Am J Physiol Regul Integr Comp Physiol 307: R44–R56, 2014.
First published April 9, 2014; doi:10.1152/ajpregu.00186.2013.
Gene expression and localization of two types of AQP5 in Xenopus tropicalis
under hydration and dehydration
Yuki Shibata,1 Takahiro Sano,2 Nobuhito Tsuchiya,2 Reiko Okada,1,2 Hiroshi Mochida,3
Shigeyasu Tanaka,1,2 and Masakazu Suzuki1,2
1
Integrated Bioscience Section, Graduate School of Science and Technology, Shizuoka University, Shizuoka, Japan;
and 2Department of Biological Science, Graduate School of Science, Shizuoka University, Shizuoka, Japan; and 3Protein
Purify, Gunma, Japan
Submitted 16 April 2013; accepted in final form 6 April 2014
WATER CHANNELS, CALLED AQUAPORINS
(AQPs), play important
roles in water homeostasis and various physiological processes. AQPs are a class of integral membrane proteins that
form a selective water pore in the plasma membrane of various
cells of animals, plants, and microorganisms (2, 47). Thirteen
isoforms of AQPs (AQP0 –AQP12) are identified in mammals
and categorized into three subfamilies: classical AQPs, aquaglyceroporins, and unorthodox AQPs (22). Classical AQPs,
e.g., AQP2 and AQP5, conduct only water, whereas aquaglyceroporins, e.g., AQP3 and AQP7, transport not only water but
also small uncharged solutes, such as glycerol and urea. Unorthodox AQPs, comprising AQP11 and AQP12, are so called
because of their deviated amino acid sequences. On the other
hand, anurans possess additional anuran-specific AQPs: i.e.,
AQPa1 and AQPa2 (The letter “a” represents “anuran”) (39,
Address for reprint requests and other correspondence: M. Suzuki, Dept.
of Biological Science, Graduate School of Science, Shizuoka Univ., 836,
Ohya, Suruga-ward, Shizuoka-city, Shizuoka 422-8529, Japan (e-mail:
[email protected]).
R44
41). AQPa2 is further subdivided into urinary bladder type
(type 2) and ventral skin-type (type 3) (40, 41). Each AQP
shows unique localization in the tissues and cells, therein
permitting specific water influx and efflux. AQP5, a classical
AQP, is expressed in various mammalian exocrine glands,
including the sweat gland, lacrimal gland, salivary gland, and
pyloric gland (42). At the cellular level, AQP5 is detected in
either the apical or apical/basolateral membranes of the particular
glandular cells, and plays a role in the secretion of water (42).
For anuran amphibians, an AQP5 homologue, AQP-x5, was
identified in Xenopus laevis, and localized to the skin glands
(26). The major skin glands of amphibians are divided into two
types: the granular gland (also called the serous gland or poison
gland) and the mucous gland (33, 45). The granular glands
protect the body by producing a wide variety of biologically
active substances, e.g., toxic amines, antimicrobial peptides,
and toxic alkaloids (7, 13, 31). On the other hand, the mucous
glands produce a mixture of glycopeptides, such as neutral,
sialic, and sulfated mucins (11, 12, 38). The water included in
the secreted fluid, especially from the mucous glands, aids in
maintenance of a moist skin, cutaneous gas exchange, and
thermoregulation (6, 28). Another two glands are observed in
the X. laevis skin: the small granular (granulated) gland and the
NP gland in the nuptial pad of the male forelimb (17). Immunohistochemistry and immunoelectron microscopy with an
antibody raised against AQP-x5 revealed that AQP-x5 is present in the apical plasma membrane of acinar cells of the small
granular glands (30).
Whereas AQP-x5 is the only AQP5 homologue whose
cDNA was obtained from X. laevis, molecular phylogenetic
analysis previously indicated the presence of two types of aqp5
in Xenopus tropicalis (40) (Ensembl, http://www.ensembl.org/
index.html). In the present study, we first cloned cDNA encoding an anuran homologue of AQP5 in X. tropicalis (AQPxt5a: Ensembl ENSXETG00000024580) because the nucleotide sequence of mRNA or EST was not determined for this
gene. The relationships among AQP5 homologues were then
examined utilizing the sequence data of 95 AQPs from mammals
to fish. Immunohistochemical analysis was further carried out to
elucidate the physiological roles of AQP-xt5a and AQP-xt5b
(ENSXETG00000020388; accession no. NM_001015749; 25)
under hydrated and dehydrated conditions.
MATERIALS AND METHODS
Animals, sampling, and plasma analysis. Male tropical clawed frogs,
X. tropicalis, were kept in freshwater at 25°C, and fed commercial
trout pellets. The animals were 4.5– 6.0 cm long (body length) and
weighed 11–26 g. Before sampling, the animals were anesthetized
0363-6119/14 Copyright © 2014 the American Physiological Society
http://www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
Shibata Y, Sano T, Tsuchiya N, Okada R, Mochida H, Tanaka
S, Suzuki M. Gene expression and localization of two types of AQP5
in Xenopus tropicalis under hydration and dehydration. Am J Physiol
Regul Integr Comp Physiol 307: R44 –R56, 2014. First published
April 9, 2014; doi:10.1152/ajpregu.00186.2013.—Two types of aquaporin 5 (AQP5) genes (aqp-xt5a and aqp-xt5b) were identified in the
genome of Xenopus tropicalis by synteny comparison and molecular
phylogenetic analysis. When the frogs were in water, AQP-xt5a
mRNA was expressed in the skin and urinary bladder. The expression
of AQP-xt5a mRNA was significantly increased in dehydrated frogs.
AQP-xt5b mRNA was also detected in the skin and increased in
response to dehydration. Additionally, AQP-xt5b mRNA began to be
slightly expressed in the lung and stomach after dehydration. For the
pelvic skin of hydrated frogs, immunofluorescence staining localized
AQP-xt5a and AQP-xt5b to the cytoplasm of secretory cells of the
granular glands and the apical plasma membrane of secretory cells of
the small granular glands, respectively. After dehydration, the locations of both AQPs in their respective glands did not change, but
AQP-xt5a was visualized in the cytoplasm of secretory cells of the
small granular glands. For the urinary bladder, AQP-xt5a was observed in the apical plasma membrane and cytoplasm of a number of
granular cells under normal hydration. After dehydration, AQP-xt5a
was found in the apical membrane and cytoplasm of most granular
cells. Injection of vasotocin into hydrated frogs did not induce these
changes in the localization of AQP-xt5a in the small granular glands
and urinary bladder, however. The results suggest that AQP-xt5a
might be involved in water reabsorption from the urinary bladder
during dehydration, whereas AQP-xt5b might play a role in water
secretion from the small granular gland.
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
R45
with ethyl m-aminobenzoate methanesulfonate (Nacalai tesque,
Kyoto, Japan). The blood was collected from the heart, and the plasma
was separated by centrifugation and stored at ⫺25°C. Plasma osmolality was measured by freeze point depression osmometry (Vogel
98
55
50
67
100
100
98
82
100
100
100
100
76
100
100
54
79
100
AQP5a
AQP5
Xenopus tropicalis AQP-xt5b(AQP2): ENSXETG00000020388
Xenopus laevis AQP-x5(b): AB250090
Human AQP2: ENSG00000167580
Quail AQP2: AY430098
Anole lizard AQP2: ENSACAG00000008441
Hyla chysoscelis HC-2: DQ364244
Hyla japonica AQP-h2K: AB295642
Hyla japonica AQP-h2: AB107014
Bufo marinus AQP-t2: AF020621
Xenopus tropicalis AQP-xt2: ENSXETG00000024581
Hyla japonica AQP-h3: AB073316
Bufo marinus AQP-t3: AF020622
Bufo japonicus AQP3: AB500708
Rana japonica AQP3: AB500706
Rana catesbeiana AQP3: AB500705
AQP5b
AQP2
AQPa2
Fig. 2. Phylogenetic relationships among
AQP5a, AQP5b, AQP2, AQPa2, and AQP6,
seen in a NJ unrooted tree of AQP proteins
from fish to humans. AQP5 is classified into
two types: type 5a, including human AQP5
and X. tropicalis AQP-xt5a, and type 5b,
comprising X. tropicalis AQP-xt5b and X.
laevis AQP-x5(b). X. tropicalis AQP-xt5b is
annotated as AQP2 in Ensembl. The length
of each branch is not proportional to the
estimated number of amino acid substitutions, and the numbers above the interior
branches are bootstrap probabilities (percent; 10,000 replicates). The organism and
accession numbers are indicated for each
AQP.
Rana nigromaculata AQP3: AB500707
83
100
100
Human AQP5: ENSG00000161798
Chicken AQP5: ENSGALG00000002720
Anole lizard AQP5: ENSACAG00000008471
Xenopus tropicalis AQP-xt5a: AB795995
Anole lizard AQP5-like: NCBIGENE 100553558
Bufo marinus AQP-t4: AF020623
95
91
OM815, Giessen, Germany), and plasma sodium concentration was
determined by atomic absorption spectrophotometry (Hitachi Z5300,
Tokyo, Japan). The urinary bladder was dissected out, immediately
frozen in liquid nitrogen, and used for cDNA cloning experiments.
Xenopus tropicalis AQP-xt3: ENSXETG00000013389
Xenopus laevis AQP-x3: NM_001170452
Human AQP6: ENSG00000086159
Anole lizard AQP6: ENSACAG00000016924
AQP6
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
Fig. 1. Comparison of amino acid sequences
among Xenopus tropicalis AQP-xt5a, AQPxt5b, X. laevis AQP-x5(b), human AQP5,
mouse AQP5, and human AQP2. A pair of
Asn-Pro-Ala motifs (squares) and the mercurial-inhibition site (diamond) are conserved in all the aquaporins (AQPs). The
phenylalanine, histidine, cysteine, and arginine residues (stars) are presumed to be
important for aromatic/arginine constriction,
as in mammalian AQP1 (16, 21). Potential
phosphorylation sites for protein kinase C
(open triangles) and PKA (solid triangles) in
AQP-xt5a were conserved in AQP-xt5b,
AQP-x5(b), mammalian AQP5, or mammalian AQP2, except Ser-227. An N-glycosylation site (circle) is predicted in mammalian
AQP5 and AQP2, but not in anuran AQP5.
Top lines indicate the predicted membranespanning domains of AQP-xt5a. The positions of introns in the AQP-xt5a gene are
indicated by numbered arrows (Ensembl).
R46
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
A
B
Xenopus tropicalis
Scaffold 167
Fig. 3. Schematic diagram of the AQP gene
clusters of X. tropicalis and humans (A) and
comparison of homologous genes (B). AQPxt5a and AQP-xt5b are the homologues of
mammalian AQP5. The orthologs of mammalian AQP2 and AQP6 are not detected in
the X. tropicalis genome. On the other hand,
urinary bladder-type AQPa2 (AQP-xt2) and
ventral skin-type AQPa2 (AQP-xt3) are absent in the human genome. Arrows indicate
the orientation of gene transcription. FAIM2,
Fas apoptotic inhibitory molecule 2; RACGAP1,
Rac GTPase-activating protein 1.
500 kb
FAIM2
600 kb
H. sapiens
FAIM2
FAIM2
-
AQP-xt2
(Urinary
bladder-type
AQPa2)
AQP2
-
AQP5
AQP-xt5a
AQP-xt5b
700 kb
RACGAP1
AQP-xt2 AQP-xt5a AQP-xt5b
AQP-xt3
AQP2 AQP5 AQP6
RACGAP1
FAIM2
48.5 Mb
48.6 Mb
AQP6
-
-
AQP-xt3
(Ventral skintype AQPa2)
RACGAP1
RACGAP1
48.7 Mb
Chromosome 12
␮l of buffer containing 0.5 mM dNTP, 10 mM DTT, 500 ng of
oligo-dT19 primer (Operon, Tokyo, Japan), 40 units RNase inhibitor
(Promega), and 200 units Moloney-murine leukemia virus reverse
transcriptase (Life Technologies). AQP-xt5a cDNA was then amplified in 100 ␮l reaction mixture with 4 ␮l cDNA product, 0.2 mM
dNTP, 2.4 units Prime STAR HS DNA polymerase (Takara), 1 ␮M
AQP-xt5a primer I, 5=-ATGAAGAGGGAACTTTGCTCC, and 1 ␮M
AQP-xt5a primer II, 5=-CTACTGGGGGGCACATTTTTTATG, using a Program Temp Control System, PC-708 (Astec, Fukuoka,
Japan). The PCR program consisted of 1 denaturation cycle of 95°C
for 0.5 min, and 30 amplification cycles of 94°C for 0.5 min, 55°C for
Fig. 4. Swelling assay and immunodetection
for AQP-xt5a. A: time course of the osmotic
swelling. Oocytes were microinjected with
water or AQP-xt5a cRNA. Some of the AQPxt5a cRNA-injected oocytes were incubated in
0.3 mM HgCl2. The recovery of the HgCl2induced inhibition was further examined by
incubating the oocytes in 5 mM 2-mercaptoethanol (2ME). B: Pf was calculated from the
initial rate of oocyte swelling. The data are
shown as the means ⫾ SE of measurements
from five to nine oocytes in each experimental
group. Different lowercase letters denote statistically significant differences (P ⬍ 0.05). C:
imunofluorescence staining against the AQPxt5a protein in microinjected oocytes. Immunopositive labels were visible predominantly
along the plasma membrane of the AQP-xt5acRNA-injected oocytes, which were sampled
after swelling assay (a); the corresponding Nomarski differential interference image (b); in
the absorption test, AQP-xt5a immunoreactivity was abolished to the background levels in
the AQP-xt5a-injected oocytes (c); and immunopositive labeling for AQP-xt5a was not observed in the water-injected oocytes (d). Arrowheads indicate the plasma membrane.
Scale bar ⫽ 50 ␮m. D: Western blot analysis
using anti-AQP-xt5a antibody for the oocytes
sampled after swelling assay. Immunoreactive
bands were seen at 29 kDa and 44 kDa in an
extract of AQP-xt5a cRNA-injected oocytes
(lane 1). The proteins from the same oocytes
were also immunostained with the antiserum
preabsorbed with 10 ␮g/ml antigen peptide
(lane 2). Asterisks denote nonspecific bands.
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
Homo sapiens
Additionally, various tissues, such as the kidney, ventral hindlimb
skin, ventral pelvic skin, and urinary bladder, were sampled for
reverse transcription (RT)-PCR analysis and immunohistochemistry.
All animal experiments were carried out in compliance with the Guide
for Care and Use of Laboratory Animals of Shizuoka University.
Cloning and sequence analysis of AQP-xt5a cDNA. Total RNA was
extracted from the urinary bladder with TRIzol reagent (Life Technologies, Carlsbad, CA), and 10 ␮g of total RNA was incubated in
100 ␮l buffer, including 40 units RNase inhibitor (Promega, Madison,
WI) and 2 units deoxyribonuclease I (Takara, Kyoto, Japan), at 37°C
for 30 min. The total RNA (5 ␮g) was then reverse-transcribed in 20
X. tropicalis
R47
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
5 ␮g total RNA was subjected to RT-PCR, as described above. Specific
primers were used for detection of AQP-xt5a mRNA, AQP-xt5b mRNA
(NM_001015749), or AQP3 mRNA (NM_001016845): AQP-xt5a
primer III, 5=-CGTCGTATCACCAAACGTCAG, AQP-xt5a primer IV,
5=-ATCGCTCCAGCTTTCTTCTTCC, AQP-xt5b primer I, 5=-CACTATAGCATTTCTGATTGG, AQP-xt5b primer II, 5=-AAGAGAGATGCCAGAATTCC, AQP3 primer I, ATTCCTGACTGTCAATCTGG,
and AQP3 primer II, TATAAGTGTCAGATGCTCCG. As an endogenous control, ␤-actin cDNA (BC068217) was also amplified with specific
primers: ␤-actin primer I, 5=-ACTTGACCTGACAGACTACC, and
␤-actin primer II, 5=-CAGTATTGGCATAGAGGTCC. An aliquot of 10
␮l of each amplified product was electrophoresed through an ethidium
bromide-stained 2% agarose gel, and photographed with a FAS-III digital
Relative body weight
1.05
1.00
0.95
0.90
**
0.85
85
0
Plasma osmolality
(mOsm/kg)
250
*
240
230
220
0
0
150
Plasma Na+
concentration (mM)
140
120
100
80
60
40
20
0
Fig. 5. Body weight change, plasma osmolality, and plasma sodium concentration of hydrated and dehydrated X. tropicalis. A: ratio of body weight on day
7 was compared between the hydrated (circle) and dehydrated frogs (triangle).
The body weight was significantly decreased after dehydration. B: significant
increase was observed in the plasma osmolality of the dehydrated frogs.
C: plasma Na⫹ concentration did not change between the hydrated and
dehydrated groups. Each bar shows the means ⫾ SE of five measurements.
*P ⬍ 0.05 vs. hydrated group. **P ⬍ 0.01 vs. hydrated group (day 7).
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
0.5 min, and 72°C for 1 min. The PCR product was separated by
electrophoresis, and a major band was subcloned into Sma I-cut
pGEM-3Z vector (Promega). Sequencing reactions were conducted
with a thermo sequenase cycle sequencing kit (Affymetrix, Santa
Clara, CA), and nucleotide sequences were determined using a Li-Cor
automated DNA sequencer model 4200L-2G (Li-Cor, Lincoln, NE).
The sequence data were analyzed using Genetyx, ver. 8 (Genetyx,
Tokyo, Japan) and TMHMM server v.2.0 (http://www.cbs.dtu.dk/
services/TMHMM/).
Phylogenetic analysis. The amino acid sequences of 95 AQPs from
mammals to fish were aligned using Clustal W (44), and alignment
parameters were set according to an instruction manual by Hall (18).
An unrooted tree was inferred by the neighbor-joining (NJ) method
(36) in the PAUP program ver. 4.0 beta 10 (Sinauer Associates,
Sunderland, MA). The mean character difference was utilized to
estimate the evolutionary distance. Confidence in the NJ tree was
assessed with 10,000 bootstrap replications (14) and utilized to construct a 50% majority-rule consensus tree.
Swelling assay with X. laevis oocytes. The coding region of X.
tropicalis AQP-xt5a cDNA was synthesized by PCR using the total
RNA from the urinary bladder, PrimeSTAR, and primers: 5=-GCCACCATGAAGAGGGAACTTTGCTC and 5=-(T)25 CTACTGGGGGGCACATTTTTTATG, as described above. The amplified cDNA
was subcloned into the pGEM-3Z vector (Promega). AQP-xt5a cRNA
was capped and transcribed from the AQP-xt5a cDNA/pGEM-3Z
vector that was linearized with Kpn I (Takara), using mCAP RNA
capping kit (Stratagene, La Jolla, CA). For the swelling assay, X.
laevis oocytes (stages V and VI) were defolliculated for 1 h with 1
mg/ml collagenase B (Roche Diagnostics, Tokyo, Japan) in sterile
OR2 solution [100 mM NaCl, 2 mM KCl, 2 mM MgCl2, and 5 mM
Tris-HCl (pH7.5)]. Isolated oocytes were microinjected with 50 nl of
either cRNA (1 ␮g/␮l) or MilliQ water, and then incubated in Barth’s
buffer [8 mM NaCl, 1 mM KCl, 1.7 mM MgSO4, 0.33 mM Ca
(NO3)2, 0.41 mM CaCl2, 2.4 mM NaHCO3, 10 mM Tris-HCl (pH
7.6), 10 ␮g/ml penicillin, and 10 ␮g/ml streptomycin, 200 mOsm] at
18°C for 3 days. After incubation, the oocytes were transferred from
200 mOsm to 70 mOsm Barth’s buffer without antibiotics. The
osmotically elicited increase in volume was monitored at 24°C under
an Olympus BX50 microscope with a charge-coupled device camera
connected to a computer (Olympus, Tokyo, Japan). The coefficient of
osmotic water permeability (Pf) was calculated from the initial slope
of oocyte swelling (48). In the inhibition experiment, AQP cRNAinjected oocytes were incubated with 0.3 mM HgCl2 for 10 min before
transfer to 70 mOsm Barth’s buffer. Further, to examine the recovery
of the HgCl2-induced inhibition, AQP cRNA-injected oocytes were
incubated in 5 mM 2-mercaptoethanol for 10 min following the
incubation in 0.3 mM HgCl2.
Dehydration and administration of [Arg (8)]-vasotocin. Clawed
frogs were separated into a hydrated control group or a dehydrated
group. The dehydrated group was kept in a container with water at a
depth of ⬃1 cm at 30°C for 1 day and then at a depth of ⬃0.5 cm at
30°C for 1 day, before transfer into a container without water except
for a moist sponge attached to the underside of a stainless-steel wire
mesh floor (day 0). Five dehydrated frogs were kept in the container
at 30°C, and sampled on day 7. The control group was kept in a
container with water at a depth of ⬃10 cm at 30°C, and five hydrated
frogs were sampled on day 7. In the hydrated group, another five frogs
were injected intraperitoneally with 50 ␮l of saline (0.65% NaCl)
(Otsuka, Tokyo, Japan) containing 10⫺6 M [Arg (8)]-vasotocin
(AVT) (Peptide Institute, Osaka, Japan), and sampled after 20 min.
No food was given to frogs during the course of the experiments.
Relative body weight (RBW) was calculated for each group on the
following formula: RBW ⫽ mean body weight on day 0 or day
7/mean body weight on day 0.
Tissue distribution and quantification of AQP mRNAs. Total RNA
was extracted from various tissues of clawed frogs, using TRIzol reagent
(Life Technologies). After treatment with deoxyribonuclease I (Takara),
R48
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
AQP-xt5a serum diluted at 1:8,000. After a washing with TBS, the
membrane was incubated with biotinylated goat anti-rabbit IgG antibody (Dako, Tokyo, Japan), and streptavidin-conjugated horseradish
peroxidase (Dako). After a washing with TBS, the reaction products
were detected by use of ECL Western blot analysis detection reagents
(GE Healthcare, Buckinghamshire, UK). To assess the specificity of
anti-AQP-xt5a antibody, an absorption test was performed by preincubating anti-AQP-xt5a with the antigen peptide (ST-200) (10 ␮g/
ml). Further, to determine whether the immunoreactive proteins were
glycosylated, the extracts from the cRNA-injected oocytes were
treated with peptide-N-glycosidase F (Daiichi Pure Chemicals, Tokyo,
Japan) at 37°C for 1 h, and subjected to SDS-PAGE.
Immunohistochemistry and immunofluorescence quantification.
The urinary bladder and skin were fixed in periodate-lysine-paraformaldehyde fixative overnight at 4°C, dehydrated, and embedded in
Paraplast plus (McCormick Scientific, St. Louis, MO). Thin sections
(4 ␮m) were cut and mounted on gelatin-coated slides. They were
then deparaffinized and rinsed with distilled water and PBS before
incubation with 1% BSA-PBS for 30 min. For immunofluorescence
staining, sections were first covered with rabbit anti-AQP-xt5a antibody at a 1:2,000 dilution for 16 h. After rinsing in PBS, the sections
were covered with a mixture of indocarbocyanine (Cy3)-labeled
affinity-purified donkey anti-rabbit IgG antibody (Jackson Immunoresearch, West Grove, PA) at a 1:400 dilution and 1 ␮g/ml 4=, 6-diamidino-2-phenylindole (DAPI) for 2 h. DAPI was included for
nuclear counterstaining. The sections were finally rinsed with PBS
and mounted with PermaFluor (Immunon, Pittsburgh, PA). The specificity of immunostaining was assessed using an absorption test by
preincubating the anti-AQP-xt5a antibody with the antigen oligopeptide (10 ␮g/ml). For double-immunofluorescence staining, sections
were incubated with a mixture of rabbit anti-AQP-xt5a antibody at a
1:2,000 dilution and guinea pig anti-AQP-x5(b) antibody at a 1:2,000
dilution, guinea pig anti-AQP-x3BL antibody at a 1:2,000 dilution, or
guinea pig anti-bullfrog V-ATPase E-subunit antibody at a 1:2,000
dilution, followed by incubation with a mixture of Cy3-labeled don-
Fig. 6. Tissue distribution of AQP-xt5
mRNAs and AQP3 mRNA in the hydrated (A)
and dehydrated X. tropicalis (B), determined
by RT-PCR analysis. Total RNA (10 ng)
from various tissues were reverse-transcribed and amplified by PCR with specific
primers. ␤-actin mRNA was used as an internal control. A: presence of amplified
bands at the predicted lengths (429 bp)
shows the expression of AQP-xt5a mRNA in
the hindlimb skin, ventral pelvic skin, pectoral skin, dorsal skin, and urinary bladder
under the hydrated condition. On the other
hand, distinct bands for AQP-xt5b mRNA
(437 bp) were detected in the hindlimb skin,
ventral pelvic skin, pectoral skin, and dorsal
skin. Amplified bands for AQP3 mRNA
(310 bp) were observed in all the tissues
examined. B: under the dehydrated condition, AQP-xt5a mRNA was detected in the
same tissues, while AQP-xt5b mRNA was
found weakly in the lung and stomach in
addition to the skin. AQP3 mRNA was expressed again in all of the tissues examined.
The expression levels of AQP-xt5 and AQP3
mRNAs appeared to be higher than those
from the hydrated frogs.
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
camera system (Nippon Genetics, Tokyo, Japan). End-point quantitative
RT-PCR was carried out using AQP-xt5a primer III and AQP-xt5a
primer IV to assess the AQP-xt5a mRNA levels. The mRNA levels of
AQP-xt5b, AQP3, and ␤-actin were quantified with the above specific
primers. The cycle numbers were chosen within the exponential and
parallel amplification range: 31 for AQP-xt5a, 30 for AQP-xt5b, 28 for
AQP3, and 25 for ␤-actin. The amount of each molecule was estimated
from the band intensity based on the standard curve generated by serial
dilution of cDNA/pGEM-3Z vector. The intensity of the amplified bands
was quantified using ImageJ software (National Institutes of Health,
Bethesda, MD), and the ratio of AQP-xt5 or AQP3 to ␤-actin transcripts
was calculated for normalization.
Antibodies. An oligopeptide corresponding to the C-terminal amino
acid residues 244 –255 (ST-200: EEESWSDQQDNC; Fig. 1) of X.
tropicalis AQP-xt5a was synthesized and coupled to keyhole limpet
hemocyanin (Protein Purify, Maebashi, Japan). Antibodies were
raised in a rabbit or guinea pig immunized with the ST-200 peptide
coupled to keyhole limpet hemocyanin, as described previously (43).
Rabbit or guinea pig anti-peptide antibodies were previously generated for X. laevis AQP5 homologue, AQP-x5(b) (26), and X. laevis
AQP3, AQP-x3BL (30), bullfrog vacuolar H⫹-ATPase (V-ATPase)
E-subunit (46).
Western blot analysis. After swelling assay, the microinjected
oocytes were homogenized in cell lysis buffer [150 mM NaCl, 0.1
mg/ml PMSF, 1 mg/ml aprotinin, and 50 mM Tris·HCl (pH 8.0)], and
centrifuged at 12,000 rpm for 10 min to remove insoluble materials.
After addition of the equal volume of 6% SDS solution [6% sodium
dodecyl sulfate, 22.4% glycerol, 10% 2-mercaptoethanol, 140 mM
Tris·HCl (pH 6.8), and 0.02% bromophenol blue], the supernatant
proteins (10 ␮g) were denatured at 37°C for 1 h and electrophoresed
on a 12% SDS-polyacrylamide gel. The proteins were then transferred
to an Immobilon-P membrane (Millipore, Tokyo, Japan) by electroblotting at 70 V for 1 h. The membrane was blocked in Block ace
(Dainippon Sumitomo Pharma, Osaka, Japan). After a washing with
TBS [0.1 M Tris·HCl (pH 8.0), 0.5 M NaCl, 0.1% polyoxyethylene
(20) sorbitan monolaurate], the membrane was incubated with anti-
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
RESULTS
Characterization of AQP-xt5 and synteny analysis. Using
RT-PCR and subsequent molecular cloning experiments, we obtained a cDNA fragment encoding AQP-xt5a. An open reading
frame of the cDNA is composed of 867 nucleotides, and AQPxt5a was predicted to consist of 289 amino acid residues
(AB795995), as annotated in Ensembl (ENSXETG00000024580)
(Fig. 1). As in other classical AQPs, certain features were
conserved in AQP-xt5a; these were a pair of canonical AsnPro-Ala motifs, and amino acid residues important for the
aromatic/arginine restriction filter, i.e., Phe-49, His-173, Cys182, and Arg-188, (8) (Fig. 1). Cys-182 is considered to be also
the binding site for mercury, which inhibits water permeation
through AQP-xt5a (20). In addition, three PKC phosphorylation sites were predicted at Ser-152, Ser-227, and Ser-232 (Fig.
1). One PKA phosphorylation site was also predicted at Ser259 (Fig. 1), but no N-linked glycosylation site was detected in
Fig. 7. mRNA expression levels of AQP-xt5a (A–D), AQPxt5b (E), and AQP3 (F) between hydrated and dehydrated
X. tropicalis. Signal quantification was made by end-point
quantitative RT-PCR. AQP-xt5a mRNA expression was
significantly increased in the hindlimb skin (A), ventral
pelvic skin (B), dorsal skin (C), and urinary bladder (D)
after the frogs were dehydrated. AQP-xt5b mRNA expression was also increased in the hindlimb skin (E) under the
dehydrated condition. Further, a significant increase in the
AQP3 mRNA level was detected in the urinary bladder (F).
Each bar shows the means ⫾ SE of five measurements.
*P ⬍ 0.05 vs. hydrated group. **P ⬍ 0.01 vs. hydrated
group.
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
key anti-rabbit IgG at a 1:400 dilution (Jackson Immunoresearch),
Alexa Fluor 488-labeled goat anti-guinea pig IgG at a 1:200 dilution
(Molecular Probes, Eugene, OR), and DAPI. Specimens were observed with an Olympus BX61 microscope equipped with epifluorescence and Nomarski differential interference-contrast optics. Immunolabels for AQP-xt5a were quantified in the urinary bladder epithelial cells. Fluorescent images were captured in randomly selected
fields, and the mean immunofluorescence intensity was measured with
ImageJ (National Institutes of Health). Nonspecific fluorescence was
recorded from the urinary bladder submucosal cells and subtracted
from the measurements as the background signal.
Statistical analysis. Results were presented as the means ⫾ SE.
Statistical significance between two groups was analyzed by Student’s
t-test because the variances were equal (F test). Multiple comparisons
were made by the Steel-Dwass test, using PASW Statistics 18 software (IBM, Armonk, NY) since the variances were heterogeneous
(Bartlett’s test). Statistical significance was set at P ⬍ 0.05 or P ⬍
0.01.
R49
R50
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
AQP-xt5a. Similar characteristics were also detected in AQPxt5b (NM_001015749) (Fig. 1). To verify the phylogenetic
position of AQP-xt5a and AQP-xt5b, an NJ tree was constructed using 95 AQP proteins of vertebrates from fish to
mammals, and a part of this tree is shown in Fig. 2. In the
AQP5 cluster, AQP-xt5a belonged to the same subcluster as
human AQP5, chicken AQP5, and Anole lizard AQP5,
whereas AQP-xt5b formed another subcluster with X. laevis
AQP-x5(b) and Bufo marinus AQP-t4. The NJ tree further
showed that AQP5 has close relationships to kidney-type
AQP2. Additionally, AQP5 has a higher similarity to AQP2 in
its gene structure and location in the genome. aqp-xt5a, aqpxt5b, mammalian AQP5, and AQP2 all comprise a similar four
exon-three intron structure (Ensembl) (data not shown). In the
genome of X. tropicalis, aqp-xt5a and aqp-xt5b are located
between faim2 encoding Fas apoptotic inhibitory molecule 2
and racgap1 for Rac GTPase-activating protein 1, together
with urinary bladder-type aqpa2 and ventral skin-type aqpa2
Hydrated
Hydrated
Absorption Hydrated
Hydrated
AQP-xt5a Hydrated
Dehydrated
AQP-xt5a Dehydrated
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
Fig. 8. Histological localization of AQP-xt5a
in the skin of X. tropicalis. A: Mallory’s
triple staining. The acini of three types of
skin glands, i.e., the mucous gland, granular
gland, and small granular gland, are located
in the spongy dermis under the epidermis. B,
C, E: immunofluorescence staining against
AQP-xt5a in the skin of hydrated frogs.
D, F: Nomarski differential interference-contrast images are shown as the corresponding
references: D to C, and F to E. AQP-xt5a
immunoreactivity (red; arrowheads) is observed in the peripheral area of the acinus of
the granular gland, but not in the mucous
gland or small granular gland (B). The labeling (arrowheads) disappeared when antiAQP-xt5a antibody was preabsorbed with
the antigen peptide (C). A: magnified image
(E) depicts the localization of AQP-xt5a (arrowheads) in the peripheral cytoplasm of the
secretory cell of the granular gland. G: immunofluorescence staining against AQPxt5a in the skin of dehydrated frogs. H: Nomarski differential interference-contrast image corresponds to G. After dehydration,
AQP-xt5a (red) did not change its localization in the granular gland (arrowhead), but
appeared in the cytoplasm of acinar cells of
the small granular glands (arrows) (G). Nuclei are counterstained with DAPI (blue). cd,
compact dermis; ed, epidermis; gg, granular
gland; mg, mucous gland; sd, spongy dermis;
sg, small granular gland. Scale bar in A ⫽
100 ␮m; scale bar to B–D ⫽ 50 ␮m; scale
bar to E–H ⫽ 10 ␮m.
AQP-xt5a
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
44-kDa band was not shifted after treatment with peptide-Nglycosidase F (data not shown).
Physiological conditions of X. tropicalis. The body weight
of X. tropicalis was significantly decreased after 7 days of
dehydration (Fig. 5A). Plasma osmolality was significantly
increased after dehydration (Fig. 5B), but plasma sodium
concentration showed no difference between hydrated and
dehydrated frogs (Fig. 5C).
Gene expression of AQP-xt5 in tissues. Tissue distribution of
AQP-xt5a mRNA and AQP-xt5b mRNA was examined by
RT-PCR. For the hydrated frogs, amplified bands for both
AQP-xt5 mRNAs were detected in the ventral hindlimb skin,
ventral pelvic skin, pectoral skin, and dorsal skin (Fig. 6A). A
band for AQP-xt5a mRNA was also seen in the urinary
bladder. In the end-point RT-PCR, all the bands appeared to be
intensified in the dehydrated frogs (Fig. 6B). Additionally, a
weak band for AQP-xt5b mRNA was detected in the lung and
stomach of the dehydrated frogs (Fig. 6B). Quantitative RTPCR using ␤-actin mRNA as an endogenous reference showed
that the relative expression levels of AQP-xt5a mRNA increased significantly (P ⬍ 0.05) in the ventral hindlimb skin,
ventral pelvic skin, dorsal skin, and urinary bladder of the
dehydrated frogs, compared with the hydrated frogs (Fig. 7,
A–D). The relative expression of AQP-xt5b mRNA also increased significantly (P ⬍ 0.01) in the hindlimb skin of the
dehydrated frogs (Fig. 7E).
Gene expression was further examined for AQP3. RT-PCR
analysis showed AQP3 mRNA to be expressed in all the tissues
examined, including the skin and urinary bladder (Fig. 6). The
AQP3 mRNA expression appeared to be enhanced after dehydration (Fig. 6B), and a significant increase (P ⬍ 0.05) was
detected in the urinary bladder (Fig. 7F).
Localization of AQP-xt5 in the skin and urinary bladder.
Mallory’s triple staining showed that the skin consisted of the
V-ATPase AQP-xt5a
AQP-xt5a
sg
AQP-xt5b
sg
B
A
AQP3
AQP-xt5a
ed
sg
C
mg
sg
D
mg
Fig. 9. Double-immunofluorescence staining
against AQP-xt5a and V-ATPase E-subunit
(A), AQP-xt5a and AQP-xt5b (B), or AQPxt5a and AQP3 (C) in the small granular
glands of the ventral skin of dehydrated X.
tropicalis. A: AQP-xt5a (red; arrowheads) is
localized to the secretory compartment of the
acinus. No labels for AQP-xt5a are seen in
the mitochondrion-rich cells immunopositive
for V-ATPase E-subunit (green; arrows).
B: AQP-xt5a (red; arrowheads) is expressed
in the cytoplasm of secretory cells, whereas
AQP-xt5b (green; arrows) is located in the
apical membrane of these cells. C: AQP-xt5a
(red; arrowheads) resides in the cytoplasm of
secretory cells, while AQP3 (green) is found
in the basolateral membrane of these cells
(arrows). AQP3 is also observed along the
plasma membrane of epidermal cells (double
arrowheads). D: Nomarski differential interference-contrast image corresponding to C.
Nuclei are counterstained with DAPI (blue).
ed, epidermis; sd, spongy dermis; sg, small
granular gland; mg, mucous gland. Scale bar
⫽ 10 ␮m.
sd
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
(Ensembl) (Fig. 3). Likewise, AQP5 and AQP2 are sited
between FAIM2 and RACGAP1 in mammalian genomes (Ensembl) (Fig. 3).
Expression of AQP-xt5a in X. laevis oocytes. Transmembrane water flow through AQP-xt5a was evaluated by a swelling assay using X. laevis oocytes. After 3 days of incubation at
18°C, the oocytes were injected with AQP-xt5a cRNA or
water, and transferred from isotonic (200 mOsm) to hypoosmotic (70 mOsm) Barth’s solution. The oocytes injected
with AQP-xt5a cRNA swelled more rapidly than those injected
with water (Fig. 4A), and the Pf of AQP-xt5a was ⬃4-fold
greater than the control (Fig. 4B). The enhanced water permeability was significantly inhibited by the treatment with 0.3
mM HgCl2, but this decrease was recovered after the additional
exposure to 5 mM 2-mercaptoethanol (Fig. 4B), confirming
that the increase in water permeability of cRNA-injected
oocytes was mediated by the expressed AQP-xt5a protein. To
confirm the proper expression of AQP-xt5a in the cRNAinjected oocytes, immunofluorescence staining was carried out
using an anti-AQP-xt5a antibody. Immunopositive labels were
detected along the plasma membrane and cytoplasm near the
plasma membrane of the AQP-xt5a cRNA-injected oocytes
(Fig. 4C, a and b). The immunoreactivity was eliminated by
preabsorption of the antiserum with 10 ␮g/ml of the immunogen peptide (Fig. 4C, c). No labels were observed in the
water-injected oocytes (Fig. 4C, d). Western blot analysis of
the extracts from AQP-xt5a cRNA-injected oocytes detected a
band at ⬃29 kDa, close to the molecular mass (28.8 kDa)
predicted from the deduced amino acid sequence of AQP-xt5a.
Another band was also observed at about 44 kDa (Fig. 4D, lane
1). Neither band was found when anti-AQP-xt5a was preabsorbed with the immunogen peptide (Fig. 4D, lane 2), suggesting that the bands of 29 kDa and 44 kDa may represent
AQP-xt5a and a modified form, respectively. However, the
R51
R52
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
epidermis and the dermis that was further divided into the
spongy dermis and compact dermis (Fig. 8A), as in other
anurans (10, 27, 35). Three types of skin glands, i.e., mucous
gland, granular gland, and small granular gland, were observed
in the skin of X. tropicalis (Fig. 8A). The acini of the mucous
gland and small granular gland were stained light blue, while
the acinus of the granular gland was stained red, like those in
the skin of X. laevis (17). The acinus of each gland was located
in the spongy dermis.
Immunofluorescence staining localized labels for AQPxt5a along the peripheral area of the acinus of the granular
gland in both the dorsal and ventral skins of hydrated frogs
(Fig. 8, B, E, and F). For the granular gland, the secretory
compartment of the acinus comprises a syncytium (9).
Therefore, AQP-xt5 seems to be present in the peripheral
cytoplasm of the secretory syncytium of the granular gland.
No labels were observed in the mucous gland or small
granular gland of hydrated frogs (Fig. 8, B, E, and F). The
specificity of the immunoreaction was confirmed by the
antibody absorption tests using anti-AQP-xt5a antibody preabsorbed with the antigen (Fig. 8, C and D). On the other
hand, immunoreactive AQP-xt5b and AQP3 were localized
along the apical plasma membrane and basolateral membrane of secretory cells of the small granular gland of
AQP-xt5a
AQP3
AQP-xt5a
V-ATPase
AQP-xt5a
AQP3
Dehydrated
Dehydrated
Fig. 10. Double-immunofluorescence staining against AQP-xt5a and V-ATPase E-subunit (A, E), or AQP-xt5a and AQP3 (C, G) in
the urinary bladder of hydrated (A–D) and
dehydrated X. tropicalis (E–H). Nomarski
differential interference-contrast images are
shown as the corresponding references; B to
A, D to C, F to E, and H to G. A, C: for the
hydrated frogs, AQP-xt5a (red; arrowhead) is
located in the apical plasma membrane and
cytoplasm of granular cells of the luminal
epithelium. No labels for AQP-xt5a are visible in the mitochondrion-rich cells immunopositive for V-ATPase E-subunit (green; arrow) (A). On the other hand, AQP3 (green;
double arrowheads) is present along the basolateral membrane of granular cells (C). E,
G: for the dehydrated frogs, intense labels for
AQP-xt5a (red; arrowheads) are observed
along the apical membrane of most granular
cells. AQP-xt5a is not detected in the mitochondrion-rich cells immunopositive for VATPase E-subunit (green; arrow) (E). AQP3
(green; double arrowheads) is located along
the basolateral membrane of granular cells
(G). et, epithelium; lu, lumen; sm, submucosa. Scale bar ⫽ 10 ␮m.
Hydrated
Hydrated
V-ATPase
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
AQP-xt5a
R53
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
100
Mean fluorescence
intensity
Apical membrane
80
Cytoplasm
bc
60
40
ab
a
*
*
*
20
0
hydrated frogs, respectively (data not shown), like AQPx5(b) and AQP3 in X. laevis kept in the water (26, 40).
After dehydration, immunopositive labels for AQP-xt5a became detectable not only in the granular gland, but also in the
small granular gland. High-magnification images revealed that
labels for AQP-xt5a were located over the cytoplasm of acinar
cells in the small granular gland (Fig. 8, G and H). The specific
immunoreactivity was again confirmed by the antibody absorption tests (data not shown). Double-immunofluorescence staining was carried out to elucidate the detailed distribution of
AQPs in the acinar cells of the small granular gland. Staining
against AQP-xt5a and V-ATPase E-subunit, a marker molecule
for mitochondrion-rich cells (46), depicted AQP-xt5a in secretory cells of the small granular gland of dehydrated frogs, but
not in the mitochondrion-rich cells (Fig. 9A). It was further
shown that AQP-xt5a, AQP-xt5b, and AQP3 (AQP-xt3BL),
resided at the cytoplasm, apical plasma membrane, and basolateral plasma membrane of secretory cells of the small granular gland of dehydrated frogs, respectively (Fig. 9, B–D).
AQP-xt5b was not found in the apical plasma membrane of
flattened cells located in the intermediate region between the
acinus and excretory duct of mucous glands, unlike X. laevis
AQP-x5(b) (26, 30). These findings are summarized in Fig. 12A.
In addition to the skin glands, AQP-xt5a was observed in the
urinary bladder. Immunofluorescence staining revealed AQPxt5a in a number of the luminal epithelial cells under the
hydrated condition, specifically at the apical plasma membrane
and cytoplasm (Fig. 10, A–D). Double-immunofluorescence
DISCUSSION
In the present study, we have demonstrated the presence of
two types of AQP5, AQP-xt5a and AQP-xt5b, in X. tropicalis.
Although aqp-xt5b (ENSXETG00000020388) is annotated as
aqp2 in Ensembl, we consider that this gene encodes an AQP5
homolog, for the following reasons. First, our molecular phylogenetic analysis assigned this gene to the AQP5 cluster.
Secondly, in Ensembl, the gene order of aqp2 (aqp-xt5b) and
aqp5 (aqp-xt5a) in X. tropicalis genome is inverted, compared
with that of mammalian AQP2 and AQP5, in spite of the same
orientation of transcription (Ensembl) (Fig. 3). Third, if this
gene is aqp2, it should be expressed in the kidney, as in
mammals (37), quails (32), and tree frogs (34). However,
RT-PCR analysis did not detect the expression of this gene in
the kidney, or rather it was expressed in the skin glands. Given
these lines of evidence, it is more plausible that the current
gene arrangement of aqp-xt5a (aqp5) and aqp-xt5b (aqp2) had
been caused by a deletion of aqp2 and a tandem gene duplication of aqp-xt5.
The small granular gland was first reported in X. laevis (17),
but little is known about its function. In the present study, we
Table 1. Tissue distribution of AQP-xt5a and AQP-xt5b in Xenopus tropicalis
AQP-xt5a
AQP-xt5b
Physiological
Condition
Skin
Lung
Urinary
Bladder
Kidney
Brain
Stomach
Large
Intestine
Muscle
Liver
Heart
Hydrated
Dehydrated
Hydrated
Dehydrated
⫹
⫹⫹
⫹
⫹⫹
⫺
⫺
⫺
⫹
⫹
⫹⫹
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫹
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫹, expression; ⫹⫹, stronger expression; ⫺, no expression.
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
Fig. 11. Subcellular distribution of AQP-xt5a in granular cells of the urinary
bladder of hydrated, hydrated/AVT-injected, and dehydrated X. tropicalis. The
mean immunofluorescence intensity was measured with ImageJ software. The
trafficking of AQP-xt5a to the apical membrane was significantly increased
after the frogs were dehydrated. This increase was not caused by AVT
injection into the hydrated frogs. Each bar shows the means ⫾ SE of more than
seven measurements. Different lowercase letters denote statistically significant
differences (P ⬍ 0.05). *P ⬍ 0.05 vs. cytoplasm.
staining against AQP-xt5a and V-ATPase E-subunit showed
that AQP-xt5a was not expressed in the mitochondrion-rich
cells of hydrated frogs (Fig. 10, A and B). On the other hand,
AQP3 immunoreactivity was detected along the basolateral
membrane of these AQP-xt5a-positive cells (Fig. 10, C and D).
Because AQP3 is expressed in the granular cells of the luminal
epithelium (30, 40, 41), AQP-xt5a-positive cells are considered
to be the granular cells. After dehydration, the number of
AQP-xt5a-positive cells increased, and labels were observed in
the apical membrane and cytoplasm of most granular cells
(Fig. 10, E–G). Furthermore, labeling was increased significantly (P ⬍ 0.05) in the apical membrane (Fig. 11). Dehydration did not induce expression of AQP-xt5a in the mitochondrion-rich cells, however (Fig. 10, E and F). As in hydration,
AQP3 was localized along the basolateral membrane of AQPxt5a-positive cells, but its immunoreactivity tended to be
increased (Fig. 10, G and H).
The effect of AVT on the localization of AQP-xt5a was
examined in the hydrated frogs. Twenty minutes after injection, AVT did not induce the expression of AQP-xt5a in the
secretory cells of the small granular glands or in most granular
cells of the urinary bladder, such as was seen following
dehydration (data not shown). In addition, the AVT injection
scarcely increased the trafficking of AQP-xt5a into the apical
membrane in the urinary bladder granular cells (Fig. 11).
We have summarized the tissue distribution of AQP-xt5
(Table 1), and the cellular and subcellular localization of AQPs
in the skin glands (Fig. 12A) and urinary bladder (Fig. 12B).
R54
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
A
Skin
Granular gland
Small granular gland
Hydrated
lumen
MRC
basolateral side
basolateral side
MRC
basolateral side
basolateral side
AQP5a
B
AQP5b
AQP3
Urinary bladder
Hydrated
lumen
MRC
basolateral side
Dehydrated
lumen
MRC
basolateral side
AQP5a
found small granular glands in the skin of X. tropicalis, and
localized immunoreactive AQP-xt5b and AQP3 to the apical
plasma membrane and basolateral membrane, respectively, of
their secretory cells. In addition, we found that the subcellular
distribution of both AQPs did not change when the frogs were
dehydrated. These findings suggest that water might be secreted from the small granular gland through AQP-xt5b and
AQP3 not only in hydrated frogs but also in dehydrated frogs.
When the frogs dwell in water, this secretion might contribute
to the disposal of excessive fluid entering the body osmotically.
In some natural habitats, X. tropicalis migrates to the river
banks during the dry season and hide in holes, under flat stones,
or under roots (Amphibiaweb, http://amphibiaweb.org/). When
AQP3
the frogs are, thus, dehydrated on the land, the water secreted
from the small granular gland could provide the body surface
with moisture and help decrease body temperature via the
endothermic effect of evaporation. The present immunohistochemistry further revealed the occurrence of AQP-xt5a in the
cytoplasm of secretory cells of the small granular gland under
the dehydrated condition. However, the physiological role of
this AQP is obscure.
In the present study, AQP-xt5a, but not AQP-xt5b, was
detected in the urinary bladder. This is the first finding of the
expression of vertebrate AQP5 in this tissue. The urinary
bladder is an important osmoregulatory organ for many adult
anurans, and water is reabsorbed from the urine stored in the
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
Fig. 12. Schematic view of AQP distribution in
the skin glands (A) and urinary bladder (B) of
Xenopus. A: under the hydrated condition, AQP5b
and AQP3 are located in the apical plasma membrane and basolateral membrane of secretory cells
of the small granular gland, respectively. Under
the dehydrated condition, AQP5a becomes expressed in the cytoplasm in addition to the apical
AQP5b and basolateral AQP3. On the other hand,
AQP5a resides in the peripheral cytoplasm of the
secretory syncytium of the granular gland under
both conditions. B: under the hydrated condition,
AQP5a is expressed in the apical membrane and
cytoplasm of a number of granular cells of the
urinary bladder. Under the dehydrated condition,
AQP5a becomes expressed in most granular cells
with more abundance in the apical membrane. On
the other hand, AQP3 is located along the basolateral membrane, and its gene expression is also
increased after dehydration.
Dehydrated
lumen
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
Perspectives and Significance
Amphibian water economy has been extensively investigated in association with their adaptation to diverse ecological
environments. When on land, many anurans absorb water
through the posteroventral skin and reabsorb water from the
urinary bladder (5, 23, 29). Thus far, Xenopus has been studied
as a representative of aquatic anurans that do not show these
responses (3). However, we have here reported the first evidence to suggest that even in Xenopus, the urinary bladder
could reabsorb water under dehydrating conditions, which
mimic the natural environment in the dry season. In addition,
it is also the first finding that AQP5(a) could be involved in this
water reabsorption. AQP5a and/or AQP5b are likely to exist
not only in aquatic Xenopus but also in semiaquatic and
terrestrial anurans. Therefore, it could be important to elucidate
the physiological role of AQP5, as well as AQPa2, in various
species for an understanding of the molecular mechanisms,
diversity, and evolution of anuran osmoregulation.
ACKNOWLEDGMENTS
We express our sincere gratitude to Dr. Susumu Hyodo and Ms. Sanae
Hasegawa, Atmosphere and Ocean Research Institute, The University of
Tokyo, Japan, and Mr. Junya Hara, Shizuoka University, Japan, for their
technical assistance in this study. We are also grateful to Dr. Bridget I Baker
for critical reading of the manuscript.
GRANTS
This work was supported by Grants-in Aid for Scientific Research (20570055;
23370028; 26440165) from the Ministry of Education, Culture, Sports, Science
and Technology of Japan, by a SUNBOR grant from Suntory Institute for
Bioorganic Research, and by a fund from the Cooperative Program (no. 113, 2011)
of the Atmosphere and Ocean Research Institute, The University of Tokyo.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
Author contributions: Y.S., T.S., R.O., M.S., and S.T. conception and design of
research; Y.S., T.S., and H.M. performed experiments; Y.S., T.S., N.T., R.O.,
M.S., and S.T. analyzed data; Y.S., T.S., and M.S. interpreted results of experiments; Y.S., T.S., and N.T. prepared figures; Y.S. and M.S. drafted manuscript;
Y.S. and M.S. edited and revised manuscript; Y.S. and M.S. approved final version
of manuscript.
REFERENCES
1. Andreoli TE, Schafer JA. Mass transport across cell membranes: the
effects of antidiuretic hormone on water and solute flows in epithelia.
Annu Rev Physiol 38: 451–500, 1976.
2. Benga G. Water channel proteins (later called aquaporins) and relatives:
past, present, and future. IUBMB Life 61: 112–133, 2009.
3. Bentley PJ. The Amphibia. In: Endocrines and Osmoregulation A Comparative Account in Vertebrates, edited by Bradshaw SD, Burggren W,
Heller HC, Ishii S, Langer H, Neuweiler G, and Randall DJ. Berlin,
Germany: Springer-Verlag, 2002, p. 155–186.
4. Bentley PJ. Comparative Vertebrate Endocrinology. Cambridge, UK:
Cambridge University Press, 1998.
5. Bentley PJ, Yorio T. Do frogs drink? J Exp Biol 79: 41–46, 1979.
6. Clarke BT. The natural history of amphibian skin secretions, their normal
functioning and potential medical applications. Biol Rev Camb Philos Soc
72: 365–379, 1997.
7. Daly JW, Garraffo HM, Spande TF. Amphibian alkaloids. In: The
Alkaloids, edited by Cordell GF. San Diego: Academic, 1992, p.
185–288.
8. de Groot BL, Grubmuller H. The dynamics and energetics of water permeation
and proton exclusion in aquaporins. Curr Opin Struct Biol 15: 176–183, 2005.
9. Delfino G, Nosi D, Giachi F. Secretory granule-cytoplasm relationships
in serous glands of anurans: ultrastructural evidence and possible functional role. Toxicon 39: 1161–1171, 2001.
10. Dockray GJ, Hopkins CR. Caerulein secretion by dermal glands in
Xenopus laevis. J Cell Biol 64: 724 –733, 1975.
11. Dominguez E, Navas P, Hidalgo J, Aijon J, Lopez-Campos JL. Mucous glands of the skin of Rana ridibunda. A histochemical and ultrastructural study. Basic Appl Histochem 25: 15–22, 1981.
12. Els WJ, Henneberg R. Histological features and histochemistry of the
mucous glands in ventral skin of the frog (Rana fuscigula). Histol
Histopathol 5: 343–348, 1990.
13. Erspamer V. Bioactive secretions of the amphibian integument. In:
Amphibian Biology, edited by Heatwole H. Chipping Norton: Surrey
Beatty & Sons, 1994, p. 178 –341.
14. Felsenstein J. Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39: 783–791, 1985.
15. Finkelstein A. Water movement through lipid bilayers, pores, and plasma
membranes: theory and reality. New York: Wiley, 1987.
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
urinary bladder to compensate for the water loss when on dry
land (4, 23). The urinary bladder has a tight epithelium that
shows a low water permeability in the basal state but allows
enhanced water permeability in response to antidiuretic hormone (ADH), especially vasotocin (AVT) (1, 3, 15). On the
other hand, the urinary bladder of aquatic Xenopus was regarded as an exception because ADH failed to increase its
water permeability (1, 3). The present immunostaining revealed that AQP-xt5a was located in the apical plasma membrane of granular cells, but the number of such cells was
limited when the frogs were kept in the water. In addition,
AVT injection did not increase the number of AQP-xt5aexpressing granular cells, and scarcely facilitated the translocation of AQP-xt5a to the apical membrane. These findings
suggest that the failure of AVT to increase water permeability
of Xenopus urinary bladder might be partially due to insufficient expression of AQP5a. When Xenopus inhabits water, this
low expression might be important to prevent water reentry
from the urinary bladder into the body.
By contrast, after dehydration, AQP-xt5a appeared along the
apical plasma membrane of most granular cells, while AQP3
was detected along their basolateral membrane. These findings
suggest that when exposed to dehydration, X. tropicalis could
reabsorb water from the urinary bladder via AQP-xt5a and
AQP3. As mentioned above, the frogs migrate onto the land
during the dry season (Amphibiaweb). Hence, water reabsorption from the urinary bladder might have an essential role in the
survival of this species in the dry season.
Our RT-PCR analysis revealed an increase in the expression
of both AQP-xt5a and AQP3 mRNAs in the urinary bladder
after dehydration. Serosal hypertonicity is reported to increase
water permeability of ranid and bufonid urinary bladder (19,
24). Additionally, adrenal steroids enhance the vasopressinstimulated water flow across toad urinary bladder (49). Therefore, it is possible that these factors might be involved in
inducing the gene expression of AQP-xt5a and AQP3, although the actual molecular mechanisms are not known.
Previously, we reported that in a terrestrial species, Hyla
japonica, urinary bladder-type AQPa2 (AQP-h2) was expressed in most granular cells, translocated into the apical
membrane in response to AVT, and could cooperate with
basolateral AQP3 for water reabsorption from the urinary
bladder (40, 41). For X. tropicalis, we have recently found that
urinary bladder-type AQPa2 (AQP-xt2) was also expressed in
the granular cells (unpublished observation), and the physiological role of AQP-xt2 is currently under investigation.
R55
R56
AQP-XT5 EXPRESSED IN THE SKIN GLANDS AND URINARY BLADDER
34. Ogushi Y, Mochida H, Nakakura T, Suzuki M, Tanaka S. Immunocytochemical and phylogenetic analyses of an arginine vasotocin-dependent aquaporin, AQP-h2K, specifically expressed in the kidney of the tree
frog, Hyla japonica. Endocrinology 148: 5891–5901, 2007.
35. Rigolo JR, Almeida JA, Ananias F. Histochemistry of skin glands of
Trachycephalus aff. venulosus Laurenti, 1768 (Anura, Hylidae). Micron
39: 56 –60, 2008.
36. Saitou N, Nei M. The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Mol Biol Evol 4: 406 –425, 1987.
37. Sasaki S. Aquaporin 2: from its discovery to molecular structure and
medical implications. Mol Aspects Med 33: 535–546, 2012.
38. Schumacher U, Adam E, Hauser F, Probst JC, Hoffmann W. Molecular anatomy of a skin gland: histochemical and biochemical investigations on the mucous glands of Xenopus laevis. J Histochem Cytochem 42:
57–65, 1994.
39. Suzuki M, Hasegawa T, Ogushi Y, Tanaka S. Amphibian aquaporins
and adaptation to terrestrial environments: a review. Comp Biochem
Physiol A Mol Integr Physiol 148: 72–81, 2007.
40. Suzuki M, Tanaka S. Molecular and cellular regulation of water homeostasis in anuran amphibians by aquaporins. Comp Biochem Physiol A Mol
Integr Physiol 153: 231–241, 2009.
41. Suzuki M, Tanaka S. Molecular diversity of vasotocin-dependent aquaporins closely associated with water adaptation strategy in anuran amphibians. J Neuroendocrinol 22: 407–412, 2010.
42. Takata K, Matsuzaki T, Tajika Y. Aquaporins: water channel proteins
of the cell membrane. Prog Histochem Cytochem 39: 1–83, 2004.
43. Tanaka S, Kurosumi K. A certain step of proteolytic processing of
proopiomelanocortin occurs during the transition between two distinct
stages of secretory granule maturation in rat anterior pituitary corticotrophs. Endocrinology 131: 779 –786, 1992.
44. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680, 1994.
45. Vanable JW Jr. Granular gland development during Xenopus laevis
metamorphosis. Dev Biol 10: 331–357, 1964.
46. Yajima S, Kubota M, Nakakura T, Hasegawa T, Katagiri N, Tomura
H, Sasayama Y, Suzuki M, Tanaka S. Cloning and expression of
vacuolar proton-pumping ATPase subunits in the follicular epithelium of
the bullfrog endolymphatic sac. Zoolog Sci 24: 147–157, 2007.
47. Zardoya R. Phylogeny and evolution of the major intrinsic protein family.
Biol Cell 97: 397–414, 2005.
48. Zhang RB, Logee KA, Verkman AS. Expression of mRNA coding for
kidney and red cell water channels in Xenopus oocytes. J Biol Chem 265:
15375–15378, 1990.
49. Zusman RM, Keiser HR, Handler JS. Effect of adrenal steroids on
vasopressin-stimulated PGE synthesis and water flow. Am J Physiol Renal
Fluid Electrolyte Physiol 234: F532–F540, 1978.
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00186.2013 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.3 on June 15, 2017
16. Fu D, Lu M. The structural basis of water permeation and proton
exclusion in aquaporins. Mol Membr Biol 24: 366 –374, 2007.
17. Fujikura K, Kurabuchi S, Tabuchi M, Inoue S. Morphology and
distribution of the skin glands in Xenopus laevis and their response to
experimental stimulations. Zoolog Sci 5: 415–430, 1988.
18. Hall BG. Phylogenetic Trees Made Easy: A How-to Manual. Sunderland,
MA: Sinauer Associates, 2011.
19. Hanna-Mitchell AT, Gebruers EM. The hydroosmotic response of
frog urinary bladder to serosal hypertonicity is dependent on adenylate
cyclase for its maintenance and affected by [Cl⫺]o changes. Am J
Physiol Regul Integr Comp Physiol 291: R213–R223, 2006.
20. Hirano Y, Okimoto N, Kadohira I, Suematsu M, Yasuoka K, Yasui M.
Molecular mechanisms of how mercury inhibits water permeation through
aquaporin-1: understanding by molecular dynamics simulation. Biophys J
98: 1512–1519, 2010.
21. Hub JS, Grubmuller H, de Groot BL. Dynamics and energetics of
permeation through aquaporins. What do we learn from molecular dynamics simulations? Hand Exp Pharmacol 190: 57–76, 2009.
22. Ishibashi K, Kondo S, Hara S, Morishita Y. The evolutionary aspects of
aquaporin family. Am J Physiol Regul Integr Comp Physiol 300: R566 –
R576, 2011.
23. Jorgensen CB. 200 years of amphibian water economy: from Robert
Townson to the present. Biol Rev Camb Philos Soc 72: 153–237, 1997.
24. Kachadorian WA, Spring KR, Shinowara NL, Muller J, Palaia TA,
DiScala VA. Effects of serosal hypertonicity on water permeability in toad
urinary bladder. Am J Physiol Cell Physiol 258: C871–C878, 1990.
25. Klein SL, Strausberg RL, Wagner L, Pontius J, Clifton SW, Richardson P. Genetic and genomic tools for Xenopus research: The NIH Xenopus
initiative. Dev Dyn 225: 384 –391, 2002.
26. Kubota M, Hasegawa T, Nakakura T, Tanii H, Suzuki M, Tanaka S.
Molecular and cellular characterization of a new aquaporin, AQP-x5,
specifically expressed in the small granular glands of Xenopus skin. J Exp
Biol 209: 3199 –3208, 2006.
27. Lillywhite HB. Water relations of tetrapod integument. J Exp Biol 209:
202–226, 2006.
28. Lillywhite HB, Licht P. A comparative study of integumentary mucous
secretions in amphibians. Comp Biochem Physiol A Comp Physiol 51:
937–941, 1975.
29. Macknight AD, DiBona DR, Leaf A. Sodium transport across toad urinary
bladder: a model “tight” epithelium. Physiol Rev 60: 615–715, 1980.
30. Mochida H, Nakakura T, Suzuki M, Hayashi H, Kikuyama S, Tanaka
S. Immunolocalization of a mammalian aquaporin 3 homolog in watertransporting epithelial cells in several organs of the clawed toad Xenopus
laevis. Cell Tissue Res 333: 297–309, 2008.
31. Myers CW, Daly JW. Dart-poison frogs. Sci Am 248: 120 –133, 1983.
32. Nishimura H. Urine concentration and avian aquaporin water channels.
Pflügers Arch 456: 755–768, 2008.
33. Noble G, Noble E. On the histology of frog skin glands. Trans Am
Microsc Soc 63: 254 –263, 1944.