the ear (fig. 2C). At the late proembryo/early
transition stage, the expression domain shifts more to the
base of the embryo and transcripts become restricted to
the L1 layer (fig. 2D). Transcriptional activity ceases thereafter, which coincides with the activation of KN1 transcription in a lateral domain of the transition stage embryo
(Smith et al. 1995). ZmWOX2A transcripts are again detected when the SAM has been established in leaf stage
embryos. Transcripts accumulate in the outer cell layers
of the SAM predominantly lateral to the apical tip (fig. 2E).
Such hybridization signals are only observed in a subfraction of series of tissue sections, indicating that ZmWOX2A
transcriptional activity is transient, possibly relating to the
initiation of new leaf primordia. In analogy to Arabidopsis,
we also tested for transcription of ZmWOX2A in the egg
cell and the zygote by performing RT–PCR experiments.
ZmWOX2A transcripts were found in the zygote, but in
contrast to AtWOX2 expression in Arabidopsis (Haecker
et al. 2004), transcripts were not detected in the unfertilized
egg cell (data not shown), therefore, ZmWOX2A expression
is zygotic.
Expression Patterns of ZmWOX5 Paralogues and
Root Development
The maize genome contains 2 WOX5 paralogues,
ZmWOX5A and ZmWOX5B. Based on the transcriptional
activity in the root QC, an orthologue to AtWOX5 is encoded by the ZmWOX5B gene (fig. 3A–C). Expression is
first detected in a central domain of the embryo proper
above the uppermost tier of vacuolized suspensor cells at
the proembryo stage, when ZmWOX2A is already expressed
in a lateral adaxial domain (fig. 3A). During later stages of
embryo development, ZmWOX5B is transcribed in cells
of the QC. However, in contrast to ZmSCR, which is
transcribed in the endodermis and in a single row of
cells through the maize root QC (Lim et al. 2005),
the ZmWOX5B expression domain initially extends into
the tissue above (fig. 3C). The position of this ZmWOX5B
domain in the coleoptilar stage embryo is striking relative to
the expression pattern of KN1. Side-by-side RNA in situ
hybridizations show that the ZmWOX5B domain is located
internally to an inverted cup-shaped KN1 expression domain (fig. 3C and D). This KN1/ZmWOX5B expression
domain comprises the entire shoot/root axis of the maize
embryo from the L2 layer of the SAM towards the root
QC. Later in the elaborated root of the maturing embryo
or the vegetative seedling, ZmWOX5B transcripts mark
not only a single row of cells in the root QC but also
the base of provascular bundles specified immediately
above the QC (fig. 3B). ZmWOX5B in maize is expressed
outside the root QC in the cambial cells of the basal vascular
system, differently to AtWOX5 in Arabidopsis and QHB in
rice (Kamiya et al. 2003; Haecker et al. 2004).
The ZmWOX5A paralogue has acquired a completely
different expression pattern and is not detected in the embryo prior to early leaf stage 1. Expression starts in the suspensor region in 4–6 cell layers below the root QC (fig. 3E),
the intervening cells express the coleorhiza/calyptrogen
marker ZmNAC5 (Zimmermann and Werr 2005). Although
the coleorhiza delaminates from the primary embryonic
root laterally, it remains connected to the subtending embryonic suspensor at its basal end. The ZmWOX5A gene
is transcribed in cells subtending the central coleorhiza domain, which forms a continuous cell array with the root (fig.
3F). Concerning the function of these cells in the suspensor,
the transcriptional activity of ZmWOX5A in the early endosperm may provide a hint. Prior to the expression in the
embryo, high levels of ZmWOX5A transcripts are transiently detected in the endosperm shortly after cellularization of the basal transfer layer (fig. 3G). This specialized
endosperm domain is essential for nutrient supply from
WOX Genes in Maize Embryonic Patterning 2479
the embryonic plantlet. In the seedling, ZmWOX5A expression is detectable in the rhizodermis, which is involved in
uptake of ions and water from the rhizosphere into the root
(fig. 3H).
ZmWOX4 Expression Marks Provascular
Cells of the Hypocotyl
Similar to ZmWOX5A in the embryo, ZmWOX4 expression is first detectable during leaf stage 1. Transcription
is confined to the morphogenetic axis in the maize embryo
and starts in a broad domain between the SAM and RAM
(fig. 4A). During later leaf stages, transcripts are restricted
to the vascular system, marking vascular strands at the
height and above the scutellar node (fig. 4B). No expression
was detected in the emerging vascular system at the base of
the root, which is marked by ZmWOX5B expression or in
the prominent vascular strand connecting the embryonic
axis with the scutellum. ZmWOX4, therefore, provides
a marker specific for the vascular system of the hypocotyl.
As the expression pattern of the Arabidopsis orthologue AtWOX4 has not been reported previously, we analyzed its transcriptional activity in the dicot embryo. The
resulting expression pattern is similar to that described
for AtWOX1, although both HDs, AtWOX4 and AtWOX1,
group into distant subbranches of the WOX phylogenetic
tree (fig. 1). AtWOX4 activity is detected at the apical tip
of the cotyledons in heart stage Arabidopsis embryos
(fig. 4C) for a short interval and ceases thereafter. The AtWOX4 and ZmWOX4 expression patterns exhibit no obvious similarities but ZmWOX4 marks provascular strands in
the prospective hypocotyl domain of the shoot root axis.
The WOX3 Branch and Grass Leaf Development
FIG. 3.—Transcription of the ZmWOX5A and B paralogues.
ZmWOX5B expression starts in the center of the embryo proper of the
6 dap proembryo (A) and focuses later to the root QC and basal
provascular strands in the coleoptilar stage embryo (B). (C1/C2 and D1/
D2) Comprise adjacent longitudinal or transverse sections through late
coleoptilar stage embryos which were hybridized with the ZmWOX5B (C1/
D1) and KN1 (C2/D2) probes. The coleoptile (co) is marked in the median
longitudinal sections (C1 and C2); the arrow in C1 indicates the plane of
the transverse sections compared in D1 and D2. Note the mutually
exclusive expression patterns of ZmWOX5B and KN1 in the longitudinal
and transverse sections. (E and F) ZmWOX5A transcription in the
suspensor of leaf stage 1 or leaf stage 4 embryos. Both expression domains
are located 4–6 cell layers below the root QC (asterisk). (G) ZmWOX5A
expression in the basal transfer layer of the 9 dap endosperm, and (H)
ZmWOX5A expression in the rhizodermis. Frames in the schematic
representations (E–G) indicate the depicted area of the photographs.
maternal into the filial tissue, that is, endosperm and embryo (Hueros et al. 1995). By analogy, ZmWOX5A transcriptional activity in the suspensor could indicate a cell
type specialized for acropetal transport through the root into
All 3 grass genomes contain WOX3 relatives, which
root outside of the PRS/NS branch (Matsumoto and Okada
2001; Nardmann et al. 2004; Nardmann and Werr 2006).
Expression analyses here focus on the newly identified
branch members. Gene-specific RT–PCR experiments
revealed that both maize paralogues, ZmWOX3A and
ZmWOX3B, are transcribed. However, the sequence similarity between both maize paralogues is so high that we
used a cross-hybridizing ZmWOX3A probe to establish
the cellular expression pattern. ZmWOX3A/B transcripts
are first detected in the anlage of the coleoptile where
the marginal cell file is marked (fig. 5A). This
ZmWOX3A/B expression pattern is reminiscent of that of
ZmNS1 expression (Nardmann et al. 2004) and may explain
why ns1/ns2 double mutants exhibit no phenotype in the
coleoptile other than in leaves and leaf-like floral organs.
During later stages of embryogenesis and during the
vegetative phase, ZmWOX3A/B expression is detected in
the margins of developing true foliage leaves, another aspect shared with ZmNS1/NS2 (fig. 5B). However, significant differences exist between the expression patterns of
both gene pairs in the SAM. ZmWOX3A/B transcription
marks a ring-shaped expression domain of cells recruited
for the P0/P1 leaf primordium (fig. 5B–D). In addition,
ZmWOX3A/B are transcribed at the base of developing
2480 Nardmann et al.
FIG. 4.—ZmWOX4 and AtWOX4 expression patterns. (A) Median longitudinal section showing the onset of ZmWOX4 transcription in the
hypocotyl region of a leaf stage 1 embryo. (B) In leaf stage 4 embryos, ZmWOX4 transcripts are restricted to the vascular system. (C) Expression of the
Arabidopsis orthologue AtWOX4 is confined to the cotyledons of heart stage embryos; the maize and Arabidopsis patterns show hardly any similarity.
phytomers opposite to the midrib where the axillary meristem resides and intermingling leaf margins are attached to
the node (compare side-by-side sections in fig. 5E and F).
Similar expression patterns were obtained with the rice orthologues in young Oryza seedlings. Whereas OsNS is confined to lateral leaf margins (fig. 5H), the single OsWOX3
orthologue is expressed in the SAM at the base of young
phytomers (fig. 5G). The discrepancy to the published
OsNS patterns in rice (Dai et al. 2007) may reside in cross
hybridization between the 2 rice WOX3 paralogues. Consistently, in maize and rice the grass-specific branching of the
WOX3 lineage correlates with differences in expression patterns thus indicating subfunctionalization.
ZmWOX9A/B/C
In Arabidopsis, AtWOX9 is activated after fertilization
and together with AtWOX8 marks the large basal suspensor
cell but is absent in the small apical embryo proper cell
(Haecker et al. 2004). Cellular expression patterns of the
3 ZmWOX9 paralogues are detectable only during late
embryonic stages. At leaf stage 1, ZmWOX9A–C are transcribed in the suspensor region with ZmWOX9B expression
throughout the suspensor (fig. 6A) and a ZmWOX9C preference for outer cell layers (fig. 6C). The expression pattern
of ZmWOX9A is similar to that of ZmWOX9B (data not
shown). At leaf stage 4, these outer/inner expression pattern
differences persist underneath the coleorhiza subtending the
root QC (fig. 6B–D). All 3 ZmWOX9 genes are already transcribed during early embryonic stages as analyzed by RT–
PCR experiments (fig. 6E). Transcripts were detected 3, 5,
and 7 dap although corresponding RNA in situ hybridization experiments revealed no reliable pattern information
earlier than leaf stage 1.
In Arabidopsis, AtWOX9/STIMPY acts partially redundantly to WUS (Wu et al. 2005). It was therefore notable to
see that ZmWOX9B is transcribed not only in the suspensor
but also in the SAM. At late coleoptilar stage, ZmWOX9B
transcripts are found in a few cells at a lateral position of the
protruding SAM proximal to the coleoptile (fig. 6F). Therefore, like members of the WOX3 branch, the 2 maize WUS
paralogues and presumably ZmWOX2A, one maize member
of the WOX9 branch, may contribute to SAM function.
Discussion
The WOX Gene Family Is Ancient in the
Angiosperm Lineage
The grass part of the WOX phylogenetic tree (fig. 1)
contains members of the 3 major radiations of the Poaceae
family: Pooideae (B. distachyon), Bambusoideae (O. sativa), and Panicoideae (Z. mays). The tree is therefore representative for true grasses or Gramineae, which comprise
600 genera and between 9,000 and 10,000 species. Regarding dicots, the tree contains WOX family members from A.
thaliana and P. trichocarpa and because both genomes
have been sequenced should provide the whole WOX gene
complement for 2 eudicot species, as is the case of WOX
family members in rice.
The phylogeny reveals significant differences between
the 3 grass and the 2 eudicot species. There is no evidence
that grass genomes contain orthologues of WOX1, 6, 7, 8,
10, and 14. In contrast, orthologues of WOX1, 6, and 7 are
found in the genome of P. trichocarpa. Populus and Arabidopsis both belong to the core eudicots but are members
of the Salicaceae and Brassicaceae group, respectively, and
fall into eurosids I and II. The WOX1, 6, or 7 orthologues in
both species possibly indicate a common ancestry, consistent with the assumption that rosids comprise a monophyletic group (Jansen et al. 2006). As eurosids I and II are the
major radiations among rosids, the differences concerning
WOX10 and 14 family members may relate to the depth of
branching between both clades but this would need substantiation from other clade members. In contrast, the
homogeneity among grasses implies few changes between
Pooideae, Bambusoideae, and Panicoideae. This is consistent with estimations that Poales represent a rather young
monophyletic group dating back to the late Cretaceous
(.65 Myr; Bremer 2002), whereas the first undisputed evidence of angiosperms appears in the fossil record of the
early Cretaceous period with a rapid diversification in
the mid-Cretaceous (approximately 100 MYA).
Despite a possible loss of individual WOX family
members, all 3 grass genomes contain an interesting duplication in the WOX3 subbranch. The rice and Brachypodium
genomes both contain 2 WOX3 members, whereas the
maize genome encodes 2 pairs of paralogues. The duplication in the WOX3 branch, therefore, existed prior to the
WOX Genes in Maize Embryonic Patterning 2481
FIG. 6.—Transcription of 3 ZmWOX9 paralogues. Longitudinal
sections through leaf stage 1 embryos (A–C) and the suspensor region of
leaf stage 4/5 embryos (B–D) either probed with ZmWOX9B (A, B) or
ZmWOX9C (C, D). Asterisks mark the root QC. (E) RT–PCR
experiments showing expression of all 3 ZmWOX9 orthologues from
early proembryo stage (3 dap) onward. (F) Only ZmWOX9B transcripts
are detectable outside the suspensor in a few cells at the flank of the SAM.
WOX3 paralogues do not find an obvious counterpart in
eudicots.
FIG. 5.—Expression of grass-specific WOX3/PRS paralogues in the
maize coleoptile and during leaf development of maize and rice. (A) Late
coleoptilar stage maize embryo showing ZmWOX3A/B transcripts in the
margins. (B) Median longitudinal section through the early seedling SAM
showing 2 spots of ZmWOX3A/B transcription at both flanks of the SAM
at the height of the next leaf primordium. (C and D) Consecutive
transverse sections through the seedling SAM, showing a ring of
ZmWOX3A/B activity in the P1 primordium (compare to B); the P1 midrib
is located to the right. (E and F) Consecutive transverse sections through
the seedling SAM at the height of P2 hybridized either with ZmWOX3A
(E) or ZmNS1 probes (F). Note the presence of ZmWOX3A but absence of
ZmNS1 transcripts in the shoot apex at the flank opposing the P1 midrib,
where lateral leaf margins will merge and the axillary meristem will be
initiated. (G and H) Transverse sections through the rice seedling SAM
(P1 height) hybridized with the single OsWOX3 orthologue (G) or the
OsNS orthologue (H). Compare expression in the rice shoot apex or the
leaf margins to ZmWOX3A or NS1 in maize depicted in (E and F).
duplication of the maize genome. For maize and rice, it has
been shown that NS orthologues and additional WOX3
relatives both relate to leaf development but are expressed
in different domains. These expression patterns provide
evidence that the WOX3 duplication could be preserved
by subfunctionalization (Lynch and Force 2000), possibly
relating to the peculiar architecture of the grass leaf,
with a basal sheath enclosing the stem. Suggestively,
PRS and ZmNS1/2, OsNS, and BdNS group in a unique
branch of the phylogenetic tree, whereas the grass-specific
Early Embryonic Patterning in Maize
The isolation of maize WOX genes was performed to
raise molecular markers for patterning of the grass embryo.
The RNA in situ hybridization analyses presented here
show that WOX family members provide such markers
on the transcriptional level and allow the comparison to cellular decisions in the Arabidopsis embryo (fig. 7). ZmWOX
transcriptional gene activity was absent in the egg cell but
starts in the zygote with ZmWOX2A. From the few-celled
stage onward, transcripts are exclusively detected in the apical embryo proper domain. This expression domain is
maintained throughout most of the proembryo stage before
the transcriptional activity becomes confined to the adaxial
face of the embryo proper, where the SAM will later
emerge. Ultimately, at the late proembryo/early transition
stage, ZmWOX2A transcription is restricted to the L1 layer
at the adaxial side of the embryo. In relation to Arabidopsis,
it is striking that both ZmWOX2A and AtWOX2 are active in
the zygote, mark the apical cell fate and prepattern the position of the SAM (fig. 7). This similarity of expression patterns makes it tempting to consider that ZmWOX2A and
AtWOX2 represent orthologous gene functions. However,
this conclusion implies that WOX2 provides an ancient angiosperm function associated with the embryo proper cell
2482 Nardmann et al.
FIG. 7.—Schematic representation of WOX gene expression patterns during monocot and dicot embryo development. Comparison of pattern
formation during maize (top) and Arabidopsis (bottom) embryogenesis. Each color represents an individual or mixed WOX expression domain. To be
complete, the schematic drawing includes previously published patterns of KN1, ZmNS1, and ZmWUS1 patterns (Smith et al. 1995; Nardmann et al.
2004; Nardmann and Werr 2006) in addition to the patterns elaborated in the course of this study. The Arabidopsis WOX gene transcription patterns,
except that of WOX4, are based on the original publication by Haecker et al. (2004).
fate and SAM anlage prior to the separation of monocots
and dicots. The confinement of transcription from an early
pattern throughout the embryo proper to the adaxial face
might be interpreted that dorso/ventral polarity does not exist in the early proembryo but is established later.
The second marker, which is informative in a temporal
and spatial pattern, is ZmWOX5B; it is activated in central
cells at the base of the embryo proper in the 6 dap proembryo. The expression pattern is dynamic during subsequent
stages of embryo development. However, restriction of expression to the root QC implies that ZmWOX5B expression
marks the anlage of the root meristem. ZmWOX5B expression appears later than that of ZmWOX2A, and this activation coincides with the start of the restriction of the
ZmWOX2A transcription domain to the adaxial face of
the embryo proper. Whereas ZmWOX2A interprets adaxial
positional information, the early pattern of ZmWOX5B expression indicates the perception of centro/radial information. Based on 2 ZmWOX markers and on ZmSCR (Lim
et al. 2005), the RAM and SAM anlagen seem to be established coordinately in time and at an oblique angle relative
to the initial apical/basal polarity of the zygote.
The Root/Shoot Axis, a Discrete Embryo Domain
The adaxial ZmWOX2A and the central ZmWOX5B expression domains comprise a distinct centrolateral domain
of the embryo proper, whereas the prospective scutellum
fate at the abaxial face is marked by ZmDRN transcription
(Zimmermann and Werr 2007). The view that already in the
proembryo the root/shoot axis is set apart from the rest of
the embryo, for example, suspensor and scutellum, gains
support from the KN1 expression pattern. KN1 is activated
at a late proembryo/early transition stage at the adaxial face
of the embryo, when ZmWOX2A transcription ceases in the
L1 layer (Smith et al. 1995). In contrast to STM, which is
considered the orthologous gene function in Arabidopsis
(Kerstetter et al. 1997), KN1 expression is not only confined
to the SAM of the maize embryo but also transcription extends centrally and basally toward the boundary between
embryo proper and suspensor (fig. 7). At the coleoptilar
stage, the KN1 expression domain comprises an inverted
cup-shaped domain, enclosing the ZmWOX5B expression
domain, which becomes confined to the QC and basal provascular strands during subsequent developmental stages.
In the basal cell layer of the ZmWOX5B transcription domain, ZmSCR is coexpressed and overlaps with the KN1
expression domain in the periphery (data not shown).
At this intermediate stage of primary embryonic axis
development, all cells of the prospective root/shoot axis—
from SAM (except the L1 layer) to QC—express either
KN1 or ZmWOX5B and thus based on transcriptional molecular markers are different from adjacent scutellum cells.
Starting with the restriction of ZmWOX2A expression to the
WOX Genes in Maize Embryonic Patterning 2483
adaxial embryo proper domain and the activation of
ZmWOX5B, the root/shoot axis of the maize embryo comprises a discrete domain, which elongates and where KN1
activity may indicate a meristematic ground state. From an
initially broad transcription pattern inside this KN1 domain,
expression of ZmWOX4 focuses to provascular strands,
similar to ZmWOX5B in subtending cells above the root
QC. The ZmWOX4 and ZmWOX5B patterns in the embryo
are nonoverlapping and according to the position of the scutellar node may correspond to the hypocotyl and primary
root of the maize seedling.
The first evidence for further differentiation of the
SAM is provided by ZmWOX3 paralogues. Together with
ZmNS1 (Nardmann et al. 2004), the grass-specific
ZmWOX3A/B paralogues are expressed in marginal cells
in the emerging coleoptile above the prospective SAM.
This coexpression of NS1/ZmWOX3A/B may indicate functional redundancy and may explain why ns1/ns2 double
mutants are aphenotypic in the coleoptile. However, the expression patterns differ largely during leaf development.
Whereas ZmNS1/2 activity in the shoot apex is restricted
to small foci where lateral leaf domains are initiated
and will detach from the apex (Nardmann et al. 2004),
ZmWOX3A/B expression marks a ring of SAM cells recruited for the P0 primordium. Expression starts and ceases
first at the midrib position of a new leaf primordium and
extends to the opposite face of the SAM, where the axillary
meristem is initiated. In median longitudinal sections
through the maize seedling, consequently, 1 or 2 foci of expression become evident at the flank of the SAM (fig. 5B),
which correspond to different stages during P0 development.
In contrast to ZmNS1/2 transcripts, which are restricted to
basal lateral margins, transcription of ZmWOX3A/B is also
detected in the apical domain of the P1 leaf (fig. 5D).
Although we have not analyzed the pattern of OsNS and
OsWOX3 in the rice embryo, all the seedling patterns consistently agree with the maize data, except that maize has
2 paralogues, whereas rice has a single orthologue. It should
be noted that in addition to ZmNS1/2 and ZmWOX3A/B also
ZmWOX9B is transiently expressed at the flank of the embryonic SAM. The anlage of the complex maize leaf around
the SAM circumference, therefore, involves the activity of
at least 5 ZmWOX genes, not taking into consideration the 2
maize WUS paralogues ZmWUS1 and ZmWUS2 which may
contribute to leaf development (Nardmann and Werr 2006).
Only ZmWUS1 is transiently expressed in the embryo, at
the end of coleoptilar stage, when the SAM starts to initiate
leaves.
Presently there is no evidence for ZmWOX gene activity in the scutellum, whereas 12 ZmWOX genes are transiently expressed in the embryonic shoot/root axis or the
subtending suspensor. This is in contrast to the development of the cotyledons in Arabidopsis, where several
WOX family members are expressed (Haecker et al.
2004, fig. 4). Beside ZmNS1 or ZmWOX3A/B and AtWOX3/PRS, which only share marginal expression patterns
in coleoptile and cotyledons (Nardmann et al. 2004), also
AtWOX1 and 4 are expressed in the cotyledons. Whereas
the expression patterns established here demonstrate that
ZmWOX genes may contribute to various aspects of
shoot/root axis development pattern in the maize embryo,
there seems no contribution in the scutellum. This relates to
the controversial and long-standing discussion whether the
cotyledons and the scutellum represent orthologous organs
(Weatherwax 1920).
However, the alternative hypothesis that the scutellum
may be an invention of grasses and consequently may
find no counterpart in dicot embryos has also been raised
(Reeder 1953). The ZmWOX expression data support this
view as the WOX patterns shared between the Arabidopsis
and the maize embryo involve only the shoot/root axis including the coleoptile of the grass embryo. Strikingly, the
WOX2/5 phylogeny and the patterns of ZmWOX2A and
ZmWOX5B relative to those in Arabidopsis suggest that
the embryonic axis is specified early, in an adaxial–central
domain of the embryo proper. Further, cell-type specifications in this shoot/root axis involve WOX family members
in maize as is observed during globular–heart stage transition in the Arabidopsis embryo including the cotyledons
(see fig. 7). The ZmWOX data, therefore, suggest that during
the early proembryo stage, the maize embryo proper is regionalized into 2 domains; the adaxial shoot/root axis and
an abaxial domain determined to be the scutellum. Both the
early discrete scutellum domain and the absence of WOX
gene activity, which is detected in the cotyledons or the coleoptile of Arabidopsis and maize embryos, respectively,
support the initial assumption that the scutellum may be
an organ without counterpart in dicot embryos and thus
a new acquisition of grasses.
In conclusion, analysis of the WOX gene family reveal
interesting phylogentic differences between monocots and
dicots and confirm that individual family members provide
sophisticated transcriptional markers for plant development. The use of maize WOX gene family members as molecular markers in maize embryo development allowed us
to visualize cellular decisions in the maize proembryo for
the first time, including specification of the shoot/root axis
at an oblique angle to the apical–basal polarity of the zygote. All molecular marker data are compatible with the
conclusion that the embryonic shoot/root axis comprises
a discrete domain from the early proembryo stage on.
All cell fates of the shoot and the root are established within
this distinct morphogenic axis domain, which elongates and
separates the anlagen of SAM and RAM in the course of
embryo development.
Acknowledgments
We thank Dr J. Chandler for suggestions, stimulating
discussions, and critically reading the manuscript. The project was supported by the European Commission (QLK32000-00196 and QLRT-2000-00302) and the Deutsche
Forschungsgemeinschaft (WE 1262/5-1) and through
SFB 680.
Literature Cited
Abbe EC, Phinney BO, Baer DF. 1951. The growth of the shoot
apex in maize: internal features. Am J Bot. 38:744–752.
Berleth T, Chatfield S. 2002. Embryogenesis: pattern formation
from a single cell. In: Somerville CR, Meyerowitz EM,
2484 Nardmann et al.
editors. The Arabidopsis Book. Rockville (MD): American
Society of Plant Biologists. pp. 1-22.
Bradley D, Carpenter R, Sommer H, Hartley N, Coen E. 1993.
Complementary floral homeotic phenotypes result from
opposite orientations of a transposon at the plena locus of
Antirrhinum. Cell. 72:85–95.
Bremer K. 2002. Gondwanan evolution of the grass alliance of
families (Poales). Evolution Int J Org Evolution. 56:1374–1387.
Clark JK, Sheridan WF. 1991. Isolation and characterization of
51 embryo-specific mutations of maize. Plant Cell. 3:935–951.
Dai M, Hu Y, Zhao Y, Liu H, Zhou D-X. 2007. A WUSCHELLIKE HOMEOBOX Gene Represses a YABBY Gene
Expression Required for Rice Leaf Development. Plant
Physiol. 144:380–390.
Doyle JA, Donoghue MJ. 1986. Seed plant phylogeny and the
origin of the angiosperms: an experimental cladistic approach.
Bot Rev. 52:321–431.
Elster R, Bommert P, Sheridan WF, Werr W. 2000. Analysis of
four embryo-specific mutants in Zea mays reveals that
incomplete radial organization of the proembryo interferes
with subsequent development. Dev Genes Evol.
210:300–310.
Haecker A, Gross-Hardt R, Geiges B, Sarkar A, Breuninger H,
Herrmann M, Laux T. 2004. Expression dynamics of WOX
genes mark cell fate decisions during early embryonic
patterning in Arabidopsis thaliana. Development. 131:
657–668.
Hueros G, Varotto S, Salamini F, Thompson RD. 1995.
Molecular characterization of BET1, a gene expressed in the
endosperm transfer cells of maize. Plant Cell. 7:747–757.
Jackson D. 1991. In situ hybridization in plants. In: Bowles DJ,
Gurr SJ, McPerson M, editors. Molecular plant pathology:
a practical approach. Oxford: Oxford University Press. p.
163–174.
Jansen RK, Kaittanis C, Saski C, Lee SB, Tomkins J,
Alverson AJ, Daniell H. 2006. Phylogenetic analyses of Vitis
(Vitaceae) based on complete chloroplast genome sequences:
effects of taxon sampling and phylogenetic methods on
resolving relationships among rosids. BMC Evol Biol. 6:32.
Johansen DE. 1950. Plant embryology: embryogeny of the
Spermatophyta. Waltham (MA): Chronica Botanica Company.
Jurgens G. 1992. Pattern formation in the flowering plant
embryo. Curr Opin Genet Dev. 2:567–570.
Kamiya N, Nagasaki H, Morikami A, Sato Y, Matsuoka M.
2003. Isolation and characterization of a rice WUSCHEL-type
homeobox gene that is specifically expressed in the central
cells of a quiescent center in the root apical meristem. Plant J.
35:429–441.
Kerstetter RA, Laudencia-Chingcuanco D, Smith LG, Hake S.
1997. Loss-of-function mutations in the maize homeobox
gene, knotted1, are defective in shoot meristem maintenance.
Development. 124:3045–3054.
Kranz E. 1999. In vitrofertilization with isolated single gametes.
In: Hall R, editor. Methods in molecular biology, 111, Plant
cell culture protocols. Totowa (NJ): Humana Press Inc. p.
259–267.
Kumar S, Tamura K, Jakobsen IB, Nei M. 2001. MEGA2:
molecular evolutionary genetics analysis software. Bioinformatics. 17:1244–1245.
Lim J, Jung JW, Lim CE, Lee MH, Kim BJ, Kim M, Bruce WB,
Benfey PN. 2005. Conservation and diversification of
SCARECROW in maize. Plant Mol Biol. 59:619–630.
Long JA, Barton MK. 1998. The development of apical embryonic
pattern in Arabidopsis. Development. 125:3027–3035.
Lynch M, Force A. 2000. The probability of duplicate gene
preservation by subfunctionalization. Genetics. 154:459–473.
Magnard JL, Heckel T, Massonneau A, Wisniewski JP,
Cordelier S, Lassagne H, Perez P, Dumas C,
Rogowsky PM. 2004. Morphogenesis of maize embryos
requires ZmPRPL35-1 encoding a plastid ribosomal protein.
Plant Physiol. 134:649–663.
Matsumoto N, Okada K. 2001. A homeobox gene, PRESSED
FLOWER, regulates lateral axis-dependent development of
Arabidopsis flowers. Genes Dev. 15:3355–3364.
Mayer KF, Schoof H, Haecker A, Lenhard M, Jurgens G,
Laux T. 1998. Role of WUSCHEL in regulating stem cell fate
in the Arabidopsis shoot meristem. Cell. 95:805–815.
Nardmann J, Ji J, Werr W, Scanlon MJ. 2004. The maize
duplicate genes narrow sheath1 and narrow sheath2 encode
a conserved homeobox gene function in a lateral domain of
shoot apical meristems. Development. 131:2827–2839.
Nardmann J, Werr W. 2006. The shoot stem cell niche in
angiosperms: expression patterns of WUS orthologues in rice
and maize imply major modifications in the course of monoand dicot evolution. Mol Biol Evol. 23:2492–2504.
Okamoto T, Scholten S, Lörz H, Kranz E. 2005. Identification of
genes that are up- or down-regulated in the apical or basal cell
of maize two-celled embryos and monitoring their expression
during zygote development by a cell manipulation- and PCRbased approach. Plant Cell Physiol. 46:332–338.
Randolph LF. 1936. Developmental morphology of the caryopsis
in maize. J Agric Res. 53:881–916.
Reeder JR. 1953. The embryo of streptochaeta and its beaing on
the homology of the coleoptile. Am J Bot. 40:77–80.
Scheres B, Benfey P, Dolan L. 2002. Root development. The
Arabidopsis Book.
Smith GL, Jackson D, Hake S. 1995. Expression ofknotted1marks shoot meristem formation during maize embryogenesis.
Dev Genet. 16:344–348.
Soltis PS, Soltis DE. 2004. The origin and diversification in
angiosperms. Am J Bot. 91:1614–1626.
Vollbrecht E, Veit B, Sinha N, Hake S. 1991. The developmental
gene knotted-1 is a member of a maize homeobox gene
family. Nature. 350:241–243.
Wardlaw CW. 1955. Embryogenesis in plants. New York: John
Wiley & Sons, Inc.
Weatherwax P. 1920. The homologies of the position of the
coleoptile and the scutellum in maize. Bot Gaz. 69:73–90.
Wikstrom N, Kenrick P. 2001. Evolution of Lycopodiaceae
(Lycopsida): estimating divergence times from rbcL gene
sequences by use of nonparametric rate smoothing. Mol
Phylogenet Evol. 19:177–186.
Wu X, Dabi T, Weigel D. 2005. Requirement of homeobox gene
STIMPY/WOX9 for Arabidopsis meristem growth and
maintenance. Curr Biol. 15:436–440.
Zimmermann R, Werr W. 2005. Pattern formation in the
monocot embryo as revealed by NAM and CUC3 orthologues
from Zea mays L. Plant Mol Biol. 58:669–685.
Zimmermann R, Werr W. 2007. Transcription of the putative
maize orthologue of the Arabidopsis DORNROSCHEN gene
marks early asymmetry in the proembryo and during leaf
initiation in the shoot apical meristem. Gene Expr patterns.
158–164.
Neelima Sinha, Associate Editor
Accepted August 22, 2007