Mutagenesis vol. 19 no. 4 pp. 269±276, 2004
DOI: 10.1093/mutage/geh030
DNA damage and repair measured in different genomic regions using
the comet assay with ¯uorescent in situ hybridization1
Eva HorvaÂthovaÂ1, MaÂria DusÏinskaÂ2,
Sergey Shaposhnikov3 and Andrew R.Collins3±5
Research Institute, VlaÂrska 7, 833 91 Bratislava, Slovakia, 2Institute
of Preventive and Clinical Medicine, Slovak Medical University, LimbovaÂ
12, 833 03 Bratislava, Slovakia, 3Department of Nutrition, University of
Oslo, PO Box 1046, Blindern, 0316 Oslo, Norway and 4Rowett Research
Institute, Greenburn Road, Aberdeen AB21 9SB, UK
1Cancer
The comet assay is a sensitive method for measuring DNA
strand breaks in eukaryotic cells. After embedding in
agarose, cells are lysed and electrophoresed at high pH.
DNA loops containing breaks (in which supercoiling is
relaxed) escape from the nucleoid comet head to form a
tail. Oligonucleotide probes were designed for 5¢ and 3¢
regions of the genes for dihydrofolate reductase (DHFR)
and O6-methylguanine DNA methyltransferase (MGMT),
both from the Chinese hamster, and the human tumour
suppressor p53 gene. Alternate ends were labelled with
either biotin or ¯uorescein. These probes were hybridized
to the DNA of comets from Chinese hamster ovary
(CHO) cells or human lymphocytes treated with H2O2 or
photosensitizer plus light to induce oxidative damage.
Ampli®cation with Texas red- and ¯uorescein-tagged antibodies led, in the case of p53 in human cells, to red and
green signals located in the comet tail (as well as in the
head), indicating the presence of breaks in the vicinity of
the gene. However, only one end of the MGMT gene
appeared in the tail and almost no signals from the DHFR
gene, either red or green, were in the tail of comets from
CHO cells. Restriction on movement from the head to tail
may result from the presence of a `matrix-associated
region' in the gene. The kinetics of repair of oxidative
damage were followed; strand breaks in the p53 gene were
repaired more rapidly than total DNA. Thus, ¯uorescent
in situ hybridization in combination with the comet assay
provides a powerful method for studying repair of speci®c
genes in relation to chromatin structure.
Introduction
Not all mammalian genes are repaired with the same ef®ciency.
Following damage by UV radiation, cyclobutane pyrimidine
dimers in transcribed genes tend to be repaired more quickly
compared with damage in non-transcribed genes (Bohr et al.,
1985; Madhani et al., 1986; Mellon et al., 1986) and damage is
removed more quickly from the transcribed than from the nontranscribed strand (Mellon et al., 1987). This phenomenon is
known as transcription-coupled repair (TCR). The approach
generally used to measure gene-speci®c repair is based on
digestion of DNA extracted from UV-treated cells with a
suitable restriction endonuclease and a UV damage-speci®c
endonuclease, followed by denaturation, electrophoretic
separation and identi®cation of the restriction fragment by
Southern blotting using a radioactively labelled probe. If
suf®cient damage is present so that virtually all copies of the
gene fragment contain a lesion, a smear rather than a discrete
band appears on the autoradiograph, because the lesions (and
hence the endonuclease-induced breaks) are randomly distributed. When cells are incubated after damage, intact restriction
fragments begin to reappear as the damage is repaired, and the
band increases in intensity. Such experiments require a high
degree of damage, to ensure that virtually all cells are damaged
in the fragment of interest. The relevance of the results to the
normal situation of low levels of damage from environmental
exposure is uncertain. Relatively few genes have been
subjected to this kind of analysis of repair of UV damage
and only recently has gene-speci®c repair been investigated in
relation to other kinds of damage, such as base oxidation (Taffe
et al., 1996; LePage et al., 2000).
The comet assay (single cell gel electrophoresis) is a
sensitive method for detecting DNA strand breaks and other
lesions (Collins and DusÏinskaÂ, 2002). Cells embedded in
agarose on a microscope slide are lysed with non-ionic
detergent and 2.5 M NaCl, a treatment known for many
years to produce nucleoids, structures resembling nuclei but
lacking most histones and other nuclear proteins (Cook et al.,
1976). A nuclear matrix or scaffold is still present, supporting
the DNA as a series of loops, which are supercoiled by virtue of
their former turns around nucleosomes. If breaks are present,
supercoiling is relaxed and the DNA loops are able to extend to
form a halo (Cook et al., 1976). In the comet assay, the
nucleoids are immobilized in agarose and electrophoresed. The
DNA extends towards the anode to form a comet tail, which is
visualized by ¯uorescence microscopy after staining with a dye
such as 4¢,6-diamidino-2-phenylindole (DAPI). Increasing the
number of breaks increases the percentage of DNA in the tail,
but has little effect on tail length, supporting the notion that, as
in nucleoid halos, the factor determining the appearance of
DNA in the tail is whether or not the loop is relaxed (Collins
et al., 1997).
With its high sensitivity, the comet assay lends itself to
investigations of the kinetics of repair of low levels of damage
induced in nuclear DNA by treatment with reactive oxygen,
e.g. H2O2. Strand breaks are typically rejoined quickly. In
Chinese hamster ovary (CHO) cells, most breaks disappear
during incubation for 30 min (Collins and HorvaÂthovaÂ, 2001),
very similar to the rate of repair of ionising radiation-induced
strand breaks (Frankenberg-Schwager, 1989). Freshly isolated
human lymphocytes apparently rejoin H2O2-induced breaks
more slowly (Collins et al., 1995). Oxidized bases can also be
detected with the comet assay, by incubating the nucleoids in
the gel with a lesion-speci®c endonuclease (endonuclease III or
formamidopyrimidine DNA glycosylase, FPG) to convert the
5To
whom correspondence should be addressed at: Department of Nutrition, University of Oslo, PO Box 1046, Blindern, 0316 Oslo, Norway.
Tel: +47 22 85 13 60; Fax: +47 22 85 13 41; Email: [email protected]
Mutagenesis vol. 19 no. 4 ã UK Environmental Mutagen Society 2004; all rights reserved.
269
E.HorvaÂthova et al.
damage to breaks. Repair of oxidized bases in CHO cells or
HeLa cells has a t0.5 of several hours (Collins et al., 1995;
Collins and HorvaÂthovaÂ, 2001).
We have developed a general method, combining the comet
assay and ¯uorescent in situ hybridization (FISH), to monitor
the repair of particular genes after low level DNA damage,
against the background of total genomic DNA damage and
repair. Oligonucleotide probes are used to identify the two ends
of one strand of a target gene in the DNA of a comet. They are
labelled with either biotin or ¯uorescein so that after ampli®cation with appropriate antibodies and ¯uorescent tags, the
two ends appear as red (Texas red) or green (¯uorescein) spots
against the DAPI-stained background.
We selected for study three genes known to be expressed in
most cell types. The housekeeping gene for dihydrofolate
reductase (DHFR) was the ®rst gene investigated for ef®ciency
of repair relative to the genome overall (Bohr et al., 1985).
Unexpectedly, comet±FISH signals for DHFR do not appear in
the tail even in comets from severely damaged CHO cells. In
contrast, in human lymphocytes FISH clearly indicates DHFR
genes (or pseudogenes) in the tail, and we have followed their
repair, as well as repair of the O6-methylguanine DNA
methyltransferase gene (MGMT) in CHO cells and the tumour
suppressor protein gene p53 in human cells, in comparison with
the rate of repair of DNA overall. This approach is generally
applicable to measuring gene-speci®c repair rates. It also
provides information on the location of individual genes in
relation to the nuclear matrix and, hence, on the structural
organization of DNA repair.
Materials and methods
Cells
CHO cells were cultured in DMEM/F12 medium (Gibco BRL, Paisley, UK)
with 10% foetal calf serum. Cells were washed twice with phosphate-buffered
saline (PBS) and treated as described below with DNA-damaging agent.
Lymphocytes were obtained from ®nger-prick blood samples. A sample of
30 ml of blood was added to 1 ml of RPMI 1640 (without phenol red) and 10%
foetal calf serum in a 1.5 ml Eppendorf tube and left on ice for 30 min before
being underlayed with 0.1 ml of Histopaque 1077 (Sigma, Poole, UK). The
tubes were centrifuged at 200 g for 3 min at 4°C. Lymphocytes were removed
from just above the interface between the RPMI and Histopaque, mixed with
1 ml of PBS, centrifuged again and the pellet suspended in PBS containing
H2O2 or photosensitizer (see below).
Treatment with DNA-damaging agent
CHO cells growing in monolayer and lymphocytes in suspension were treated
in one of three ways. (i) Cells were incubated with 0.2 mM H2O2 in PBS for 5
min on ice. This treatment induces predominantly strand breaks in the DNA.
(ii) The photosensitizer Ro 19-8022 (Hoffmann-La Roche, Basel, Switzerland)
was added to the cells at 0.1 mM in PBS and the cells were irradiated for 2 min
on ice at 0.33 m with a 1000 W tungsten halogen lamp. This treatment oxidizes
bases in DNA but causes few direct strand breaks (P¯aum et al., 1998). (iii)
CHO cells were irradiated with UVC (1 J/m2) to induce pyrimidine dimers.
Before and after irradiation, they were incubated (in growth medium) with 2
mM hydroxyurea and 0.1 mM 1-b-D-arabinofuranosylcytosine (araC) (Sigma)
for 30 min at 37°C.
After treatment, CHO cells were removed from the culture dish by light
trypsinization, centrifuged and suspended in PBS. Lymphocytes were
centrifuged and resuspended in PBS. Concentrations of cells were adjusted
so that, after a ®nal centrifugation, the pellet could be taken up in 1% low
melting point agarose (Gibco BRL) in PBS at 37°C to give ~2 3 104 cells in 85
ml.
The comet assay (single cell alkaline gel electrophoresis)
Plain glass microscope slides were precoated by dipping in a solution of 1%
normal electrophoresis grade agarose (Gibco BRL) in distilled water and
drying. Cells in 85 ml of agarose at 37°C were placed on a precoated slide
followed by a glass coverslip. Gels were left to set at 4°C and then, after
removing the coverslips, placed in lysis solution (2.5 M NaCl, 0.1 M
Na2EDTA, 10 mM Tris brought to pH 10.0 with NaOH, plus 1% Triton X-100)
270
for 1 h at 4°C. Slides with cells that had been treated with photosensitizer plus
visible light to induce oxidized bases were washed three times for 5 min in
enzyme buffer (40 mM HEPES, 0.1 M KCl, 0.5 mM EDTA, 0.2 mg/ml bovine
serum albumin, pH 8.0 with KOH) and incubated for 30 min with FPG at 37°C.
This converts 8-oxoguanine residues to strand breaks. All slides were then
placed in an electrophoresis tank and immersed in 0.3 M NaOH, 1 mM
Na2EDTA for 40 min, before electrophoresis at 25 V (0.8 V/cm) for 30 min at
an ambient temperature of 4°C. After electrophoresis, slides were neutralized
by washing three times for 5 min with 0.4 M Tris±HCl, pH 7.5. Comets were
analysed for total DNA content by staining with DAPI (1 mg/ml) for
¯uorescence microscopy, using a CCD COHU solid state camera and image
analysis software Komet 3.0 (Kinetic Imaging, Liverpool, UK).
Fluorescent in situ hybridization combined with comets
In parallel with the standard comet assay analysis, duplicate slides were
prepared for FISH. Slides were immersed for 25±30 min in absolute ethanol at
4°C and then in 0.5 M NaOH for 25 min to ensure complete denaturation of
DNA. Slides were dehydrated in 70, 80 and 95% ethanol for 5 min each.
Speci®c DNA probes were designed for coding sequences close to the 5¢- and
3¢-ends of the CHO DHFR gene, the CHO MGMT gene and the human p53
gene as follows (all purchased from Sigma-Genosys, Cambridge, UK). DHFR:
exon 1, bases 38±63, 5¢-AGAATATGGGCATCGGCAAGAACGGA, labelled
5¢ with biotin; exon 6, bases 533±558, 5¢-ATAAATTTGAAGTCTATGAGAAGAAA, labelled 5¢ with ¯uorescein. MGMT: bases 8±33, 5¢AGACCTGCAAAATGAAATACACAGTG, labelled 5¢ with biotin; bases
463±488, 5¢-AGTAACGGCAGCATTGGTAATTACTC, labelled 5¢ with
¯uorescein. p53: exon 2, bases 38±63, 5¢-TCTGAGTCAGGAAACATTTTCAGACC, labelled 5¢ with biotin; exon 11, bases 38±63, 5¢-ATAAAAAACTCATGTTCAAGACAGAA, labelled 5¢ with ¯uorescein.
Oligonucleotides as supplied (between 240 and 600 mg) were redissolved in
1 ml of TE buffer (10 mM Tris±HCl, pH 7.4, 1 mM EDTA) and 10 ml aliquots
(stored at ±20°C) diluted 1503 in TE buffer for use. Equal volumes of the two
probes for one gene were mixed, a total of 30 ml was pipetted onto each gel and
covered with a plastic coverslip cut from overhead transparency ®lm.
Hybridization was performed at 37°C in a humid chamber for 72 h (88 h in
the case of p53).
After hybridization, slides were washed in 23 SSC for 5 min at 42°C, in 50%
23 SSC/50% formamide (Sigma) for 5 min at 42°C, twice in 23 SSC for 5 min
at room temperature and, ®nally, rinsed with 43 SSC/0.05% Tween 20
(Sigma). Development of immuno¯uorescent signals involved two cycles of an
antibody cascade of Texas red±avidin DCS (A1) and biotinylated anti-avidin D
(A2) (Vector Laboratories, Peterborough, UK), to detect biotin-labelled
oligonucleotides, and rabbit anti-¯uorescein (F1) and ¯uorescein-conjugated
donkey anti-rabbit (F2) (Cambio, Cambridge, UK), to detect ¯uoresceinlabelled oligonucleotides, as follows [dilutions in 43 SSC/0.05% Tween 20
with blocking protein (Cambio) at 15%]: (i) 30 ml A1 (1:400); (ii) 15 ml A2
(1:50) + 15 ml F1 (1:125), premixed; (iii) 15 ml A1 (1:200) + 15 ml F2 (1:250),
premixed; (iv) 15 ml A2 (1:50) + 15 ml F1 (1:125), premixed; (v) 15 ml A1
(1:200) + 15 ml F2 (1:250), premixed. At each stage, slides were incubated for
30 min at 37°C in a humid box and between stages they were washed three
times for 4 min in 43 SSC/0.05% Tween 20. After a ®nal three washes they
were air dried.
Slides were incubated for 10 min in distilled water before counterstaining
with 30 ml of DAPI, diluted in H2O with Vectashield antifade mountant (Vector
Laboratories). Fluorescence microscopy was performed at 633 magni®cation
on a ¯uorescence microscope (Leica DMR, Wetzlar, Germany) equipped with
®lters for observation of DAPI (blue), Texas red (red) and ¯uorescein (green).
Images were captured using a Hamamatsu colour chilled 3CCD camera linked
to a computer. Image-Pro Plus version 4.0 (Media Cybernetics, Silver Spring,
MD) was used to capture and process the images. Colour and contrast were
adjusted using Photoshop (Adobe, San Jose, CA).
Results
The genes studied were: DHFR (Chinese hamster), length 31
kb, 564 bases expressed in six exons; MGMT (Chinese
hamster), length 200 kb, 630 bases; p53 (human), length 20
kb, 2629 bases expressed in 11 exons.
Oligonucleotide probes were designed to be complementary
to sequences in 5¢ and 3¢ terminal exons of each gene and endlabelled with biotin and ¯uorescein, respectively. After
hybridization with comet DNA for 3 days or more at 37°C,
as described in Materials and methods, oligonucleotides were
detected by incubation with avidin±Texas red followed by
biotinylated anti-avidin to reveal the biotin-labelled probes,
Gene-speci®c DNA repair
and incubation with rabbit anti-¯uorescein followed by
¯uorescein-conjugated donkey anti-rabbit antibodies to detect
¯uorescein-labelled probes.
Localization of the DHFR gene within comet DNA of CHO
cells
CHO cells were treated with H2O2 to introduce DNA strand
breaks, embedded in agarose on a microscope slide, lysed,
treated with alkali and electrophoresed to produce `comets'. To
estimate the extent of DNA damage, some slides were stained
with DAPI for ¯uorescence microscopy. The percentage DNA
in the tail of 50 randomly selected comets was estimated by
computer image analysis. In a typical experiment, the H2O2
produces on average ~50% DNA in the tail. Other slides were
set up for hybridization with the speci®c oligonucleotides.
These slides were counterstained with DAPI so that the red and
green signals from the oligonucleotides could be visualized
against the head or tail of the comets. Figure 1A shows a
typical image, with red and green spots clearly visible. In
almost all the comets examined, the spots were present only in
the head of the comet. The average numbers of spots per comet
are recorded in Table I. As a control, strand breaks were
introduced in a different way, by irradiating CHO cells with
UVC and incubating them with hydroxyurea and araC to block
repair synthesis and accumulate incomplete repair sites as
DNA breaks. A similar pattern of FISH signals exclusively in
the comet head was recorded (Table I).
Localization and repair of the CHO MGMT gene
CHO cells were damaged either with H2O2 or with the
photosensitizer Ro 19-8022 and visible light to induce oxidized
bases and incubated for different times (depending on the type
of damage) to allow repair. In the subsequent comet assay,
those slides prepared from Ro 19-8022-treated cells were
incubated with FPG to make breaks at sites of 8-oxoguanine.
Thus the removal of damage (frank strand breaks or FPGsensitive sites) was monitored by following the decrease in
percent DNA in the tail with time of incubation (Figure 2,
broken lines). H2O2-induced damage was repaired rapidly
(Figure 2A, open squares); within 20 min almost all breaks
were rejoined. Base excision repair is a slower process, as
Figure 2B illustrates. Parallel slides from these experiments
were hybridized with the oligonucleotide probes to the 5¢ and 3¢
terminal exons of the MGMT gene. In contrast to what was seen
with the DHFR probes, signals now appeared over tail DNA,
although these were predominantly green spots of ¯uorescein
label; Texas red signals were mostly found in the head. Fifty
comets were scored, recording the occurrence of Texas red and
¯uorescein signals in head and tail. These data are plotted in
Figure 2 (solid lines) as percentages of red or green spots in the
tail, so that the rate of repair of DNA containing the MGMT
gene can be compared directly with that of total DNA. In the
H2O2-treated cells, restoration of green spots to head DNA
occurred as rapidly as the repair of total DNA (Figure 2A and
Table I). After Ro 19-8022 + light treatment, it appears that
repair of FPG-sensitive sites in the DNA containing MGMT is
non-existent during the ®rst hour and then rapid (Figure 2B and
Table I).
Localization and repair of the DHFR gene in comets of
human cells
The DHFR oligonucleotide probes made for hybridization with
CHO DNA had suf®cient homology to be used also in
experiments with comets from human lymphocytes. In this
Fig. 1. Examples of DAPI-stained comet images from H2O2-treated cells,
with ¯uorescein and Texas red signals indicating the location of speci®c
genes. In each, the tail of the comet is to the right. (A) CHO cells, with
DHFR probes; (B) lymphocytes, with DHFR probes; (C) lymphocytes, after
repair incubation for 20 min, with p53 probes. The white bar represents
10 mm. Hybridization signals are indicated by arrows.
271
E.HorvaÂthova et al.
Table I. Detection of oligonucleotides with ¯uorescein- or Texas red-labelled antibodies in comets from cells treated with H2O2, Ro 19-8022 (Ro) or UVC,
as indicated
Treatment
Experiment
Time
Mean number of signals
Fluorescein (green)
DHFR CHO H2O2
DHFR CHO UV
MGMT CHO H2O2
MGMT CHO Ro + light
DHFR human H2O2
DHFR human Ro + light
p53 human H2O2
1
2
1
1
2
1
2
1
2
1
2
1
2
1
2
1
2
1
2
1
2
0
0
20 min
30 min
0
0
20 min
20 min
0
0
1h
1h
2h
2h
0
0
4h
4h
0
4h
0
0
20 min
20 min
Texas red
Head
Tail
Total
Head
Tail
Total
3.60
2.36
2.78
3.60
2.08
2.10
2.80
2.78
3.38
3.16
2.16
2.30
2.98
2.72
2.14
2.20
2.70
2.88
1.98
2.90
1.06
1.04
2.06
2.08
0
0.08
0
0
0.98
0.90
0.10
0.10
1.12
1.12
0.82
0.80
0.20
0.18
1.94
1.94
0.08
0.06
0.48
0.02
0.96
1.04
0.02
0.04
3.60
2.44
2.78
3.60
3.06
3.00
2.90
2.88
4.50
4.28
2.98
3.10
3.18
2.90
4.08
4.14
2.78
2.94
2.46
2.92
2.02
2.08
2.08
2.12
3.04
1.96
1.60
2.82
1.44
1.40
1.64
1.76
2.90
2.98
1.92
1.96
1.62
1.72
2.24
2.30
2.68
2.80
1.94
1.88
1.22
1.28
1.88
1.86
0.02
0
0
0
0.02
0.06
0
0
0
0
0.22
0.24
0
0.02
0.86
0.92
0.04
0.06
0.28
0
0.76
0.76
0
0
3.06
1.96
1.60
2.82
1.46
1.46
1.64
1.76
2.90
2.98
2.14
2.20
1.62
1.74
3.10
3.22
2.72
2.86
2.22
1.88
1.98
2.04
1.88
1.86
Cells were incubated for between 0 and 4 h. In the case of the UVC-treated CHO cells, hydroxyurea and araC were present during the incubation. Numbers of
signals detected per cell are given as mean values from (in almost all cases) 50 comets scored. Independent experiments in each section of the table are
indicated by different numbers in the column headed Experiment.
case, hybridization signals appeared in both head and tail DNA
(Figure 1B). To examine repair, cells were incubated for 4 h
after both H2O2 and Ro 19-8022 + light treatment, since
rejoining of strand breaks is known to be slower in
lymphocytes than in cultured cells (Collins et al., 1995), and
Figure 3A con®rms this; only about half of the strand breaks
were repaired in that time. However, DNA containing the
DHFR gene damaged with either agent is repaired completely
in 4 h (Figure 3A and B and Table I).
Localization and repair of the human p53 gene
Finally, we examined damage and repair of DNA containing
the p53 gene in human lymphocytes treated with H2O2. Red
and green signals were almost equally distributed between the
head and tail of comets from cells taken immediately after
H2O2 treatment (Table I). After only 20 min incubation of cells
to allow repair to occur, virtually all p53 probes were located in
the comet heads, indicating complete repair, while total DNA
had been repaired to only a small extent in that time (Figures
1C and 4 and Table I).
Discussion
Comets with FISH
The combination of FISH with the comet assay was ®rst
reported by Santos et al. (1997). Telomere- and centromerespeci®c probes were hybridized to the DNA of comets from
human lymphocytes. In addition, Santos et al. probed three
segments of the human MGMT gene, which typically appeared
in a tandem array. McKelvey-Martin et al. (1998) hybridized
p53 sequences as well as chromosome-speci®c probes.
272
Applying 12 different chromosome painting probes to human
lymphocyte comets, Rapp et al. (2000) investigated the
differential sensitivity of DNA to breakage following UVA
irradiation and found an inverse relationship between the
density of active genes in the chromosome (as indicated by
expressed sequence tags) and the level of DNA breakage.
Our experiments were based on the following model.
(i) If two (red and green) spots appear in the head of a comet,
this indicates that the gene is in an undamaged region of DNA.
(ii) The appearance of red and green signals in the tail of a
comet indicates that a break has occurred in the proximity of
the gene. According to our model of comet formation,
supercoiling has been relaxed in the loop of DNA containing
the gene.
(iii) In principle, if the distance between the two sites of
hybridization is small relative to the length of the comet
tail and the gene is found in the tail, it should be possible
to determine whether breakage has occurred in the DNA
between the sites (in which case the two spots would be
separated by a distance greater than the distance separating
them in intact DNA) or in the DNA of the loop enclosing
the gene (in which case the normal separation would be
seen). However, breakage between the probed points of the
gene will then be a very rare event, since we are applying
low levels of damage to a small target. In the present work, we
have simply analysed whether the probe labels are in the head
or tail of the comet and information we collect on relative
damage and repair rates refers to the segment of DNA
containing the gene and forming a unit of supercoiling and of
comet tail structure.
Gene-speci®c DNA repair
Fig. 2. Repair of total DNA and the MGMT gene in CHO cells during
incubation after treatment with H2O2 (A) or Ro (Ro 19-8022) + light (B). In
(B) nucleoids were digested with FPG to introduce breaks at 8-oxoguanines.
Broken lines represent total DNA; circles, untreated control; squares, treated
with damaging agent. Solid lines represent label attached to the MGMT
gene; triangles, ¯uorescein; inverted triangles, Texas red. Mean values from
two experiments are shown. Bars represent the range of mean values of
percentage DNA in the tail for the two experiments; replicate data for
speci®c gene damage appear in Table I.
Fig. 3. Repair of total DNA and the DHFR gene in human lymphocytes
during incubation after treatment with H2O2 (A) (two experiments; means
and range indicated as in Figure 2) or with Ro (Ro 19-8022) + light (B)
(single experiment). In (B) nucleoids were digested with FPG to introduce
breaks at 8-oxoguanines. Broken lines represent total DNA; circles, untreated
control; squares, treated with damaging agent. Solid lines represent label
attached to the DHFR gene; triangles, ¯uorescein; inverted triangles,
Texas red.
It is useful at this point to relate the sizes of the genes studied
here to the dimensions of the comet. The DHFR gene, at 31 kb,
corresponds to an extended length of ~10 mm. [The vertical rise
Ê . DNA in the comet head
per base pair in B form DNA is 3.38 A
is double-stranded (Collins et al., 1997). In the tail, it is singlestranded, but it is not known whether it is fully extended or
tangled.] The measured distance between red and green spots
in Figure 1A is consistent with these dimensions. The diameter
of the head of a comet from a moderately damaged cell is
typically ~20 mm and the length of a tail is ~60 mm. p53 is
smaller, while the MGMT gene is 6.5 times as long as the
DHFR gene, and comparable with the length of the comet tail.
the tail should be a direct function of the number of DNA
breaks present. Thus, if on average (in a population of comets)
50% of total DNA is in the tail, then we would expect 50% of
the copies of a particular gene to be located in the tail. We were
therefore initially surprised to ®nd virtually no DHFR labels in
the tails of CHO comets damaged with H2O2, nor when breaks
were accumulated by allowing incision without ligation after
UV irradiation. It is unlikely that the DHFR-containing DNA
region is extraordinarily resistant to damage by these disparate
agents. However, it is known that in CHO cells there is a
scaffold- or matrix-associated region of DNA (SAR or MAR)
in the middle of this gene (Kas and Chasin, 1987). SAR/MARs
are identi®ed by co-localization with the nuclear scaffold or
matrix during isolation with high salt or lithium diiodosalicylate, respectively. They cannot be unequivocally identi®ed on
the basis of sequence consensus. In the comet assay, cells are
Distribution of gene-speci®c signals between head and tail
Neglecting possible differences in sensitivity of regions of
DNA to damage, the probability that a particular gene will be in
273
E.HorvaÂthova et al.
lysed with high salt and Triton X-100, a procedure resembling
that used to produce nuclear matrices. Tenacious attachment of
SAR/MARs to the matrix through the later stages of the comet
assay (alkaline treatment and electrophoresis) might explain
the inability of the DHFR gene to leave the comet head even
when the DNA is released from its supercoiling. In the case of
the MGMT gene, the Texas red label was almost always in the
comet head, but the ¯uorescein label did appear in the tail,
consistent with the presence of a SAR/MAR near the 5¢-end of
the gene, though we have no independent evidence that this is
Fig. 4. Repair of total DNA and the p53 gene in human lymphocytes treated
with H2O2. Repair is indicated by the decrease in percentage tail DNA as
cells are incubated. Broken lines represent total DNA; circles, untreated
control; squares, treated with damaging agent. Solid lines represent label
attached to the p53 gene; triangles, ¯uorescein; inverted triangles, Texas red.
Mean values from two experiments, with bars representing range, as in
Figure 2.
the case. (The MGMT gene is suf®ciently long that the 3¢-end
would be effectively free of a restraint imposed on the 5¢-end.)
On the basis of the appearance of both labels of the p53 gene
and of the DHFR gene in the tail of human lymphocytes, since
both genes are short, it seems that in these cells they are not
associated with SAR/MARs. Figure 5 incorporates SAR/
MARs in the model.
The signi®cance of SAR/MARs in vivo is disputed. They
may simply be regions that associate with DNA-binding
proteins such as topoisomerases and enzyme complexes
involved in replication or transcription, becoming incorporated
into the matrix (a structure not demonstrated to exist in vivo)
during isolation (Hancock, 2000). A more physiological
extraction method developed by Jackson et al. (1993) showed
the retention of transcribing and replicating DNA at foci in a
residual nuclear structure. DNA and RNA polymerases are
immobilized in so-called replication and transcription factories, through which the DNA passes (Jackson et al., 1993; Cook,
1999). The association of the DHFR and MGMT genes in CHO
cells with the comet head may thus re¯ect involvement of the
DNA in transcription. In the model of Cook (1999), the DNA is
attached to the factory upstream of the promoter of an active
gene, consistent with the localization of the Texas red signal,
indicating the 5¢-end of the MGMT gene, in the head of the
comet. A further possibility is that the damaged DNA is
brought to the matrix for repair, so that the rapid relocalization
of the p53 gene to the comet head may indicate that repair is in
progress rather than completed.
Gene copy number and size
Although two alleles per cell were identi®ed by the
oligonucleotide probes for p53, as expected for lymphocytes
in G1, there was a tendency for higher numbers of spots to be
seen with the DHFR probes (Table I), perhaps indicating the
presence of DHFR pseudogenes (Anagnou et al., 1988). CHO
cells are aneuploid, and also proliferating, so the number of
Fig. 5. Diagrammatic representation of DNA in a comet. Four extended, relaxed DNA loops are shown forming a comet tail. They are relaxed because a break
is present somewhere in the loop. Loops are anchored to the nuclear matrix (indicated by the net of light grey lines). DNA loops with intact DNA remain
supercoiled and within the head (indicated by the two tangles). The p53 gene is wholly in the tail. The DHFR gene is held close to the matrix by the presence
of a MAR/SAR. It is speculated that a MAR/SAR is also present in the MGMT gene, near one end, which is held in the head, while the other end extends into
the tail.
274
Gene-speci®c DNA repair
gene copies per cell is unpredictable. Sometimes we found
fewer Texas red than ¯uorescein-labelled spots; either the
ef®ciency of hybridization varied for the different oligonucleotide probes or the antibody cascade did not always reach
suf®cient intensity of ¯uorescence for detection.
A point to emphasize is the low level of damage that we
are able to investigate. A comet with 50% of DNA in the
tail corresponds to a strand break frequency of 1.6 per 109 Da
or ~0.5 per 103 kb, according to a calibration carried out
with X-rays (Collins et al., 1996). Statistically, very few
comets analysed will have breaks within the DHFR or
p53 gene, but the gene will appear in the tail if the DNA
loop within which it lies is relaxed by a strand break. Even
in the case of the larger MGMT gene, breaks within the gene
itself are infrequent at the levels of damage we study. The
different rates of repair that we observe apply not to the
individual genes, but to the DNA loops, or units of supercoiling, containing the genes.
Differential rates of DNA repair
Conventional studies of gene-speci®c repair have been directed
at the level of restriction fragments of the gene of interest and
with such a small target, high levels of damage must be
in¯icted to ensure that almost all restriction fragments contain
a lesion. Typically, a dose of 10 J/m2 is administered (Mellon
et al., 1986). A mechanism for preferential repair of transcribing DNA has been proposed (Hanawalt, 2001); the transcription complex stalls at sites of UV damage and this leads to
recruitment of proteins to the complex which carry out repair
and allow transcription to resume. Recent work with oxidative
damage (LePage et al., 2000) has shown transcribed strandspeci®c removal of oxidized bases in human cells. Thymine
glycol was induced by treatment of cells with10 mM H2O2 and
8-oxoguanine was presented to cells by transfection with a
shuttle vector. The vector was constructed in alternative forms,
with or without promoters, to control whether it was transcribed or not in the host cells. Cockayne syndrome cells
lacking TCR were unable to remove 8-oxoguanine from the
shuttle vector when it was transcribed, although they repaired it
pro®ciently in the absence of transcription. Thus it seems that
TCR is a process that releases the stalled RNA polymerase II
from the lesion site and allows repair to proceed, a subtly
different explanation from that developed from the experiments with UV.
The use of high (generally supra-lethal) doses of damage to
investigate gene-speci®c repair rates raises the question of
whether the ®ndings of TCR apply under normal circumstances
or whether they represent a response to extreme conditions.
Use of the comet assay here imposes the opposite limitation; it
is so sensitive that we cannot work above rather low doses of
damaging agent, 1 J/m2 UV or 200 mM H2O2. Since the
formation of a comet depends on relaxation of DNA loops, the
information we obtain on differential rates of repair relates to
the domain containing the labelled gene, i.e. the DNA loop,
rather than the speci®c gene. The MGMT gene (equivalent
to about half a loop in length) is in a section of DNA that
shows relatively rapid repair of oxidized bases. Strand breaks
induced by H2O2 in or near the p53 gene are repaired very
quickly compared with total DNA, in agreement with
McKenna et al. (2003), also using FISH with the comet
assay, who reported that the p53 domain was preferentially
repaired after g-irradiation.
Conclusions
Repair rates of genes located in different segments of the
genome are likely to differ, whether because they are being
transcribed or for other reasons connected with sequence or
location. We describe a novel approach to the analysis of repair
rates of speci®c genes after low doses of damage. We ®nd that
CHO cells show preferential repair of oxidized bases in the
MGMT gene, although only after a delay. Strand breaks in the
human p53 gene are repaired very quickly compared with total
DNA. This approach can be applied to other genes treated with
a range of damaging agents. An intriguing possibility is that,
using very long genes such as DMD, the dystrophin gene (2400
kb or ~1 mm in length, with 79 exons), it will be possible to
compare rates of repair of damage in different regions of the
gene by the use of probes for selected pairs of exons.
In addition to providing information about differential repair
rates, the comet assay with FISH can help with the analysis of
gene organization and repair in relation to the structure of the
nucleus. At the beginning of this discussion we reasoned that
the appearance of signals in the comet head indicates that the
gene is in an undamaged region of DNA. This supposition
requires quali®cation. Certain genes (or parts of genes) remain
in the head even when there is a DNA break nearby and it is
likely that this af®nity with the head re¯ects either the presence
of a SAR/MAR in (or near) the gene or involvement of the gene
in transcription.
Acknowledgements
We thank Lawrence Chasin, Geoff Margison and Miroslav PirsÏel for helpful
comments and discussions and Leif Hunter and Pat Bain for excellent technical
assistance. Experimental work carried out at the Rowett Research Institute was
funded by the Scottish Executive Environment and Rural Affairs Department.
E.HorvaÂthova was supported by a fellowship from the International Agency for
Research on Cancer. Sergey Shaposhnikov was the recipient of a FEBS Short
Term Fellowship.
References
Anagnou,N.P., Antonarakis,S.E., O'Brien,S.J., Modi,W.S. and Nienhuis,A.W.
(1988) Chromosomal localization and racial distribution of the polymorphic
human dihydrofolate reductase pseudogene (DHFRP1). Am. J. Hum. Genet.,
42, 345±352.
Bohr,V.A., Smith,C.A., Okumoto,D.S. and Hanawalt,P.C. (1985) DNA repair
in an active gene: removal of pyrimidine dimers from the DHFR gene of
CHO cells is much more ef®cient than in the genome overall. Cell, 40, 359±
369.
Collins,A.R. and DusÏinskaÂ,M. (2002) Oxidation of cellular DNA measured
with the comet assay. In Armstrong,D. (ed.), Methods in Molecular Biology,
Vol. 186: Oxidative Stress Biomarkers and Antioxidant Protocols. Humana
Press, Totowa, NJ, pp. 147±159.
Collins,A.R. and HorvaÂthovaÂ,E. (2001) Oxidative DNA damage, antioxidants
and DNA repair: applications of the comet assay. Biochem. Soc. Trans., 29,
337±342.
Collins,A.R., Ma,A. and Duthie,S.J. (1995) The kinetics of repair of oxidative
DNA damage (strand breaks and oxidised pyrimidines) in human cells.
Mutat. Res., 336, 69±77.
Collins,A.R., DusÏinskaÂ,M., Gedik,C.M. and SÏteÏtina,R. (1996) Oxidative
damage to DNA: do we have a reliable biomarker? Environ. Health
Perspect., 104 (Suppl. 3), 465±469.
Collins,A.R., Dobson,V.L., DusÏinskaÂ,M., Kennedy,G. and SÏteÏtina,R. (1997)
The comet assay: what can it really tell us? Mutat. Res., 375, 183±193.
Cook,P.R. (1999) The organization of replication and transcription. Science,
284, 1790±1795.
Cook,P.R., Brazell,I.A. and Jost,E. (1976) Characterization of nuclear
structures containing superhelical DNA. J. Cell Sci., 22, 303±324.
Frankenberg-Schwager,M. (1989) Review of repair kinetics for DNA damage
induced in eukaryotic cells in vitro by ionizing radiation. Radiother. Oncol.,
14, 307±320.
Hanawalt,P.C. (2001) Controlling the ef®ciency of excision repair. Mutat.
Res., 485, 3±13.
275
E.HorvaÂthova et al.
Hancock,R. (2000) A new look at the nuclear matrix. Chromosoma, 109, 219±
225.
Jackson,D.A., Hassan,A.B., Errington,R.J. and Cook,P.R. (1993) Visualization
of focal sites of transcription within human nuclei. EMBO J., 12, 1059±
1065.
Kas,E. and Chasin,L.S. (1987) Anchorage of the Chinese hamster
dihydrofolate reductase gene to the nuclear scaffold occurs in an
intragenic region. J. Mol. Biol., 198, 677±692.
LePage,F., Kwoh,E.E., Avrutskaya,A., Gentil,A., Leadon,S.A., Sarasin,A. and
Cooper,P.K. (2000) Transcription-coupled repair of 8-oxoguanine:
requirement for XPG, TFIIH and CSB and implications for Cockayne
syndrome. Cell, 101, 159±171.
Madhani,H.D., Bohr,V.A. and Hanawalt,P.C. (1986) Differential DNA repair
in transcriptionally active and inactive proto-oncogenes: c-abl and c-mos.
Cell, 45, 417±423.
McKelvey-Martin,V.J., Ho,E.T.S., McKeown,S.R., McCarthy,P.J., Rajab,N.F.
and Downes,C.S. (1998) Emerging applications of the single cell gel
electrophoresis (comet) assay. I. Management of invasive transitional cell
human bladder carcinoma. II. Fluorescent in situ hybridization comets for
the identi®cation of damaged and repaired DNA sequences in individual
cells. Mutagenesis, 13, 1±8.
McKenna,D.J., Rajab,N.F., McKeown,S.R., McKerr,G. and McKelveyMartin,V.J. (2003) Use of the comet-FISH assay to demonstrate repair of
the TP53 gene region in two human bladder carcinoma cell lines. Radiat.
Res., 159, 49±56.
Mellon,I., Bohr,V.A., Smith,C.A. and Hanawalt,P.C. (1986) Preferential DNA
repair of an active gene in human cells. Proc. Natl Acad. Sci. USA, 83,
8878±8882.
Mellon,I., Spivak,G. and Hanawalt,P.C. (1987) Selective removal of
transcription-blocking DNA damage from the transcribed strand of the
mammalian DHFR gene. Cell, 51, 241±249.
P¯aum,M., Will,O., Mahler,H.-C. and Epe,B. (1998) DNA oxidation products
determined with repair endonucleases in mammalian cells: types, basal
levels and in¯uence of cell proliferation. Free Radic. Res., 29, 585±594.
Rapp,A., Bock,C., Dittmar,H. and Greulich,K.-O. (2000) UV-A breakage
sensitivity of human chromosomes as measured by COMET-FISH depends
on gene density and not on the chromosome size. J. Photochem. Photobiol.
B Biol., 56, 109±117.
Santos,S.J., Singh,N.P. and Natarajan,A.T. (1997) Fluorescence in situ
hybridization with comets. Exp. Cell Res., 232, 407±411.
Taffe,B.G., Larminat,F., Laval,J., Croteau,D.L., Anson,R.M. and Bohr,V.A.
(1996)
Gene-speci®c
nuclear
and
mitochondrial
repair
of
formamidopyrimidine DNA glycosylase-sensitive sites in Chinese hamster
ovary cells. Mutat. Res., 364, 183±192.
Received on March 7, 2003; revised on March 22, 2004;
accepted on March 25, 2004
276