Steroid Hormone-Dependent
Interaction of Human Progesterone
Receptor with its Target Enhancer
Element
Milan K. Bagchi, Jonathan F. Elliston, Sophia Y. Tsai,
Dean P. Edwards, Ming-Jer Tsai, and Bert W. O'Malley
Department of Cell Biology
Baylor College of Medicine
Houston, Texas 77030
Department of Pathology (D.P.E.)
University of Colorado Health Sciences Center
Denver, Colorado 80262
We investigated the requirement of steroid hormone
for the specific binding of progesterone receptor to
its cognate progesterone responsive element (PRE)
in cell-free experiments. We prepared unfractionated nuclear extracts from human breast cancer
(T47D) cells which are rich in progesterone receptors and used a gel retardation assay to monitor
receptor-DNA complex formation. Exposure of receptor to either progesterone, R5020, or the antiprogestin RU38 486 in vivo or in vitro led to the formation
of two protein-DNA complexes (1 and 2) which were
not detected in nuclear extracts unexposed to hormone. Similar treatment with cortisol or estradiol
failed to induce the formation of these complexes.
The complexes were specific for PRE, since they
could be competed efficiently in binding competition
experiments by oligonucleotides containing PRE. A
monoclonal antibody which recognizes both A and
B forms of human progesterone receptor, interacted
with both complexes 1 and 2 and shifted them to
slower migrating forms. Another antibody which only
recognizes the B form interacted with only complex
1 but not with complex 2, establishing that the complexes 1 and 2 were indeed formed by progesterone
receptor forms B and A, respectively. We conclude
from the above studies that in vivo or in vitro treatment of nuclear progesterone receptor with either
progesterone or R5020 or RU38 486 alone can lead
to detection of high affinity complexes formed between the PRE and the receptor present in unpurified
nuclear extracts. (Molecular Endocrinology 2:12211229,1988)
INTRODUCTION
Steroid hormones regulate the expression of specific
genes by increasing the efficiency of transcriptional
0888-8809/88/1221 -1229$02.00/0
Molecular Endocrinology
Copyright © 1988 by The Endocrine Society
initiation from their promoters. This transcriptional activation is apparently triggered by the interaction of
steroid receptors with specific DNA sequences called
steroid responsive elements (SREs). These SREs are
short, c/s-acting enhancer-like regulatory sequences
which confer hormone inducibility to target genes (for
review see Ref. 1). In recent years several SREs have
been identified at variable distances from the promoters
of a variety of steroid regulated genes (1 -7). Works of
Strahle et al. (8) demonstrated that a 15 base-pair
sequence in the tyrosine amino transferase (TAT) gene
can function as both a glucocorticoid and progesterone
responsive element (GRE/PRE). This sequence closely
resembles but is distinct from a 13 base-pair palindromic estrogen responsive element (ERE) derived from
Xenopus vitellogenin A and B genes (9-11). Recent
gene transfer and in vitro binding studies with mutated
SREs have provided interesting insights into the molecular nature of receptor-SRE interactions (9,12).
In spite of the above-mentioned developments, the
role of the steroid hormone in determining the specificity
of the interaction between the receptor and the SRE
remains debatable. A two-step model of steroid hormone action which evolved from the works of Jensen
et al. (13) and Gorski et al. (14), proposed that the
unoccupied steroid receptors reside in the cytoplasm.
Hormone binding was purported to cause the migration
of receptor-hormone complexes to the nucleus and lead
to their interaction with specific target sites on chromatin. Consistent with this model, in vitro studies by
Yamamoto et al. (15) indicated that hormone-binding
results in a significant increase in the affinity of estrogen
receptors for nonspecific DNA. However, this model
was challenged by the later observations of Welshons
et al. (16) and King et al. (17) that at least some steroid
receptors are nuclear proteins even in the unoccupied
state. The requirement of steroid hormone for in vivo
interactions of glucocorticoid receptor with the GRE/
PRE of the TAT gene was demonstrated by Becker et
1221
MOL ENDO-1988
1222
al. (18) by genomic footprinting technique. This observation was in apparent contradiction with the studies
of Willmann and Beato (19) and Bailly et al. (20). Willmann and Beato (19) claimed that hormone-free glucocorticoid receptors can bind specifically to the GRE/
PRE in the long terminal repeat (LTR) of the mouse
mammary tumor virus (MMTV) in vitro. They postulated
that steroid binding is not obligatory for binding of
receptor to its target SRE but may serve only as a
signal for nuclear translocation. Bailly et al. (20) reported
that purified progesterone receptor binds to specific
DNA sequences in the uteroglobin gene with similar
affinity whether in hormone-bound or free state.
Two recent developments prompted us to reinvestigate the role of steroid hormones in the formation of
specific receptor-SRE complexes. One of these was
the extensive characterization of specific SREs as mentioned above; the other was the availability of simple
but highly specific DNA binding assays and monospecifc antibodies against steroid receptor for detecting
DNA-receptor complexes. In the present study, we
investigated the requirements for the interaction of a
PRE with the human progesterone receptor present in
unpurified extracts prepared from the T47D breast
cancer cell line. These cells possess extraordinary
amounts of progesterone receptors which exist in two
molecular forms, A (Mr 84,000) and B (Mr 114,000) (21,
22). Our results presented in this paper clearly demonstrate that 1) at least a certain fraction of unoccupied
progesterone receptors reside in the nucleus in the
absence of hormone but do not interact with high affinity
in an in vitro assay with their cognate PRE and 2) the
addition in vitro of steroid ligand to such receptor extracts can cause a conformational change in the receptor or in a higher order receptor-protein complex which
permits high affinity binding of receptor to its PRE.
RESULTS
Binding of Progesterone Receptor to PRE is
Induced by Steroid Hormone Treatment in Vivo
Nuclear extracts were prepared from T47D cells with
or without a brief exposure to the synthetic progestin
R5020 or antiprogestin RU38 486 before harvesting.
These extracts were then assayed for specific receptorDNA complex formation by a gel retardation assay (23)
using end-labeled TAT gene PRE as described in Materials and Methods. As shown in Fig. 1 A, extracts from
cells harvested without any exposure to hormone gave
rise to only one form of DNA-protein complex with
labeled PRE, indicated as complex 3. The extracts
made from the cells which were exposed to either
R5020 or RU38 486 displayed the formation of two
other complexes 1 and 2 in addition to complex 3.
These results indicated that the formation of complexes
1 and 2 were induced by in vivo treatment of T47D
cells with either R5020 or RU38 486. The complex 3
formation was independent of any hormone treatment.
We used a monoclonal antibody AB52 (24) which rec-
Vol2No. 12
ognizes both A and B forms of human progesterone
receptor to investigate the involvement of progesterone
receptor in the formation of either complex 1 or 2. Upon
addition of the antibody to the binding reaction containing nuclear extracts from R5020-treated cells, both
complexes 1 and 2 were converted to a slower migrating form(s) (Fig. 1B, lane 4). Formation of such a slower
migrating complex was not observed on addition of the
antibody to binding reactions containing hormone-free
nuclear extract. The result of this experiment demonstrated the presence of progesterone receptor in both
complexes 1 and 2. The migration of complex 3 remained unaffected in the presence of the antibody,
indicating the absence of progesterone receptor in this
complex. The appearance of an additional DNA-protein
complex which migrated slightly slower than complex
1 was observed only with some nuclear extract preparations. The identity of the protein(s) participating in the
formation of this complex is not clear at present.
Binding of Progesterone Receptor to PRE upon the
Addition of Hormone in Vitro
Next we attempted to induce the formation of complexes 1 and 2 in vitro by adding a variety of steroid
hormones to nuclear extracts prepared from hormonefree cells. Nuclear extracts made from cells which were
grown in charcoal-stripped serum were incubated with
or without 10-100 NM concentration of different steroid
hormones, e.g. progesterone, R5020, RU38 486,17-/3
estradiol, or cortisol. These extracts were then assayed
for complex formation with labeled PRE as described
in Fig. 2. Incubation of nuclear extracts in the absence
of any hormone did not elicit the formation of either
complex 1 or 2. However, when we carried out the
incubations in the presence of 10" 8 to 10~7 M concentrations of progesterone or R5020 we could observe
the appearance of the complexes 1 and 2. The band
intensities are relatively light but not unexpected considering the fact that no enrichment of receptor was
attempted. Similar concentrations of the antiprogestin
RU38 486 also induced the formation of the same
complexes 1 and 2, but in at least one of the bands,
the signal appeared to be more intense compared to
those induced by either progesterone or R5020. No
induction of complexes 1 or 2 was observed when the
nuclear extract was incubated with similar concentrations of either cortisol or estradiol in vitro. In each of
the above cases, however, complex 3 formation was
seen. The amount of complex 3 formation clearly did
not change either in the presence or absence of any
hormone. These data demonstrate that complexes 1
and 2 could be induced in vitro by incubating hormonefree nuclear extracts with either progesterone, R5020,
or anti-progestin RU38 486 but not by estradiol or
cortisol.
Receptor-PRE Complexes 1 and 2 are Sequence
Specific
To test the specificities of the complexes induced by in
vitro steroid hormone treatment, we performed binding
Hormone-Dependent Binding of PR to PRE
CO
-Hormone + R5020
I*
Hormone
(10"8M)
1223
Ab-AB52
(50[ig/ml)
cc en
1
2
B
1 2
3
4
Probe
1 2 3
Fig. 1. Progesterone Receptor-PRE Complexes Generate upon in Vivo Hormone Treatment of T47D Cells
A, Nuclear extracts were made from hormone-free and hormone-treated cells and assayed by gel retardation as described in
Materials and Methods. Five micrograms of protein were used in each reaction. Arrows 1, 2, and 3 indicate the positions of
migration of the DNA-protein complexes in the gel. B, Binding reactions with nuclear extracts from hormone-free and R5020treated cells (8.5 and 5 fig protein, respectively) were carried out in the presence or, absence of antibody AB52. Lanes 1, 3, No
antibody added; lanes 2, 4, antibody AB52 was added to a final concentration of 50 fig/m\.
Vol2No. 12
MOL ENDO-1988
1224
(ft
CM
CD
o
Hormone
Cone. (10-8 M)
-
1
5
O
CO
o
(ft
CO
CO
CM
10
1
5
10
-
1
5
10 1 10
o
O
1 10
2*-
Fig. 2. Specificity of the Hormone-Dependent Binding of Progesterone Receptor to PRE in Vitro
The hormone-free nuclear extracts (5 ^g protein) were first incubated in the presence or absence of indicated concentrations of
various steroid hormones for 30 min. on ice. The extracts were then mixed with 32P-labeled PRE and pBR322/H/nfl and gel
retardation assays were carried out as described in Materials and Methods.
competition studies with a variety of unlabeled oligonucleotides. For this purpose we used an extract which
was incubated in the presence of 10~7 M progesterone
in vitro as described in Fig. 2. Various molar excesses
of unlabeled PRE, a mutant PRE harboring two point
mutations (PREM), an ERE of the vitellogenin gene (10)
or a completely unrelated oligonucleotide Chicken Ovalbumin Upstream Promoter (COUP) (22) were mixed with
the labeled PRE probe before the addition of the nuclear
extract to the reaction mixture. As shown in Fig. 3A,
the formation of complexes 1 and 2 could be competed
efficiently by a 10- to 30-fold molar exess of the unlabeled PRE. When a similar molar excess of either
PREM, ERE, or COUP was used, no competition could
be observed. In contrast, complex 3 formation did not
show any competition at all with any of the oligonucleotides used. When a lower amount of nuclear extract
and higher molar excesses of competitor DNAs were
used, complex 3 formation was found to be competed
to a similar extent by either PRE, ERE, or COUP
sequence (Fig. 3B). This result showed again the lack
of DNA specificity for the formation of complex 3. These
competition data suggested that complexes 1 and 2
induced by in vitro treatment of T47D nuclear extracts
with steroid hormones were specific for the PRE sequence.
Both A and B Forms of Progesterone Receptor Bind
to PRE
To check whether complexes 1 and 2 were generated
by the interaction of PRE with only one or both A and
B forms of the human progesterone receptor, we employed two different monoclonal antibodies to the progesterone receptor. While antibody AB52 recognizes
both A and B forms of human progesterone receptor,
antibody B30 recognizes only the B form (24). Results
of the experiment with the antibodies are described in
Fig. 4 A and B. Complexes 1 and 2 were formed by an
extract activated in vitro by progesterone. Upon addition of increasing amounts of antibody AB52, both
complexes 1 and 2 were shifted to slower migrating
complexes indicating that the antibody interacted with
both complexes 1 and 2. However, when we used the
monoclonal antibody B30 which was specific for the B
form, only complex 1 was shifted to a slower migrating
complex. In control experiments, an antibody raised
against an 80 kilodalton DNA binding nonreceptor pro-
Hormone-Dependent Binding of PR to PRE
PRE
1225
PRE M
ERE
COUP
Molar Ratio
- 10 20 30 - 10 2030 - 10 20 30 10 20 30
of Competitors:
1
2
PRE
Molar Ratio
of
Competitors
ERE
COUP
- 100 200 300 - 100 200 300 - 100 200 300
Complex 3
B
Fig. 3. Specificity of DNA Binding of the Hormone-Induced Complexes
A, A hormone-free nuclear extract was activated in vitro in the presence of 10~7 M progesterone and then used in this experiment.
The binding assay was performed as described above. The competitor DNAs were mixed with the probe DNA before addition of
the protein fraction. B, Competition experiments were performed as described in A. One microgram of nuclear extract and indicated
concentrations of competitor oligonucleotides were used.
tein from chicken shifted neither complex 1 nor 2,
showing that the interactions of complexes 1 or 2 with
antibodies AB52 or B30 as described above were progesterone receptor specific. None of the antiprogesterone antibodies interacted with complex 3, indicating the
absence of receptor in complex 3. Figure 4B presents
similar data obtained with extracts preincubated in vitro
with the antiprogestin RU38 486. While the antibody
AB52 shifts both complexes 1 and 2 induced by RU38
486, only complex 1 was shifted by antibody B30. In
summary, the above experiments using receptor-specific antibodies established that complexes 1 and 2
induced by progestins and an antiprogestin in vitro
involved forms B and A of human progesterone receptor, respectively.
DISCUSSION
In this paper, we present the results of our studies on
the interaction of progesterone receptor with its cognate PRE in the presence or absence of hormone ligand.
As a source of hormone-free progesterone receptor,
we used T47D cells grown in culture media containing
charcoal-stripped serum. T47D cells possess unusually
high levels of progesterone receptor exceeding the
levels of glucocorticoid receptor by more than 100-fold.
Two forms of progesterone receptor have been identified in T47D cells: the A form (Mr = 84,000) and the B
form (Mr = 114,000) (21, 22). Both forms have been
shown to be present in cytosolic and nuclear fractions
after cell fractionation.
Vol2No. 12
MOL ENDO-1988
1226
Ab-AB52
Ab-B30
Ab-80kDa
Antibody
- 20 30 50 - 20 30 50 - 20 30 50
Cone, (pg/ml)
1
2
+ Ru38486
II
CM
m
-Hormone
CO
CM
m
CD
o
co
CD
Antibody
Cone, (mg/ml) -
20 20 30 -
20 20
Shifted \ - >
Complexes I
B
Fig. 4. Antibodies to Progesterone Receptor Recognizes Complexes 1 and 2
A, Nuclear extract activated in vitro by progesterone was used. Antibodies AB52, B30 and Ab-80 kDa were added to the binding
reaction at indicated concentrations. The antibody shifted complexes are indicated by un-numbered arrows. B, Hormone-free
nuclear extract and RU38 486 - activated nuclear extracts were used in an experiment similar to the one described in A.
Hormone-Dependent Binding of PR to PRE
We employed a gel retardation assay to detect high
affinity complex formation between the progesterone
receptors present in T47D nuclear extracts and the
PRE. The binding assay was performed in the presence
of at least 10,000-fold mass excess of nonspecific
competitor DNA relative to the probe DNA to minimize
nonspecific or low affinity binding to the PRE. When we
tested nuclear extracts prepared from cells grown in
the presence or absence of progestins for specific DNA
binding activity, we observed the appearance of two
protein-DNA complexes (1 and 2) only in extracts from
hormone-treated cells. In vitro incubation of extracts
made from hormone-free cells with 10~8 to 10~7 M
progestins led to the formation of complexes 1 and 2.
However, neither estrogen nor cortisol could induce
this high affinity binding indicating that the formation of
complexes 1 and 2 were hormone specific.
The DNA binding specificities of these two complexes
were demonstrated by binding competition studies with
unlabeled oligonucleotides containing PRE, mutated
PRE, ERE, or unrelated sequences. Experiments with
monoclonal antibodies which either recognize both A
and B forms or only the B form of the progesterone
receptor established conclusively the participation of
the B and A forms in the formation of complexes 1 and
2, respectively. These results demonstrate the steroid
dependence of the high affinity interaction of steroid
receptor with the SRE in vitro. Interestingly, RU38 486,
a synthetic steroid exhibiting antiprogestin activity also
could induce the formation of receptor-PRE complexes
both in vivo and in vitro. The intensities of the complexes induced by it, especially that formed by the B
form of the receptor, was higher compared to those of
the progestin-induced complexes. Rusconi and Yamamoto (25) have reported previously that RU38 486,
which is also a glucocorticoid antagonist, stimulated
the specific binding of glucocorticoid receptor to the
GRE of MMTV LTR. The significance of this increased
binding of the receptor to the SRE in the presence of
RU38 486 is unclear. However, it appears that the
antihormone effect of RU38 486 must be due to some
conformational alteration in receptor structure that impairs transcriptional activation at a step after the receptor binds to DNA since it clearly binds with specificity
and high affinity to the PRE enhancer.
In addition to the two hormone-induced receptor
complexes 1 and 2, a third DNA-protein complex
termed complex 3 appeared persistently in all the gel
retardation patterns obtained with nuclear extracts
made from hormone-treated or untreated cells. Binding
competition studies failed to show significant DNAbinding specificity for this complex formation. Experiments with antibodies described in Figs 1 and 4 clearly
demonstrated that this complex was not recognized by
any of the antibodies against progesterone receptor.
Incubation of HeLa nuclear extracts with PRE led to
the formation of a predominant DNA-protein complex
which migrated exactly to the same position in the gel
as complex 3 (data not shown). DNA binding specificity
for this complex was not apparent. Although we do not
know the identity of the protein(s) involved in the for-
1227
mation of complex 3, available data indicate that it is
formed by a relatively nonspecific interaction of an
abundant nuclear DNA binding protein with the PRE.
The relationship of this protein to specific receptor-DNA
interaction, if any, is under continuing investigation.
Another interesting aspect of our results is the existence of hormone-free nuclear receptors which fail to
bind PRE with sufficient affinity to be detected in our
assay. The signals of the PRE-receptor complexes
formed by 5 ng hormone-treated nuclear extracts and
8.5 ng hormone-free extracts activated in vitro by hormones showed comparable intensities (data not
shown). Within the limitations of the binding assay and
assuming that most of the cellular receptors are nuclear
in the hormone-treated cells, these results indicate that
significant amounts of receptors are in the nucleus even
in the absence of hormone. We are aware of the possibility that the nuclear location of receptors in the
absence of hormone may arise from a low affinity
nonspecific interaction of the receptor with nuclear target sites.
Our results are consistent with the published results
of Becker et al. (18) and Rusconi and Yamamato (25).
The former group of workers reported the steroid dependency of the in vivo interactions of the glucocorticoid
receptor with the GRE of the TAT gene. The latter
group used a truncated glucocorticoid receptor synthesized in vitro from a cloned gene and observed a
stimulatory effect of hormone on the sequence-specific
DNA binding activity of this receptor, although the effect
was only modest. On the other hand, our results are in
apparent contradiction to Willmann and Beato's proposal (19) that the DNA binding domain of the receptor
is entirely functional in the absence of hormone. They
observed that both hormone-bound and hormone-free
rat glucocorticoid receptors in crude hepatic cytosol
generated identical footprints on MMTV promoter. We
speculate, however, that a difference in structural status of the receptor molecules present in our nuclear
extracts and Willmann and Beato's (19) receptor preparations may account for the different requirements for
receptor-SRE interaction. In fact, the receptor preparation used by Willmann and Beato (19) in their study
had undergone heat treatment. They observed that
specific binding of cytosolic glucocorticoid receptor to
the MMTV-LTR depended on this heat activation step.
Previous studies reported that the steroid receptors
could be activated from a non-DNA binding to a DNAbinding form by a number of in vitro manipulations of
cell extracts, e.g. heat treatment, and/or exposure to
high salt etc. (26-28). It is conceivable that these treatments effect conformational changes either in the receptor molecule itself or in its association with other
proteins which in turn increase its interaction with specific target DNA sequences even in the absence of the
cognate hormone ligand. Also we cannot rule out the
possibility that nuclear steroid receptors behave differently in their requirements for high affinity binding to
SRE compared to cytosolic receptors.
At present, the molecular mechanism of the progestin
and antiprogestin mediated activation of A and B forms
Vol2No. 12
MOL ENDO-1988
1228
of progesterone receptor is unclear. Although we do
not provide any direct evidence for receptor ligand
complex formation during the hormone-dependent activation process, it is possible that the specific DNA
binding characteristics and/or affinity of the receptor
may actually be effected by direct ligand binding. Photoaffinity labeling studies by Horwitz (22) demonstrated
that both R5020 and RU38 486 bind A and B forms of
progesterone receptor in the nuclei of T47D cells at
hormone concentrations similar to those used in our
experiments. An alternative and quite plausible explanation of our results is that under the present assay
conditions a hormone-induced conformational unmasking of the functional receptor occurs which releases it
from an inactive protein complex with either itself or an
inhibitor of DNA binding. For example, Joab et al. (29),
Sanchez et al. (30), and Denis et al. (31) have described
a 90 kDa nonhormone-binding heat-shock protein (hsp)
90 which remains associated with the untransformed
forms of all steroid receptors but dissociates upon
activation. Also, Denis et al. (32) have reported liganddependent dissociation of glucocorticoid receptor from
hsp 90 protein; the dissociated receptor was capable
of binding its cognate SRE. Such proteins inhibit binding
of receptor to DNA and would be expected to be
present in our crude nuclear extracts. If this were the
case purification of the receptor could lead to an apparent ligand-independent interaction with the PRE. In
fact, little effect of ligand on receptor binding to DNA
has been observed in purified progesterone receptor
preparations from chick oviduct (Rodriguez, R., and W.
T. Schrader, unpublished observations). In any case,
our present observations lead us to propose that in a
salt extract of nuclei, ligand-free progesterone receptor
is capable only of low affinity, nonspecific interactions
with its target enhancer element under the conditions
employed in our experiments. In the presence of specific hormonal ligand, however, a necessary and sufficient conformational change takes place in the receptor
molecule which makes it competent to interact with
greater specificity and affinity with its target PRE.
Finally, we believe that the simple DNA binding assay
we described here, could be used successfully to study
the interaction of other steroid receptors with their
specific binding sequences (SREs). Partially purified
receptor preparations or even cell extracts enriched in
receptors could be used for this purpose. The hormonedependent binding of the receptors to their SRE sequences offers the possibility also of purifying the receptors by employing the SREs in DNA affinity chromatography.
MATERIALS AND METHODS
Materials
R5020 (17,21-dimethyl-19-norpregna-4, 9-diene-3, 20-dione)
was obtained from New England Nuclear (Boston, MA). Cortisol and estradiol-17/3 were purchased from Sigma (St. Louis,
MO). RU38 486 [17j8-hydroxy-11 j8-(4-dimethyl aminophenyl)-
17a-(1-propynyl)-estra-4,9-dien-3-one] was a generous gift
from Dr. B. S. Katzenellenbogen (Urbana, IL). The nucleotide
sequence of the double stranded PRE oligonucleotide used in
the binding assay is given below:
GATCCTGTACAGGATGTTCTAGCTACG
GACATGTCCTACAAGATCGATGCCTAG
The mutated PRE (PREM) used in the binding competition
assays has two G residues substituting the bases indicated
by the asterisks in the sequence above. The oligonucleotides
were synthesized by Dr. Juan Codina-Salada (Houston, TX).
Cell Culture
T47D cells obtained from Mason Research Institute (Worcester, MA) were maintained at 37 C in a humidified atmosphere
of 5% CO2 and air and passaged in logarithmic growth phase.
Growth medium was Dulbecco's modified Eagle's medium
(Gibco, Grand island, NY), supplemented with 0.5 Mg/ml insulin
(Sigma), 50 Mg/ml gentamicin (Gibco)), 0.3 mg/ml L-glutamine
(Gibco), and 5% fetal calf serum (Gibco). Cells were switched
to 5% charcoal-stripped fetal calf serum at least 5 days before
the onset of each experiment.
Preparation of Nuclear Extract
Near-confluent flasks of T47D cells (~20-30 x 106 cells per
flask) were harvested (using Hanks' balanced salt solution
containing 1 mM EDTA) and either incubated in 10 ml media
containing 10 nwi R5020 or RU38 486 for 1 h at 37 C, or
immediately washed with 50 ml phosphate-saline buffer. Pelleted cells were washed with TEG buffer containing 10 mM
Tris, pH 7.4, 1.5 mM EDTA, 10% glycerol, and homogenized
in 2 ml same buffer with 30 strokes in a Dounce homogenizer
with the B pestle. The homogenate was centrifuged at 800 x
g for 10 min. and the supernatant was removed. The crude
pellet was then resuspended in 1 ml buffer A containing 20
mM HEPES, pH 7.9, 5 mM MgCI2, 0.1 mM EDTA, 2 mM
dithiothreitol, 20% glycerol, and 0.6 M NaCI and incubated for
1 h on ice with resuspension every 15 min. The suspension
was then centrifuged at 180,000 x g for 30 min. The supernatant was collected and dialyzed overnight against buffer A
with one change. The dialyzed nuclear extract was centrifuged
again at 10,000 x g for 15 min. The resulting supernatant was
aliquoted and stored frozen at - 8 0 C. The protein concentration of the extract was determined by the method of Bradford
(33).
DNA Binding Assay
The PRE oligonucleotide was end labeled with Klenow enzyme
and [«32-P]dGTP to 1-5 x 108 cpm/Mg. The labeled PRE (0.1
- • 0.2 ng) and 1-1.5 ^g pBR322/H;nf1 were incubated with
various types of T47D nuclear extracts (5-9 ng) under the
conditions previously described (23). In most cases longer
than usual size gels were run to achieve better separation
among complexes.
Acknowledgments
We wish to thank Dr. S. Nordeen for helpful discussions. We
thank Cindy Porter for excellent technical assistance and
Cheryl McCarthy for help in preparing this manuscript.
This work was supported by Public Health Service Grants
HD-08188 and HD-07857 from the NIH.
Received July 11,1988. Accepted August 17,1988.
Address requests for reprints to: Prof. Bert W. O'Malley,
M.D., Chairman, Department of Cell Biology, Baylor College
of Medicine, 1 Baylor Plaza, Houston, Texas 77030.
Hormone-Dependent Binding of PR to PRE
1229
REFERENCES
18.
1. Yamamoto KR 1985 Steroid receptor regulated transcription of specific genes and gene networks. Annu Rev Genet
19:209-252
2. Chandler VL, Maler BA, Yamamoto KR 1983 DNA sequences bound specifically by glucocorticoid receptor in
vitro render a heterologous promoter hormone responsive
in vivo. Cell 33:489-499
3. Payver F, DeFranco D, Firestone GL, Edgar B, Wrange
6, Okret S, Gustafsson JA, Yamamoto KR 1983 Sequence-specific binding of glucocorticoid receptor to MTV
DNA at sites within and upstream of the transcribed
region. Cell 35:381-392
4. Scheidereit C, Geisse S, Westphal HM, Beato M 1983
The glucocorticoid receptor binds to defined nucleotide
sequences near the promoter of mouse mammary tumor
virus. Nature 304:749-752
5. Von der Ahe D, Janich S, Scheidereit C, Renkawitz R,
Schutz G, Beato M 1985 Glucocorticoid and progesterone
receptors bind to the same sites in two hormonally regulated promoters. Nature 313:706-709
6. Renkawitz R, Schutz G, Von der Ahe D, Beato M 1984
Sequences in the promoter region of the chicken lysozyme gene required for steroid regulation and receptor
binding. Cell 37:503-510
7. Jantzen HM, Strahle U, Gloss B, Stewart F, Schmid W,
Boshart M, Miksicek R, Schutz G 1987 Cooperativity of
glucocorticoid response elements located far upstream of
the tyrosine aminotransferase gene. Cell 49:29-38.
8. Strahle U, Klock G, Schutz G 1987 A DNA sequence of
15 base pairs is sufficient to mediate both glucocorticoid
and progesterone induction of gene expression. Proc Natl
Acad Sci USA 84:7871-7875
9. Klock G, Strahle U, Schutz G 1987 Oestrogen and glucocorticoid responsive elements are closely related but
distinct. Nature 329:734-736
10. Klein-Hitpass L, Schorpp M, Wagner U, Ryffel GU 1986
An estrogen responsive element derived from the 5'flanking region of the Xenopus vitellogenin A2 gene functions in transfected human cells. Cell 46:1053-1051
11. Martinez E, Givel F, Wahli W 1987 The estrogen responsive element as an inducible enhancer: DNA sequence
requirements and conversion to a glucocorticoid-responsive element. EMBO J 6:3719-3727
12. Chalepakis G, Arnemann J, Slater E, Bruller HJ, Gross B,
Beato M 1988 Differential gene activation by glucocorticoids and progestins through the hormone regulatory
element of mouse mammary tumour virus. Cell 53:371382
13. Jensen EV, Suzuki T, Kawashima T, Stumpf WE, Jungblut
PW, DeSombre ER 1968 A two-step mechanism for the
interaction of estradiol with rat uterus. Proc Natl Acad Sci
USA 59:632-638
14. Gorski J, Toft DO, Shyamala G, Smith D, Notides A 1968
Hormone receptors: studies on the interaction of estrogen
with the uterus. Rec Prog Horm Res 24:45-80
15. Yamamoto KR, Alberts BM 1972 In vitro conversion of
estradiol-receptor protein to its nuclear form: dependence
on hormone and DNA. Proc Natl Acad Sci USA 69:21052109
16. King WJ, Greene GL 1984 Monoclonal antibodies localize
oestrogen receptor in the nuclei of target cells. Nature
307:745-747
17. Welshons WK, Liebermann ME, Gorski J 1984 Nuclear
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
localization of unoccupied oestrogen receptors. Nature
307:747-749
Becker PB, Gloss B, Schmid W, Strahle U, Schutz G 1986
In vivo protein-DNA interactions in a glucocorticoid response element require the presence of the hormone.
Nature 324:686-688
Willmann T, Beato M 1986 Steroid-free glucocorticoid
receptor binds specifically to mouse mammary tumor virus
DNA. Nature 324:688-691
Bailly A, LePage C, Rauch M, Milgrom E 1986 Sequencespecific DNA binding of the progesterone receptor to the
uteroglobin gene: effects of hormone, antihormone and
receptor phosphorylation. EMBO J 5:3235-3241
Lessey BA, Alexander PS, Horwitz KB 1983 The subunit
structure of human breast cancer progesterone receptors:
characterization by chromatography and photoaffinity labelling. Endocrinology 112:1267
Horwitz KB 1985 The antiprogestin RU38 486: Receptormediated progestin versus antiprogestin actions screened
in estrogen-insensitive T47D human breast cancer cells.
Endocrinology 116:2236-2245
Sagami I, Tsai SY, Wang H, Tsai MJ, O'Malley BW 1986
Identification of two factors required for transcription of
the ovalbumin gene. Mol Cell Biol 6:4259-4267
Estes PA, Suba EJ, Lawler-Heavner J, Elashry-Stowers
D, Wei LL, Toft DO, Sullivan WP, Horwitz KB, Edwards
DP 1987 Immunologic analysis of human breast cancer
progesterone receptors. Immunoaffinity purification of
transformed receptors and production of monoclonal antibodies. Biochemistry 26:6250-6262
Rusconi S, Yamamoto KR 1987 Functional dissection of
the hormone and DNA binding activities of the glucocorticoid receptor. EMBO J 6:1309-1315
Baxter JD, Rousseau GG, Benson MC, Garcea RL, Ito J,
Tomkins GM 1972 Role of DNA and specific cytoplasmic
receptors in glucocorticoid action. Proc Natl Acad Sci
USA 69:1892-1896
Holbrook NJ, Bodwell JE Jeffnes M, Munck A 1983 Characterization of non-activated and activated glucocorticoid
receptor complexes from intact rat thymus cells. J Biol
Chem 258:6477-6485
Reker CE, Kovacic-Milivojevic B, Eastman-Reks SB, Vedeckis WV 1985 Transformed mouse glucocorticoid receptor: generation and interconversion of the 3-8S, monomeric and 5-2S, oligomeric species. Biochemistry
24:196-204
Joab I, Radaryi C, Renoir M, Buchou T, Catelli MG, Binart
N, Mester J, Baulieu EE 1984 Common non-hormone
binding component in nontransformed chick oviduct receptors of four steroid hormones. Nature 308:850-853
Sanchez ER, Toft DO, Schlesinger MJ, Pratt WB 1985
Evidence that the 90 kDa phosphorprotein associated
with the untransformed L-cell glucocorticoid receptor is a
murine heat shock protein. J Biol Chem 12398-12401.
Denis M, Wikstrom A-C, Gustafsson J-A 1987 The molybdate-stabilized nonactivated glucocorticoid receptor contains a dimer of Mr 90,000 non-hormone-binding protein.
J Biol Chem 262:11803-11806
Denis M, Poellinger L, Wikstom A-C, Gustafsson J-A 1988
Requirement of hormone for thermal conversion of the
glucocorticoid receptor to a DNA-binding state. Nature
333:686-688.
Bradford MM 1976 A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing
the principle of protein-dye binding. Anal Biochem
72:248-254