INVESTIGATION
HIGHLIGHTED ARTICLE
The Sister Chromatid Cohesion Pathway Suppresses
Multiple Chromosome Gain and
Chromosome Amplification
Shay Covo,*,1,2 Christopher M. Puccia,†,3 Juan Lucas Argueso,† Dmitry A. Gordenin,* and Michael A. Resnick*
*National Institute of Environmental Health Sciences, Research Triangle Park, North Carolina 27709, and †Department of
Environmental and Radiological Health Sciences, Colorado State University, Fort Collins, Colorado 80523
ABSTRACT Gain or loss of chromosomes resulting in aneuploidy can be important factors in cancer and adaptive evolution. Although
chromosome gain is a frequent event in eukaryotes, there is limited information on its genetic control. Here we measured the rates of
chromosome gain in wild-type yeast and sister chromatid cohesion (SCC) compromised strains. SCC tethers the newly replicated
chromatids until anaphase via the cohesin complex. Chromosome gain was measured by selecting and characterizing copper-resistant
colonies that emerged due to increased copies of the metallothionein gene CUP1. Although all defective SCC diploid strains exhibited
increased rates of chromosome gain, there were 15-fold differences between them. Of all mutants examined, a hypomorphic mutation
at the cohesin complex caused the highest rate of chromosome gain while disruption of WPL1, an important regulator of SCC and
chromosome condensation, resulted in the smallest increase in chromosome gain. In addition to defects in SCC, yeast cell type
contributed significantly to chromosome gain, with the greatest rates observed for homozygous mating-type diploids, followed by
heterozygous mating type, and smallest in haploids. In fact, wpl1-deficient haploids did not show any difference in chromosome gain
rates compared to wild-type haploids. Genomic analysis of copper-resistant colonies revealed that the “driver” chromosome for which
selection was applied could be amplified to over five copies per diploid cell. In addition, an increase in the expected driver chromosome
was often accompanied by a gain of a small number of other chromosomes. We suggest that while chromosome gain due to SCC
malfunction can have negative effects through gene imbalance, it could also facilitate opportunities for adaptive changes. In multicellular organisms, both factors could lead to somatic diseases including cancer.
T
HERE is growing evidence that aneuploidy is an important factor in adaptive evolution. Although aneuploidy
generally has adverse consequences (Torres et al. 2007,
2008; Williams et al. 2008; Oromendia et al. 2012), it
may provide selective advantage under various stresses
(Pavelka et al. 2010; Sheltzer and Amon 2011). The selective advantage of aneuploidy cells has medical implications
as shown for tumors (Weaver et al. 2007; Chandhok and
Pellman 2009) and drug resistance in pathogenic fungi
Copyright © 2014 by the Genetics Society of America
doi: 10.1534/genetics.113.159202
Manuscript received September 9, 2013; accepted for publication November 11, 2013;
published Early Online December 2, 2013.
Supporting information is available online at http://www.genetics.org/lookup/suppl/
doi:10.1534/genetics.113.159202/-/DC1.
1
Present address: Department of Plant Pathology and Microbiology, Hebrew
University, P. O. Box 12 Rehovot 76100, Israel.
2
Corresponding author: Department of Plant Pathology and Microbiology, Hebrew
University, P. O. Box 12, Rehovot 76100, Israel. E-mail: [email protected]
3
Present address: Department of Biology, Indiana University, Bloomington, IN 47405.
(Selmecki et al. 2006, 2009; Semighini et al. 2011). Moreover, advantageous aneuploidy can be a common step in
evolution. Recently it was suggested that in yeast, aneuploidy may be a “quick fix” to tolerate stress during adaptive
evolution since an aneuploidy state was shown to be transient while more “refined” mutations take over the culture
(Yona et al. 2012). Moreover, changes in aneuploidy can be
an “on–off switch” for colony morphological changes (Tan
et al. 2013).
For these reasons it is important to understand how
different mutants and different physiological conditions
affect aneuploidy. Most of the quantitative analysis in yeast
of mutants that influence aneuploidy was done using
chromosome loss assays. Relatively fewer studies address
chromosome gain (Hartwell and Smith 1985; Spencer et al.
1990; Stirling et al. 2011, 2012). However, measuring chromosome loss does not provide a complete view of chromatid
malsegregation or aneuploidy tolerance. For example,
Genetics, Vol. 196, 373–384 February 2014
373
inability to repair double-strand breaks (DSBs) may cause
loss of a chromosome that is not due to a defect in chromatid
transmission as evident by the number of DNA repair strains
that exhibit increased chromosome loss (Yuen et al. 2007)
and especially proteins involved in recombination (Nakai
et al. 2011; Song and Petes 2012). Unlike chromosome gain,
loss of chromosomes cannot be measured in haploid cells
that contain natural 1n complement of chromosomes, obscuring the ability to study ploidy-dependent effects on
chromatid segregation. Ploidy may have an effect on chromosome transmission as evident by the diploid-dependent
lethality of some temperature-sensitive spindle pole body
mutants (Storchova et al. 2006). In addition, at least for
the budding yeast Saccharomyces cerevisiae, most of the colonies that were selected for chromosome loss, based on loss
of genetic markers following centromere deactivation, actually reduplicated the homologous chromosome and were not
aneuploid (Reid et al. 2008). Therefore, measurements of
stable aneuploidy cannot be made by these types of assays.
Sister chromatid cohesion (SCC) is a process that tethers
the newly replicated chromatids until anaphase and provides fidelity of chromosome transmission (Guacci et al.
1997; Onn et al. 2008; Xiong and Gerton 2010). Defects
in SCC are associated with several developmental defects
(Bose and Gerton 2010) and cancer (for example, Solomon
et al. 2011 and summarized in Pfau and Amon 2012). SCC is
primarily accomplished by the four-subunit cohesin complex
containing Smc1, Smc3, yMcd1/hRad21, and yScc3/hSA1
or hSA2. Cohesin is deposited across chromosomes by the
SCC2/4 cohesin loader. Cohesin becomes cohesive during
DNA replication through acetylation by Eco1 (Ivanov et al.
2002; Rolef Ben-Shahar et al. 2008; Unal et al. 2008; Zhang
et al. 2008; Heidinger-Pauli et al. 2009). Activation of cohesin is linked to DNA replication via proteins like Ctf4 and
Ctf8 (Lengronne et al. 2006; Skibbens 2009) that facilitate
the acetylation of cohesin. Ctf4 contributes to SCC also in an
Eco1-independent manner (Borges et al. 2013). Cohesin is
specifically enriched around the centromeres (Glynn et al.
2004), which in yeast is due in part to the protein Mcm21
(Ortiz et al. 1999; Poddar et al. 1999; Eckert et al. 2007; Ng
et al. 2009). The centromere enrichment of cohesin facilitates sister chromatid biorientation before mitosis (Ng et al.
2009; Stephens et al. 2013), assuring proper chromatid segregation and the prevention of aneuploidy. This function
may be independent of SCC, occurring through intra-DNA
molecule cohesion (Stephens et al. 2011). Aneuploidy due
to defects in SCC can occur even if SCC is established properly. Failure to maintain SCC or failure to disrupt SCC before
mitosis should lead to aneuploidy. Wpl1 (the yeast homolog
of the oncoprotein hWAPL) (Oikawa et al. 2004) is considered to be an important regulator of the SCC process. Recently, Wpl1 was proposed to have a role in preventing
establishment of SCC at G2 by counteracting acetylation of
Smc3 (Guacci and Koshland 2012; Borges et al. 2013;
Lopez-Serra et al. 2013). On the other hand Wpl1 participates in maintenance of SCC once it is properly established
374
S. Covo et al.
(Rolef Ben-Shahar et al. 2008; Rowland et al. 2009; Sutani
et al. 2009) and it controls chromosome condensation
(Lopez-Serra et al. 2013). The effect of deletion of WPL1
on genome stability is not fully understood although evidence suggest it leads to increased loss of heterozygosity
(Yuen et al. 2007).
In addition to SCC, cohesin has a role in the proper
function of the kinetochore and chromatid biorientation as
mentioned above (Ng et al. 2009; Stephens et al. 2011,
2013). Cohesin is also important for gene expression and
DNA repair (Sjogren and Nasmyth 2001; Kim et al. 2002a,
b; Unal et al. 2004; Bauerschmidt et al. 2010; Wu et al.
2012).
As we and others have shown, cohesin facilitates DSB
repair between sister chromatids and suppresses recombination between homologous chromosomes (Sjogren and
Nasmyth 2001; Covo et al. 2010; Heidinger-Pauli et al.
2010). Cohesin is recruited to DSBs (Strom et al. 2004; Unal
et al. 2004) and stalled replication forks (Tittel-Elmer et al.
2012). SCC is activated in response to DNA damage (Strom
et al. 2007; Unal et al. 2007, 2008; Heidinger-Pauli et al.
2008, 2009). Defects in SCC-mediated recombination might
lead to aneuploidy, since inefficient resolution of homologous recombination intermediates can cause whole chromosome gain (Acilan et al. 2007; Ho et al. 2010).
Here, we show that different mutations in the SCC
pathway can result in highly different increases in the rate
of chromosome gain. Yet, the focus of this work is the use of
our chromosome gain assay to answer questions that were
not addressed previously in classical chromosome loss
assays. We were able to show increase in chromatid
malsegregation in diploid vs. haploid strains. In addition, we
showed a clear effect of DNA damage on chromosome gain.
Finally, we were able to show, for the first time, that defects
in cohesin can cause multiple whole chromosome gains, including chromosome amplification (fast acquisition of multiple copies of one chromosome) that allows cells to survive
toxic exposure. Based on these findings, we propose that the
genome plasticity of diploid cells defective in SCC may facilitate adaptive evolution of pathogenic fungi and provide
a selective advantage to cancer cells.
Materials and Methods
Strains used in this study are provided in Table 1.
Strain construction
Gene inactivation was done by knockout of specific open
reading frames using the KanMX cassette from the S. cerevisiae
deletion collection. The primers that were used for WPL1
knockout were as follows:
59 ATGTTTACTTCAGCCCTTTTT 39 and 59 ACGCTAG
AAGGCTCATCAAA 39 for CTF4; 59 GTCCAATTTGAGTGT
AAAATCACAGG 39 and 59 GGTGTTACACTGTTTAATCAAA
GCTC 39 for MCM21; 59 ACCTGGGCCGTCTTAAATTT 39
and 59 AGCTTGCCTTGCCATTGTTT 39 for CIN2;
Table 1 Strains used in this work
Strain
Ploidy
Genotype
CS1131
Haploid (WT)
CS1143
CS1152
CS1249
CS1252
CS1276
CS1275
CS2324
CS2322
CS2318
CS2364
CS2360
CS2405
CS2403
CS2335
CS2344
CS2393
CS2346
CS2336
CS2417
CS2420
CS2342
CS2373
CS2400
Haploid
Haploid
Haploid
Haploid
Haploid
Haploid
Diploid (WT)
Diploid
Diploid
Diploid
Diploid
Diploid
Diploid
Diploid
Diploid
Diploid
Diploid
Diploid
Diploid
Diploid
Diploid
Diploid
Diploid
MATa, bar1-D, his7-2, trp1D, ura3D, leu2-3, 112, ade2D, sfa1D, lys2D, cup1-1D,
yhr054cD, cup1-2D.LYS2 ec, CUP1-1ec, ADE2 ec, SFA1 ec (Narayanan et al. 2006)
As 1131 but mcd1-1
As 1131 but wpl1::G418
As 1131 but mcm21::G418
As 1131 but ctf4::G418
As 1131 but cin2::G418
As 1131 but mad1::G418
MATa/MATa
As 2324 but mcd1-1/mcd1-1
As 2324 but wpl1::G418/wpl1::G418
As 2324 but mcm21::G418/mcm21::G418
As 2324 but ctf4::G418/ctf4::G418
As 2324 but cin2::G418/cin2::G418
As 2324 but mad1::G418/mad1::G418
As 2324 but MATa/MATa
As 2324 but MATa/MATa
As 2324 but MATa/MATa, CUP1/cup1D
As 2324 but MATa/MATa mcd1-1/mcd1-1
As 2324 but MATa/MATa wpl1::G418/wpl1::G418
As 2324 but MATa/MATa wpl1::G418/wpl1::G418rad51::NAT/rad51::URA3
As 2324 but MATa/MATa rad51::G418/rad51::URA3
As 2324 but MATa/MATa wpl1::G418/wpl1::G418
As 2324 but dnl4::G418/dnl4::G418
As 2324 but rad52::G418/dnl4::HYGB
ec, ectopic on chromosome V. CUP1 gene was transferred from chromosome VIII, ADE2 from chromosome XV, and SFA1 from chromosome IV (Narayanan et al. 2006). In
the experiments described here, only selection for increase in copy number of CUP1 was determined. Changes in ADE2 or SFA1 were not determined directly.
59 TCCGGTTGAAGAGGTTCCA 39 and 59 TTTCGAAGGA
GAGCCTGAAT 39 for MAD1; 59 GGACAGTGAGGGTA
CATTTCAAGA 39 and 59 CAGCAACATCCGCAGATTTT 39.
mcd1-1 strains were created by popin/popout of pVG257
(Guacci et al. 1997) and the mutation was verified by sequencing. For the chromosome gain assay, we used as
a starting point strains that were previously developed
(Narayanan et al. 2006). These strains were modified by
replacing the inverted Alu repeats with the LYS2 gene.
Heterozygous mating-type diploids were created by transforming MATa haploid cells with a vector containing HO
under a native promoter (YEpHO). Nonmating isolates
were selected and diploid status was confirmed by low
UV mutability of CAN1. MATa/MATa derivatives were then
created by transforming diploid strains with pGAL-HOT,
(HO under Gal10 promoter). Transformants were incubated in galactose media for 6 hr and mating colonies
were selected after assuring that the pGAL-HOT plasmid
was cured. To create CUP1/cup1D diploid strains, we
inserted KanMax cassette using plasmid pFA6 targeted to
the CUP1 locus of our diploid strain background (CS2335
for example) using primers 59GCAGCATGACTTCTTGG
TTTCTTCAGACTTGTTACCGCAGGGGCATTTGTCGTCGCT
GTTACACCCCCGTACGCTGCAGGTCGACGGATCCCC39 and
59ATGTTCAGCGAATTAATTAACTTCCAAAATGAAGGTCATG
AGTGCCAATGCCAATGTGGTAGCTG-ATCGATGAATTCGAG
CTCGTTTTCGA39. For knockout verification primers, 59 CA
TTTCCCAGAGCAGCATGAC 39 and 59 GTTCAGCGAATTAA
TTAACTTCC 39 were used.
General conditions for rate determination of chromosome
gain are described below. Experiments were started by
patching at least six single colonies from each genotype to
YPDA-rich medium followed by incubation overnight in 30°,
including mcd1-1 temperature-sensitive strains (mcd1-1 strains
were grown and maintained at 23° prior to the experiments).
Overnight patches were then spread on selective media
(CuSO4) and diluted samples were spread on synthetic complete media. Putative chromosome gain was indicated by resistance to copper. To restrict the effect of the mcd1-1 mutation
to the growth phase and not to the selection phase, plates were
incubated at 23°. Plates were incubated for 2–4 days.
Chromosome copy number analysis
Copy number was estimated using array comparative
genome hybridization (CGH). Genomic DNA preparation,
labeling, hybridization, and data analysis procedures were
as described earlier (Zhang et al. 2013).
Determination of copper-resistant rate as a measure of
chromosome gain
Undiluted cultures of yeast patches were spread in synthetic
complete media containing 0.9 mM CuSO4. In parallel,
diluted samples were spread in synthetic complete media to
determine the amount of cells in each patch. After 3–4 days
the number of copper-resistant colonies was determined.
For each genotype in the first few experiments, the copperresistant colonies were replica plated to another CuSO4containing plate. The great majority of the resistant colonies
Chromosome Gain in Cohesin Mutants
375
Figure 1 A genetic system to study chromosome gain based on copy number increase of CUP1. CUP1-1 and CUP1-2 were
deleted from their native locus on chromosome VIII. CUP1-1 was inserted into the
telomere proximal site on the short arm of
chromosome V next to the native locus of
CAN1. The strains used here are derived from
previously published strains (Narayanan et al.
2006), but were modified by replacing lys2::
Alu with the LYS2 alleles. Selection for chromosome gain and rate determination were
done mainly on 0.9 mM CuSO4 and for
several experiments with 0.7 mM CuSO4.
While differences in the rates were observed
between the two concentrations, the trend
reflecting the difference between the different genotypes was maintained. We note that this selection system may be too stringent and, therefore, may
underestimate the actual rate of chromosome gain but it is unlikely to suffer from false positive calls, as determined by CGH (Table S1).
were able to grow again on CuSO4 plates after replica
plating.
Results
A genetic system to study chromosome gain
Defects in SCC are expected to affect chromosome gain as
well as loss. Chromosome gain has been addressed primarily
using systems based on haploid cells. We chose to determine
chromosome gain in diploid cells to address the role of
homologous chromosome interactions, segregation defects,
and aneuploidy tolerance. In yeast, the CUP1 gene codes for
copper metallothionein, which protects against excessive
copper (Ecker et al. 1986) and increased copies of CUP1
result in resistance to high copper levels (Fogel and Welch
1982; Resnick et al. 1990). We used a previously developed
strain (Narayanan et al. 2006), where a single copy of CUP1
has been placed near the telomeric CAN1 gene on chromosome V and the natural copy in chromosome VIII is deleted
(Figure 1). Resistance to copper provided selection for gain
in CUP1 copy number and potentially gain of chromosome
V. After modifying the strain (See Materials and Methods)
the resulting cells were sensitive to 0.4 mM CuSO4 and
allowed robust selection for chromosome V gain when yeast
cells were plated to 0.9 mM CuSO4 (or higher).
The vast majority of resistant colonies in our experiments
were due to gain of at least one copy of chromosome V.
Among 33 copper-resistant colonies examined (haploid and
diploid strains and various genetic backgrounds), all
exhibited whole chromosome V gain as determined by
CGH. There were no chromosome V gains in the absence of
copper selection (supporting information, Table S1) among
mcd1-1 diploid cells. No other aberrations on chromosome
V, such as local increased copy number of the locus surrounding CUP1 were observed, although other chromosomes were also gained (discussed below). Importantly,
we did not find any false positives when 0.9 mM CuSO4
was used for selection. Since we cannot exclude some killing
of cells with chromosome V gain, the rates of chromosome
376
S. Covo et al.
gain can be considered as minimal estimates. The median
chromosome gain rates for all genetic backgrounds including 95% confidence of intervals as derived from the rate of
copper resistance are presented in Table S2.
SSC defects and DNA damage facilitate
chromosome gain
There was an increase in the rate of chromosome gain for
SCC defective cells in comparison to wild type (WT). The
increase differed considerably among the mutants. Interestingly, homozygote deletion of WPL1, which has several roles
in regulation of sister chromatid cohesion, had the least
impact on chromosome gain (17-fold over WT, Figure 2).
Homozygous deletion of CTF4 that links SCC establishment
to DNA replication and MCM21 that facilitates SCC around
the centromeres increased chromosome gain 180- and
100-fold over WT, respectively. The greatest effect was
found for a cohesin temperature-sensitive mutant mcd1-1
grown at the semipermissive temperature of 30° (265-fold
increase in chromosome gain over WT) (Figure 2A).
Chromosome behavior can be affected by differences in
physiology between various types of cells or different
stresses. Particularly relevant is exposure of cells to DNA
damage, which can activate dormant cohesin molecules
(Strom et al. 2004, 2007; Unal et al. 2004, 2007, 2008).
Since cohesin mutants show defects in homologous recombination (Covo et al. 2010; Sjogren and Strom 2010) and
since defects in resolution of recombination intermediate
can lead to chromosome gain (Ho et al. 2010; Rodrigue
et al. 2012) the effects of DNA damage and the role of
homologous recombination on chromosome gain in WT
and SCC defective strains were studied. We examined chromosome gain following growth of diploid MATa/MATa cells
on plates containing a low level of the recombinogen methyl
methanesulfonate (MMS; 1 mM). As shown in Figure 2B
and Table S2, the high levels of spontaneous chromosome
gain in the MATa/MATa wpl1D/wpl1D and MATa/MATa
mcd1-1/mcd1-1 mutants were greatly increased by MMS,
based on a comparison of rates between treated and untreated
Figure 2 SCC defects, DNA damage, and homozygous mating type differentially increase chromosome gain rates. (A) Chromosome gain was
measured by copper resistance in MATa/MATa diploid cells (fold increase over WT cells). Shown is the
median of at least six repeats. The error was calculated as 95% confident of intervals and is presented
in Table S2. Number of repeats for fluctuation tests
are as follows: WT and wpl1D, 12; mcd1-1 and
ctf4D, 6; and mcm21D, 7. (B) Effect of DNA damage on chromosome gain in MATa/MATa strains.
Left side, effect of 1 mM MMS (presented in parentheses are the numbers of events/107 cell divisions
that were added in comparison with no MMS treatment). The number of repeats for fluctuation tests
are: WT and mcd1-1, 6 and wpl1D, 9. Right side,
effect of rad51D (in parenthesis is the increase in
events over that measured in RAD51 wild-type
cells). The number of repeats for fluctuation tests
are: wpl1D/rad51D, 18 and rad51D, 6. (C) Effect of
mating type on chromosome gain rates where values were determined for heterozygous and homozygous mating type for WT and SCC defective
strains (the rate for MATa/MATa mcd1-1/mcd1-1
was not measured). The number of repeats for fluctuation tests are: WT a/a, 12; a/a, 14; a/a, 3; wpl1D
a/a, 12; a/a, 9; a/a, 6; and mcd1-1, 6 (homozygous
and hetrozygote matings). (D) Attempts to identify
the pathway responsible for the mating-type effect
on chromosome gain. Nonhomologous end joining
is suppressed in MATa/MATa vs. MATa/MATa
strains. Interhomolog recombination is known to
be less efficient in MATa/MATa vs. MATa/MATa
strains. A connection between aneuploidy and inefficient recombination was previously shown (Ho
et al. 2010). Colony formation under CuSO4 exposure is highly dependent on the copy number of
CUP1 as shown with the CUP1/cup1 heterozygote
(MATa/MATa), indicating that chromosome gain of
CUP1 is the driving event. The number of repeats
for fluctuation tests are as follows: WT, 14; dnl4D,
13; rad52, 14; and CUP1/cup1, 6. (E) SCC defects
and mating type increase the chance to survive high
doses of CuSO4. Cultures were plated directly on
1.5 mM CuSO4 (instead of 0.9 mM) and colonies
were counted after 3 days. The number of repeats
for fluctuation tests are: WT a/a, 6; a/a, 6; mcd1-1
a/a, 7; and a/a, 6.
cells. Importantly, the MMS exposure and SCC defects
resulted in synergistic increases in rates of chromosome
gain. These results are consistent with the view that inefficient sister chromatid recombination in SCC-defective
strains might lead to chromosome gain. Such recombination-associated aneuploidy is expected to depend on the
function of RAD51, a gene that is central to homologous
recombination. However, the rate of spontaneous chromosome gain in MATa/MATa wpl1D/wpl1D rad51D/rad51D
diploid cells was significantly higher than in the wpl1D/
wpl1D single mutant (Figure 2B, Table S2). Homozygous
deletion of RAD51 alone also increased chromosome gain,
although to a lesser extent than in the rad51D/rad51D
wpl1D/wpl1D double mutant (Figure 2, A and B and Table
S2). Just as for MMS, the rad51D homozygous deletion synergized with deletion of WPL1. Attempts to measure chromosome gain in the rad51D/rad51D wpl1D/wpl1D double
mutant failed due to severe DNA damage sensitivity. These
results indicate that recombination intermediates such as joint
molecules are not the major source of aneuploidy in SCC defective strains. However, it is possible that DSBs, nicks, gaps, or
unresolved replication structures (Sofueva et al. 2011) might
lead to chromosome gain, especially in cells defective in SCC.
Mating-type controls of chromosome gain
We also examined the effect of cell type on chromosome
gain. In yeast, changes in mating type greatly affect the
transcriptional program (Galitski et al. 1999). Also, mating
Chromosome Gain in Cohesin Mutants
377
type influences several aspects of chromosome biology. Nonhomologous end joining is active only in haploid or diploid
cells carrying one MAT allele, MATa or MATa, while homologous recombination is more active in heterozygous MATa/
MATa cells (Kegel et al. 2001; Valencia-Burton et al. 2006;
Fung et al. 2009). Therefore, we measured chromosome
gain in a MATa/MATa strain. Surprisingly, for WT and SCC
defective strains, the rate of spontaneous chromosome gain
was increased at least 10-fold in diploids and up to 100-fold
in MATa/MATa compared to MATa/MATa strains, as described in Figure 2C and Table S2. The high levels in the
MATa/MATa strains did not depend on the end-joining gene
DNL4 (end joining is suppressed in MATa/MATa cells)
(Kegel et al. 2001) or on homologous recombination as determined using rad52D/rad52D mutants (Figure 2D and
Table S2).The rates in rad52D/rad52D mutants were
slightly, but statistically significantly, higher than for RAD+
MATa/MATa cells, in agreement with the effect of the rad51
deletion (Figure 2, B and D and Table S2).
The ability to form colonies on the CuSO4-containing
medium was clearly dependent on the copy number of
CUP1 since the rate of formation of copper-resistant colonies
was greatly reduced, from 130 3 1027 to 0.5 3 1027, when
there was only one CUP1 gene (i.e., MATa/MATa CUP1/
CUP1 vs. MATa/MATa CUP1/cup1D; Figure 2D). These
results indicate that the system is highly responsive to an
additional copy of the CUP1 gene, leading us to conclude
that CUP1 copy number gain is the driver of copper resistance in the homozygous MAT diploid strains.
Resistance to high chronic exposure of CuSO4 is much
more frequent in cohesin-deficient cells than in WT
Increased copy number of CUP1 is expected to provide protection against higher levels of CuSO4. We, therefore, investigated the ability of several yeast strains to form colonies
when grown on 1.5 mM of CuSO4.
The rate of colony formation of WT MATa/MATa cells on
1.5 mM CuSO4 was extremely low, ,1029 events per cell
division, as described in Figure 2E and Table S2. Similar to
the results with lower CuSO4 levels, the rate of colony formation was much higher when cells were homozygous for mating
type. Remarkably, there was more than a 10,000-fold rate increase in MATa/MATa mcd1-1/mcd1-1 cells that were resistant to 1.5 mM CuSO4 compared to WT MATa/MATa MCD1/
MCD1. The rate reached nearly 1025/cell/generation. A similar
rate was observed with the MATa/MATa mcd1-1/mcd1-1
strain, possibly indicating that there is a limit to the number
of additional chromosomes that a cell can tolerate (Figure 2E).
We also addressed the ability of cells to tolerate even
higher levels of CuSO4. Unlike for 1.5 mM CuSO4, no
colony-forming units were found among 109 MATa/MATa
mcd1-1/mcd1-1 diploid cells spread on 2 mM CuSO4 plates.
However, highly resistant cells appeared several days after
inoculation of 1.5 mM CuSO4-resistant colonies to liquid
medium containing 2 mM CuSO4 (growth conditions are
described in the legend to Figure 3).
378
S. Covo et al.
Multiple aneuploidy and chromosome amplification in
diploid cohesin mutants chronically exposed to a high
level of CuSO4
Since increased copper resistance as well as the stepwise
adaptation to high CuSO4 exposure was likely due to a change
in chromosome number, we analyzed by array CGH all the
chromosomes from diploid mcd1-1/mcd1-1 copper-resistant
cells grown in 0.9 and 2 mM CuSO4, as described in Table
S1. Typically, array-CGH analyses would compare the chromosome content of a resistant culture that was grown in
CuSO4 liquid media against a copper-sensitive culture that
grew in CuSO4-free medium at permissive temperature (the
reference culture). The array CGH was also performed by
comparing a reference strain to mcd1-1 cells grown at the
semipermissive temperature (without CuSO4) and then
propagated in liquid cultures without CuSO4. In the absence of CuSO4, there was almost no aneuploidy (Table
S1), indicating that partial inactivation of cohesin does
not lead to frequent unselected stable aneuploidy events.
In all cultures of copper-resistant colonies, there was gain
of chromosome V, as described in Table S1. Interestingly, there
was aneuploidy for other chromosomes as well. (Occasionally,
the array-CGH signal indicates a copy number change ,1 n,
for example, 0.75, which is likely due to heterogeneity in the
population). Among 19 cultures of diploid MATa/MATa
mcd1-1/mcd1-1 cells, there were 14 isolates showing a gain
of chromosome II in addition to chromosome V (Figure 3A).
This coincidence of gain was also observed for 11 of 14 other
copper-resistant haploid or diploid isolates of different genotypes (SCC proficient or defective). Altogether, chromosome II
was gained along with chromosome V in 25 of 33 (75%) of all
the resistant cultures examined. The gain of chromosome II in
response to copper is statistically significant. The P-value of
Fisher’s exact test corrected by Bonferroni considering each of
16 chromosomes as an independent hypothesis is 0.0016.
Frequently, chromosomal gain for chromosomes other
than V and II was also detected, as described in Table S1
and Figure 3. Based on results for all genotypes and conditions, chromosomes VII and XI were often increased (13/33
and 14/33, respectively), yet due to the relatively small size
of the sample the P-value of Fisher’s exact test is not significant when corrected to multiple hypotheses.
Chromosome loss events in the copper-resistant cells
were not as frequent as chromosome gain events (22 vs. 83,
excluding gains of chromosome V). However, if the frequently gained chromosomes II, V, VII, and XI are excluded,
there is much less bias (22 vs. 31), suggesting little difference in the probability of gain or loss for infrequent random
events (Figure 3B). There appears to be no correlation between the number of genes on each chromosome and occurrence of either chromosome loss or gain (Figure 3C).
Therefore, we could not observe an effect of the untargeted
gene dosage imbalance. There might be an exception for
chromosome I, which is the smallest and lost more
frequently, and chromosome III, which is gained more often.
Figure 3 Copper-adapted yeast cultures show multiple chromosome
aneuploidy and chromosome amplification. (A) mcd1-1/mcd1-1 (MATa/
MATa) diploid cells were grown
overnight on YPDA plates at 30°,
then spread on either 0.9 or 1.5
mM CuSO4 plates, and incubated
at the permissive temperature of
23° over 3 days. Surviving colonies
were inoculated to 10 ml YPDA
and grown at 23°; survivors of 1.5
mM were grown in 2 mM CuSO4
and those of 0.9 mM were grown
at 0.9 mM. Genomic DNA was isolated, labeled, and hybridized to genomic DNA of cells from a mcd1-1/
mcd1-1 MATa/MATa diploid colony
that was streaked and grown at 23°
for the entire course without any
CuSO4 exposure (the latter is a reference culture). Comparative genome
hybridization analysis (CGH) was
done between experimental and reference cultures using custom-made
Agilent arrays (see Materials and
Methods). For each experimental culture chromosome loss (red) or gain
(blue) events in comparison to the
reference culture are presented. The different shades of blue correspond to the number of chromosomes gained; the actual number of chromosome
copies appears within the table. (B) Incidence of chromosome loss (gray rectangle) and chromosome gain (black triangle) for each chromosome as
determined by CGH analysis for all diploid cultures tested (Table S1). (C) The number of chromosome loss and chromosome gain events as a function of
number of genes on the chromosome; data are pooled from all diploid cells analyzed (for the complete list see Table S1). A nonlinear regression trend
line is shown including R2 values both for chromosome loss and gain. The most frequent events are circled and identified. (D) For each indicated
genotype the number of chromosome V gains is shown for each culture along with the average (horizontal line). Most of the cultures grew in 0.9 mM
CuSO4. Eleven cultures of diploid mcd1-1 were exposed to 2 mM CuSO4.
Finally, the copy number of chromosome V (the target of
selection for copper resistance) was determined. Gain of more
than one copy was frequently observed among the various WT,
mcd1-1, and wpl1D isolates (20/33) resistant to 0.9 and
1.5 mM CuSO4 (Figure 3D, Table S1). Interestingly, in the
diploid MATa/MATa mcd1-1/mcd1-1 cells those were adapted
to grow in 2 mM CuSO4 liquid culture there was a gain of even
more copies of chromosome V. Among 11 highly resistant isolates, there was only 1 that acquired just a single extra chromosome. In the remaining 10 isolates, half of them gained 2
extra chromosomes and half gained at least 3 extra chromosomes, as described in Figure 3C. The karyotype of such cells
resistant to 2 mM CuSO4 dramatically deviates from that of the
normal diploid cells (an example is presented in Figure S1).
The multiple changes in karyotype are reminiscent of the variations in chromosome numbers that can be seen in cancer
cells. The severe imbalanced genome was observed also in
wpl1-deficient diploids exposed to CuSO4, as can be seen in
Table S1 isolates Csra84–87.
Diploid cells are more prone to failure in controlling
chromosome gain caused by genetic defects
Using the copper-resistance system, we found that the rate
of chromosome gain in haploids (MATa) is lower than in
diploid cells (MATa/MATa). While this trend is true for all
strains, the effect is modest in WT strains. In SCC mutants,
the differences are more striking. For example, the rate for
mcd1-1 in haploids vs. diploids is 170 as compared to 2660
events/107 cell divisions (Figure 4A, Table S2). Hence, in
comparison to the haploid cells, there was a further 4-, 5-,
11-, and 17-fold increase in the rates of gain, respectively, in
the diploids as compared to the haploid for the mcd1-1,
mcm21D, ctf4D, and wpl1D cells. The overall diploid effect
for chromosome gain was nearly two orders of magnitude
greater for MATa/MATa vs. MATa strains (compare rates in
Figure 4 and Figure 2C and also Table S2).
As shown in Figure 4A, this diploid effect extends to
other components of chromosome transmission. Loss of
the microtubule protein gene CIN2 and the spindle assembly
checkpoint protein gene MAD1 in haploid cells resulted in
15- and 16-fold increases, respectively, in the rates of chromosome gain. The rates (events/107 cell divisions) in diploids were increased another 44-fold (658/15) and 89-fold
(1433/16). Thus, reduction in the fidelity of chromosome
transmission results in chromosome gain that is greatly increased in diploid cells.
The apparent diploid-dependent chromosome gain may
stem from differential tolerance of chromosome gain,
Chromosome Gain in Cohesin Mutants
379
Figure 4 Diploid-dependent chromosome gain.
Diploid-dependent chromosome gain is revealed
in strains defective in various aspects of chromosome transmission. (A) Rates for MATa haploids
(white bars) and corresponding MATa/MATa diploids (dark bars). Shown is the median of at least
six repeats. The error was calculated as the 95%
confidence interval and is presented in Table S2.
The number of repeats for fluctuation tests are as
follows for haploids: WT and wpl1D, 6; mcd1-1,
14; mcm21D, 9; ctf4D, 8; cin2D, 6; and mad1D, 6
and for diploids: WT and wpl1D, 12; mcd1-1, 6;
mcm21D, 7; ctf4D, 6; cin2D, 8; and mad1D, 8. (B)
Rates for WT and SCC-defective MATa haploids.
Rate determinations were done as described in
Materials and Methods and Figure 2 (number of
repeats as described in A).
especially since there would be a lower gene dosage effect
for chromosome gain in diploids as compared to haploids. To
test this idea, an indicator of chromosome gain tolerance
(tolerance index) was estimated by determining the frequency
of copper-resistant cells within a culture. The tolerance index
for haploid and diploid wpl1D and WT (only data for wpl1D is
presented) strains was evaluated under three scenarios. First
it was determined directly in 3–6 copper-resistant colonies
freshly harvested from CuSO4-containing media. The chromosome gain tolerance index was close to 1 (i.e., most of the
cells in the colony were resistant) for haploid- and diploidresistant colonies (Figure S2A). Second, the tolerance index
was determined for cultures propagated from several CuSO4resistant colonies in the absence of CuSO4. As seen in Figure
S2A, no major difference was observed between haploid and
diploid cells. Finally, copper-resistant colonies were diluted
and spread to media lacking CuSO4. This was followed by
suspending several (8–16) colonies that arose and spotting
them to CuSO4 and CuSO4-free media (Figure S2B). No major difference between haploid and diploid CuSO4 tolerance
was observed (similar amounts of cells grew on media with
and without CuSO4). We conclude that chromosome gain is
well tolerated both in diploids and haploids for at least 25
generations (the number of generations from a single cell to
a colony).
Interestingly, the rates of chromosome gain in wpl1D and
WT haploids were comparable (Figure 4B). The lack of impact by the wpl1D mutation is surprising since wpl1D cells
have higher rates of chromosome gain and loss in diploid cells
than WT cells as described above (Figure 3 and S. Covo,
D. A. Gordenin and M. A. Resnick, unpublished results)
Discussion
Cohesin cohesion and chromosome gain
In this study, we have examined the role of various genes
involved with SCC, ploidy, and mating type in preventing
aneuploidy due to chromosome gain. Specifically, we
focused on the broader effect of defects in SCC on the
karyotype of cells under stress. The chromosome gain rates
380
S. Covo et al.
obtained here for the different mutants in SCC are not
statistically different from the rates we calculated for
chromosome loss with the same mutants (S. Covo, unpublished results). Defects in the establishment of sister
chromatid cohesion lead to chromosome gain as shown in
ctf4Δ cells (Figure 2 and Figure 4). Defects in cohesion per
se result in premature chromatid separation before the bipolar attachment is established, which may lead to a random
segregation of the two chromatids, increasing the chance
that both chromatids will migrate to the same daughter cell.
Thus, one daughter cell gains a chromosome and the other
loses one (Figure 1). mcm21Δ strains exhibit proficient SCC
across the chromosome but show very similar rates of chromosome gain, suggesting that the cohesin activity around
the centromeres is at least as important in preventing chromosome gain as chromosome-wide SCC. This is in agreement with the important role of cohesin and MCM21 in
imposing steric constraints on kinetochore orientation to
ensure biorientation. In mcm21-deficient cells, the chromatids do not migrate randomly, rather the kinetochore has
high probability to be attached to the wrong pole. We suggest that defects in cohesin itself cause much higher rates of
chromosome gain because both the centromeric and the
SCC functions are compromised (Figure 2A and Figure 4),
and, therefore, the probability of both premature separation
and aberrant attachment of the kinetochore is raised. In
addition, as shown in Figure 2, deficiency of RAD51 or
RAD52 increases the risk of chromosome gain and, therefore, the defects of mcd1-1 in homologous recombination
may also contribute to the high rate of chromosome gain.
Yet, the contribution of homologous recombination function
in a SCC mutant is hard to tease apart, until a mutant in
cohesin that is only defective in DNA repair is isolated, because as seen in Figure 2, defects in recombination and
defects in SCC synergize. Surprisingly, deletion of WPL1
affects chromosome gain to a much lesser extent in diploid
cells and has no effect in haploid cells (Figure 2 and Figure
4).
Defects in sister chromatid cohesion are measured at the
cellular level by the separation of florescent markers attached
to the chromosomes (i.e., sister chromatid separation). ctf4D
cells exhibit increased sister chromatid separation (for
example, see Borges et al. 2013), which is translated to a high
rate of chromosome gain (Figure 2 and Figure 4). Deletion of
WPL1 has been shown to increase somewhat sister chromatid
separation as well as decrease cohesin attachment to chromatin (Rowland et al. 2009; Sutani et al. 2009; Maradeo and
Skibbens 2010).When compared directly, sister chromatid
separation was reduced in wpl1D relative to ctf4D (Borges
et al. 2013); based on that fact alone, the effect on chromosome transmission should be less profound in wpl1D than
ctf4D . Yet, WPL1 is supposed to contribute to the fidelity of
chromatid transmission also by preventing SCC establishment
at G2. The fact that wpl1D/wpl1D cells show only modest
increase in chromosome gain rates suggests that deactivation
of the antiestablishment function of Wpl1p has relatively low
or no impact on the fidelity of chromosome transmission.
DNA damage synergistically interacts with SCC defects
to increase chromosome gain but not through
unresolved recombination intermediates
Recently it was shown that unresolved recombination
intermediates can cause chromosome gain, specifically due
to inability to resolve joint molecules that were generated by
Rad51p activity (Acilan et al. 2007; Ho et al. 2010). Defects
in SCC may increase the prevalence of such intermediates
because of the role of SCC in recombination. We hypothesized that the increased recombination between homologous chromosomes in SCC mutants may result in delayed
recombination intermediates. Indeed, we found that the
recombinogenic agent MMS greatly increased chromosome
gain in SCC mutants (Figure 2B). However, Rad51p-dependent
recombination intermediates are not required for chromosome gain as demonstrated for wpl1D/wpl1D rad51D/
rad51D diploids and MATa/MATa rad52D/rad52D mutants
(Figure 2). While the role of SCC in homologous recombination is not clear yet, we suggest based on these observations that SCC is not an important determinant in the
efficiency of resolution of recombination intermediates.
The nature of the MMS-derived lesions that exacerbate
chromosome gain in SCC defective strains remains to be
determined. One possibility is that DNA damage-induced
separase, which removes established cohesin molecules
(McAleenan et al. 2013), may cause premature chromatid
separation especially in SCC defective strains. Alternatively,
while unrepaired chromosomes activate the checkpoint response, this activation is transient and is eventually shut
down. The segregation of unrepaired chromosomes (gaps,
breaks) may be less accurate.
Mating type and ploidy along with defects in
chromosome transmission increase the risk of
chromosome gain
Interestingly, the rate of chromosome gain is greatly affected
by mating type (Figure 2 C). The reason for the difference
remains to be established, although many genes are under
mating-type control in yeast (Galitski et al. 1999). Several
genes associated with mitosis, such as components of the
aurora kinase and the Ndc80 complex are underexpressed
in MATa/MATa cells (Galitski et al. 1999). Whatever the
reasons, the mating-type effects on chromosome stability
have important implications. For example, in scenarios
where diploid pathogenic yeast become homozygous for
mating type, there might be opportunities for greater resistance to drug challenges. It was previously shown that aneuploidy in pathogenic Candida albicans can lead to drug
resistance (Selmecki et al. 2006).
SCC malfunction increases genome plasticity and allows
adaption to stress
To our knowledge, this study provides the first description of
how defects in SCC can be beneficial via genome instability
to the toxic effects of an environmental chemical. Compared
to WT, the SCC showed increased survival rates to CuSO4
due to genomic changes. Previously, copper resistance was
attributed to various modes of copy number increase in the
CUP1 gene, including CUP1 amplification, but in these cases
the amplification of CUP1 was derived by cis-DNA elements
such as inverted repeats (Fogel and Welch 1982; Narayanan
et al. 2006). In contrast, here the only mode of CUP1 copy
increase was through whole chromosome gain without any
adjacent DNA sequence that destabilizes the CUP1 locus
(Table S1). This is despite the collateral effects of unbalanced expression of many genes (Torres et al. 2007,
2008). Importantly, chromosomes could undergo considerable amplification, increasing by up to four chromosomes in
a diploid cell (i.e., a total of six copies).
In agreement with the reduction in chromosome transmission fidelity, other chromosomes were gained as well, the
most frequent being chromosome II (75% of the chromosome V gain events). We consider several possible overlapping hypotheses that provide likely explanations for the
frequent gain of chromosome II. In the first, chromosome II
is gained because it harbors genes that facilitate tolerance of
copper (such as BSD2, SCO1, and SCO2). In the second,
chromosome II is gained to counterbalance a specific imbalance created by gain of chromosome V either at the proteomic level or in the geometry of the spindle pole body. We
obtained preliminary results using a system similar to that
presented here but in which selection for gain of chromosome copy number is based on selection in only 0.15 mM
CuSO4 in combination with formaldehyde (J. L. Argueso,
unpublished results). In this system co-gain of chromosome
II and V is far less frequent, indicating that copper exposure
drives co-gain of chromosome II and V. An alternative mechanism to how copper may shape the pattern of aneuploidy is
by reducing the fidelity of specific chromosomes (in this
case, chromosome II).
Ploidy effect on chromosome gain
Finally, we found that diploid cells defective in chromosome
transmission are able to form copper-resistant colonies at
Chromosome Gain in Cohesin Mutants
381
a much higher rate than their haploid counterparts. However, the natural diploid yeast (MATa/MATa) shows only
a modest diploid-dependent increase in chromosome gain.
The diploid-dependent chromosome gain appears to be
a general phenomenon that can be revealed under stress
to chromosome transmission since it is observed in mutants
defective in SCC, spindle body checkpoint (mad1D), or tubulin filament formation (cin2D) (Figure 4A). There are
several possibilities to explain the diploid-dependent chromosome gain. Diploids might tolerate aneuploidy better
than haploids because of milder gene dosage effects, although we could not find support for this notion. There
was no diploid-dependent tolerance of aneuploidy based
on our observation that both haploid and diploid cultures
contained comparable fractions of copper-resistant cells
even when the cultures were grown on media lacking
CuSO4 (Figure S2). Alternatively, there are diploid-dependent effects relating to the fidelity of chromosome transmission itself rather than aneuploidy tolerance. As a support to
this notion, cells deficient in kinetochore functions, such as
dam1-10 and spc110-1, show temperature sensitivity that is
diploid dependent (Storchova et al. 2006). Scaling up the
ploidy may cause defects in chromosome transmission as
shown for tetraploid vs. diploids (Mayer and Aguilera
1990; Storchova et al. 2006). Another parallel between haploid vs. diploids and a further scale up to tetraploids is the
combined effect of ploidy change and mutation in SCC
(Storchova et al. 2006). Most ascomycota fungi are found
as haploids in nature although they can go through a diploid
cycle. S. cerevisiae, which is also an ascomycete, is actually
stable as a diploid (Gerstein et al. 2006; Nishant et al. 2010).
Our results suggest that heterozygous mating type counteracts the effect of ploidy increase, probably through changes
in gene expression.
Overall, we observed that even mild defects in SCC
increase significantly the chance of beneficial gain of
multiple chromosomes under selective pressure. The stability of aberrant karyotypes, which might be a “quick and
temporary fix” (Yona et al. 2012) needs to be determined.
Regardless, given the impact of SCC on chromosome gain,
we propose that hypomorphic or even temporary defects in
the SCC pathway may have a significant role in adaptive
evolution and disease, such as cancer.
Acknowledgments
We thank Kerry Bloom for discussion of the results and
useful advice. We greatly appreciate the critical evaluation
of the manuscript by Jessica Williams and Thuy-Ai Nguyen.
This work was supported by the Intramural Research Program of the National Institute of Environmental Sciences
(National Institutes of Health, Department of Health and
Human Services) under project 1Z01ES065073 (to M.A.R.),
American Cancer Society grant ACS IRG no. 57-001-53,
and a Webb-Waring Biomedical Research Award from the
Boettcher Foundation (to J.L.A.).
382
S. Covo et al.
Literature Cited
Acilan, C., D. M. Potter, and W. S. Saunders, 2007 DNA repair
pathways involved in anaphase bridge formation. Genes Chromosomes Cancer 46: 522–531.
Bauerschmidt, C., C. Arrichiello, S. Burdak-Rothkamm, M.
Woodcock, M. A. Hill et al., 2010 Cohesin promotes the
repair of ionizing radiation-induced DNA double-strand breaks
in replicated chromatin. Nucleic Acids Res. 38: 477–487.
Borges, V., D. J. Smith, I. Whitehouse, and F. Uhlmann, 2013 An
Eco1-independent sister chromatid cohesion establishment
pathway in S. cerevisiae. Chromosoma 122: 121–134.
Bose, T., and J. L. Gerton, 2010 Cohesinopathies, gene expression, and chromatin organization. J. Cell Biol. 189: 201–210.
Chandhok, N. S., and D. Pellman, 2009 A little CIN may cost a lot:
Revisiting aneuploidy and cancer. Curr. Opin. Genet. Dev. 19:
74–81.
Covo, S., J. W. Westmoreland, D. A. Gordenin, and M. A. Resnick,
2010 Cohesin is limiting for the suppression of DNA damage–
induced recombination between homologous chromosomes.
PLoS Genet. 6: e1001006.
Ecker, D. J., T. R. Butt, E. J. Sternberg, M. P. Neeper, C. Debouck
et al., 1986 Yeast metallothionein function in metal ion detoxification. J. Biol. Chem. 261: 16895–16900.
Eckert, C. A., D. J. Gravdahl, and P. C. Megee, 2007 The enhancement of pericentromeric cohesin association by conserved
kinetochore components promotes high-fidelity chromosome
segregation and is sensitive to microtubule-based tension. Genes
Dev. 21: 278–291.
Fogel, S., and J. W. Welch, 1982 Tandem gene amplification mediates copper resistance in yeast. Proc. Natl. Acad. Sci. USA 79:
5342–5346.
Fung, C. W., A. M. Mozlin, and L. S. Symington,
2009 Suppression of the double-strand-break-repair defect of
the Saccharomyces cerevisiae rad57 mutant. Genetics 181:
1195–1206.
Galitski, T., A. J. Saldanha, C. A. Styles, E. S. Lander, and G. R. Fink,
1999 Ploidy regulation of gene expression. Science 285: 251–
254.
Gerstein, A. C., H.-J. E. Chun, A. Grant, and S. P. Otto,
2006 Genomic convergence toward diploidy in Saccharomyces
cerevisiae. PLoS Genet. 2: e145.
Glynn, E. F., P. C. Megee, H. G. Yu, C. Mistrot, E. Unal et al.,
2004 Genome-wide mapping of the cohesin complex in the
yeast Saccharomyces cerevisiae. PLoS Biol. 2: E259.
Guacci, V., and D. Koshland, 2012 Cohesin-independent segregation of sister chromatids in budding yeast. Mol. Biol. Cell 23:
729–739.
Guacci, V., D. Koshland, and A. Strunnikov, 1997 A direct link
between sister chromatid cohesion and chromosome condensation revealed through the analysis of MCD1 in S. cerevisiae. Cell
91: 47–57.
Hartwell, L. H., and D. Smith, 1985 Altered fidelity of mitotic
chromosome transmission in cell cycle mutants of S. cerevisiae.
Genetics 110: 381–395.
Heidinger-Pauli, J. M., E. Unal, V. Guacci, and D. Koshland,
2008 The kleisin subunit of cohesin dictates damage-induced
cohesion. Mol. Cell 31: 47–56.
Heidinger-Pauli, J. M., E. Unal, and D. Koshland, 2009 Distinct
targets of the Eco1 acetyltransferase modulate cohesion in S
phase and in response to DNA damage. Mol. Cell 34: 311–321.
Heidinger-Pauli, J. M., O. Mert, C. Davenport, V. Guacci, and D.
Koshland, 2010 Systematic reduction of cohesin differentially
affects chromosome segregation, condensation, and DNA repair.
Curr. Biol. 20: 957–963.
Ho, C. K., G. Mazon, A. F. Lam, and L. S. Symington, 2010 Mus81
and Yen1 promote reciprocal exchange during mitotic
recombination to maintain genome integrity in budding
yeast. Mol. Cell 40: 988–1000.
Ivanov, D., A. Schleiffer, F. Eisenhaber, K. Mechtler, C. H. Haering
et al., 2002 Eco1 is a novel acetyltransferase that can acetylate
proteins involved in cohesion. Curr. Biol. 12: 323–328.
Kegel, A., J. O. Sjöstrand, and S. U. Aström, 2001 Nej1p, a cell
type-specific regulator of nonhomologous end joining in yeast.
Curr. Biol. 11: 1611–1617.
Kim, J. S., T. B. Krasieva, V. LaMorte, A. M. Taylor, and K. Yokomori,
2002a Specific recruitment of human cohesin to laser-induced
DNA damage. J. Biol. Chem. 277: 45149–45153.
Kim, S. T., B. Xu, and M. B. Kastan, 2002b Involvement of the
cohesin protein, Smc1, in Atm-dependent and independent responses to DNA damage. Genes Dev. 16: 560–570.
Lengronne, A., J. McIntyre, Y. Katou, Y. Kanoh, K.-P. Hopfner
et al., 2006 Establishment of sister chromatid cohesion at
the S. cerevisiae replication fork. Mol. Cell 23: 787–799.
Lopez-Serra, L., A. Lengronne, V. Borges, G. Kelly, and F. Uhlmann,
2013 Budding yeast Wapl controls sister chromatid cohesion
maintenance and chromosome condensation. Curr. Biol. 23: 64–
69.
Maradeo, M. E., and R. V. Skibbens, 2010 Replication factor C
complexes play unique pro- and anti-establishment roles in sister chromatid cohesion. PLoS ONE 5: e15381.
Mayer, V. W., and A. Aguilera, 1990 High levels of chromosome
instability in polyploids of Saccharomyces cerevisiae. Mutat.
Res. 231: 177–186.
McAleenan, A., A. Clemente-Blanco, V. Cordon-Preciado, N. Sen,
M. Esteras et al., 2013 Post-replicative repair involves
separase-dependent removal of the kleisin subunit of cohesin.
Nature 493: 250–254.
Nakai, W., J. Westmoreland, E. Yeh, K. Bloom, and M. A. Resnick,
2011 Chromosome integrity at a double-strand break requires
exonuclease 1 and MRX. DNA Repair (Amst.) 10: 102–110.
Narayanan, V., P. A. Mieczkowski, H. M. Kim, T. D. Petes, and K. S.
Lobachev, 2006 The pattern of gene amplification is determined by the chromosomal location of hairpin-capped breaks.
Cell 125: 1283–1296.
Ng, T. M., W. G. Waples, B. D. Lavoie, and S. Biggins,
2009 Pericentromeric sister chromatid cohesion promotes kinetochore biorientation. Mol. Biol. Cell 20: 3818–3827.
Nishant, K. T., W. Wei, E. Mancera, J. L. Argueso, A. Schlattl et al.,
2010 The baker’s yeast diploid genome is remarkably stable in
vegetative growth and meiosis. PLoS Genet. 6: e1001109.
Oikawa, K., T. Ohbayashi, T. Kiyono, H. Nishi, K. Isaka et al.,
2004 Expression of a novel human gene, human wings
apart-like (hWAPL), is associated with cervical carcinogenesis
and tumor progression. Cancer Res. 64: 3545–3549.
Onn, I., J. M. Heidinger-Pauli, V. Guacci, E. Unal, and D. E.
Koshland, 2008 Sister chromatid cohesion: a simple concept
with a complex reality. Annu. Rev. Cell Dev. Biol. 24: 105–129.
Oromendia, A. B., S. E. Dodgson, and A. Amon, 2012 Aneuploidy
causes proteotoxic stress in yeast. Genes Dev. 26: 2696–2708.
Ortiz, J., O. Stemmann, S. Rank, and J. Lechner, 1999 A putative
protein complex consisting of Ctf19, Mcm21, and Okp1 represents a missing link in the budding yeast kinetochore. Genes
Dev. 13: 1140–1155.
Pavelka, N., G. Rancati, J. Zhu, W. D. Bradford, A. Saraf et al.,
2010 Aneuploidy confers quantitative proteome changes and
phenotypic variation in budding yeast. Nature 468: 321–325.
Pfau, S. J., and A. Amon, 2012 Chromosomal instability and aneuploidy in cancer: from yeast to man. EMBO Rep. 13: 515–527.
Poddar, A., N. Roy, and P. Sinha, 1999 MCM21 and MCM22, two
novel genes of the yeast Saccharomyces cerevisiae are required
for chromosome transmission. Mol. Microbiol. 31: 349–360.
Reid, R. J. D., I. Sunjevaric, W. P. Voth, S. Ciccone, W. Du et al.,
2008 Chromosome-scale genetic mapping using a set of 16
conditionally stable Saccharomyces cerevisiae chromosomes. Genetics 180: 1799–1808.
Resnick, M. A., J. Westmoreland, and K. Bloom, 1990 Heterogeneity
and maintenance of centromere plasmid copy number in Saccharomyces cerevisiae. Chromosoma 99: 281–288.
Rodrigue, A., Y. Coulombe, K. Jacquet, J.-P. Gange, C. Roques
et al., 2012 The RAD51 paralogs ensure cellular protection
against mitotic defects and aneuploidy. J. Cell Sci. 126(Pt 1):
348–359.
Rolef Ben-Shahar, T., S. Heeger, C. Lehane, P. East, H. Flynn et al.,
2008 Eco1-dependent cohesin acetylation during establishment of sister chromatid cohesion. Science 321: 563–566.
Rowland, B. D., M. B. Roig, T. Nishino, A. Kurze, P. Uluocak et al.,
2009 Building sister chromatid cohesion: smc3 acetylation
counteracts an antiestablishment activity. Mol. Cell 33: 763–
774.
Selmecki, A., A. Forche, and J. Berman, 2006 Aneuploidy and
isochromosome formation in drug-resistant Candida albicans.
Science 313: 367–370.
Selmecki, A. M., K. Dulmage, L. E. Cowen, J. B. Anderson, and J.
Berman, 2009 Acquisition of aneuploidy provides increased
fitness during the evolution of antifungal drug resistance. PLoS
Genet. 5: e1000705.
Semighini, C. P., A. F. Averette, J. R. Perfect, and J. Heitman,
2011 Deletion of Cryptococcus neoformansAIF ortholog promotes chromosome aneuploidy and fluconazole-resistance in
a metacaspase-independent manner. PLoS Pathog. 7: e1002364.
Sheltzer, J. M., and A. Amon, 2011 The aneuploidy paradox: costs
and benefits of an incorrect karyotype. Trends Genet. 27: 446–
453.
Sjogren, C., and K. Nasmyth, 2001 Sister chromatid cohesion is
required for postreplicative double-strand break repair in Saccharomyces cerevisiae. Curr. Biol. 11: 991–995.
Sjogren, C., and L. Strom, 2010 S-phase and DNA damage activated establishment of sister chromatid cohesion–importance
for DNA repair. Exp. Cell Res. 316: 1445–1453.
Skibbens, R. V., 2009 Establishment of sister chromatid cohesion.
Curr. Biol. 19: R1126–R1132.
Sofueva, S., F. Osman, A. Lorenz, R. Steinacher, S. Castagnetti
et al., 2011 Ultrafine anaphase bridges, broken DNA and illegitimate recombination induced by a replication fork barrier.
Nucleic Acids Res. 39: 6568–6584.
Solomon, D. A., T. Kim, L. A. Diaz-Martinez, J. Fair, A. G. Elkahloun
et al., 2011 Mutational inactivation of STAG2 causes aneuploidy in human cancer. Science 333: 1039–1043.
Song, W., and T. D. Petes, 2012 Haploidization in Saccharomyces
cerevisiae induced by a deficiency in homologous recombination.
Genetics 191: 279–284.
Spencer, F., S. L. Gerring, C. Connelly, and P. Hieter, 1990 Mitotic
chromosome transmission fidelity mutants in Saccharomyces cerevisiae. Genetics 124: 237–249.
Stephens, A. D., J. Haase, L. Vicci, R. M. Taylor, and K. Bloom,
2011 Cohesin, condensin, and the intramolecular centromere
loop together generate the mitotic chromatin spring. J. Cell Biol.
193: 1167–1180.
Stephens, A. D., R. A. Haggerty, P. A. Vasquez, L. Vicci, C. E. Snider
et al., 2013 Pericentric chromatin loops function as a nonlinear
spring in mitotic force balance. J. Cell Biol. 200: 757–772.
Stirling, P., M. Crisp, M. Basrai, C. Tucker, M. Dunham et al.,
2012 Mutability and mutational spectrum of chromosome
transmission fidelity genes. Chromosoma 121: 263–275.
Stirling, P. C., M. S. Bloom, T. Solanki-Patil, S. Smith,
P. Sipahimalani et al., 2011 The complete spectrum of yeast
chromosome instability genes identifies candidate CIN cancer
genes and functional roles for ASTRA complex components.
PLoS Genet. 7: e1002057.
Chromosome Gain in Cohesin Mutants
383
Storchova, Z., A. Breneman, J. Cande, J. Dunn, K. Burbank et al.,
2006 Genome-wide genetic analysis of polyploidy in yeast.
Nature 443: 541–547.
Strom, L., H. B. Lindroos, K. Shirahige, and C. Sjogren,
2004 Postreplicative recruitment of cohesin to double-strand
breaks is required for DNA repair. Mol. Cell 16: 1003–1015.
Strom, L., C. Karlsson, H. B. Lindroos, S. Wedahl, Y. Katou et al.,
2007 Postreplicative formation of cohesion is required for repair and induced by a single DNA break. Science 317: 242–245.
Sutani, T., T. Kawaguchi, R. Kanno, T. Itoh, and K. Shirahige,
2009 Budding yeast Wpl1(Rad61)-Pds5 complex counteracts sister
chromatid cohesion-establishing reaction. Curr. Biol. 19: 492–497.
Tan, Z., M. Hays, G. A. Cromie, E. W. Jeffery, A. C. Scott et al.,
2013 Aneuploidy underlies a multicellular phenotypic switch.
Proc. Natl. Acad. Sci. USA 110: 12367–12372.
Tittel-Elmer, M., A. Lengronne, M. B. Davidson, J. Bacal, P. Francois
et al., 2012 Cohesin association to replication sites depends on
rad50 and promotes fork restart. Mol. Cell 48: 98–108.
Torres, E. M., T. Sokolsky, C. M. Tucker, L. Y. Chan, M. Boselli et al.,
2007 Effects of aneuploidy on cellular physiology and cell division in haploid yeast. Science 317: 916–924.
Torres, E. M., B. R. Williams, and A. Amon, 2008 Aneuploidy:
cells losing their balance. Genetics 179: 737–746.
Unal, E., A. Arbel-Eden, U. Sattler, R. Shroff, M. Lichten et al.,
2004 DNA damage response pathway uses histone modification to assemble a double-strand break-specific cohesin domain.
Mol. Cell 16: 991–1002.
Unal, E., J. M. Heidinger-Pauli, and D. Koshland, 2007 DNA
double-strand breaks trigger genome-wide sister-chromatid cohesion through Eco1 (Ctf7). Science 317: 245–248.
Unal, E., J. M. Heidinger-Pauli, W. Kim, V. Guacci, I. Onn et al.,
2008 A molecular determinant for the establishment of sister
chromatid cohesion. Science 321: 566–569.
384
S. Covo et al.
Valencia-Burton, M., M. Oki, J. Johnson, T. A. Seier, R. Kamakaka
et al., 2006 Different mating-type-regulated genes affect the
DNA repair defects of Saccharomyces RAD51, RAD52, and
RAD55 mutants. Genetics 174: 41–55.
Weaver, B. A. A., A. D. Silk, C. Montagna, P. Verdier-Pinard, and
D. W. Cleveland, 2007 Aneuploidy acts both oncogenically
and as a tumor suppressor. Cancer Cell 11: 25–36.
Williams, B. R., V. R. Prabhu, K. E. Hunter, C. M. Glazier, C. A.
Whittaker et al., 2008 Aneuploidy affects proliferation and
spontaneous immortalization in mammalian cells. Science
322: 703–709.
Wu, N., X. Kong, Z. Ji, W. Zeng, P. R. Potts et al., 2012 Scc1
sumoylation by Mms21 promotes sister chromatid recombination through counteracting Wapl. Genes Dev. 26: 1473–1485.
Xiong, B., and J. L. Gerton, 2010 Regulators of the cohesin network. Annu. Rev. Biochem. 79: 131–153.
Yona, A. H., Y. S. Manor, R. H. Herbst, G. H. Romano, A. Mitchell
et al., 2012 Chromosomal duplication is a transient evolutionary solution to stress. Proc. Natl. Acad. Sci. USA 109: 21010–
21015.
Yuen, K. W. Y., C. D. Warren, O. Chen, T. Kwok, P. Hieter et al.,
2007 Systematic genome instability screens in yeast and their
potential relevance to cancer. Proc. Natl. Acad. Sci. USA 104:
3925–3930.
Zhang, H., A. F. B. Zeidler, W. Song, C. M. Puccia, E. Malc et al.,
2013 Gene copy number variation (CNV) in haploid and diploid strains of the yeast Saccharomyces cerevisiae. Genetics 193:
785–801.
Zhang, J., X. Shi, Y. Li, B. J. Kim, J. Jia et al., 2008 Acetylation of
Smc3 by Eco1 is required for S phase sister chromatid cohesion
in both human and yeast. Mol. Cell 31: 143–151.
Communicating editor: J. Sekelsky
GENETICS
Supporting Information
http://www.genetics.org/lookup/suppl/doi:10.1534/genetics.113.159202/-/DC1
The Sister Chromatid Cohesion Pathway Suppresses
Multiple Chromosome Gain and
Chromosome Amplification
Shay Covo, Christopher M. Puccia, Juan Lucas Argueso, Dmitry A. Gordenin, and Michael A. Resnick
Copyright © 2014 by the Genetics Society of America
DOI: 10.1534/genetics.113.159202
Figure S1 Copper resistant mcd1-1/mcd1-1 culture exhibits an unbalanced karyotype. A colony was selected, propagated and
analyzed by array-CGH as described in the text, the legend to Figure 3 and in Materials and Methods.
2 SI
S. Covo et al.
Figure S2 Comparable aneuploidy tolerance in haploid and diploid cells. The proportion of copper resistant cells under 3
growth scenarios was determined to assess aneuploidy tolerance. A. Immediate. Determine the amount of copper resistant
cells within colonies that arose on CuSO4-containing plates by suspending the cells within three individual colonies. Outgrown.
Three to six copper resistant colonies were outgrown on media lacking CuSO4 and cells were collected and plated to CuSO4
containing and CuSO4 free plates. B. Copper resistant colonies were diluted and spread over CuSO4 free media. Eight to sixteen
descendent colonies were then suspended in water followed by 10-fold serial dilutions. The cells from each well were then
plated using a pronging device to CuSO4-containing and CuSO4-free media. An example of the results is presented. While for
most colonies there was no significant different in growth between CuSO4 containing or CuSO4 free media, for two diploid
colonies differences were observed; an example is shown in the boxed serial dilution.
S. Covo et al.
3 SI
Table S1 Karyotype of copper resistant colonies as determined by CGH. CGH analysis of 33 of copper-resistant and 8 copper
sensitive cultures, categorized by genotype, mating type and copper exposure. For haploid cells green indicates chromosome
gain in comparison to the reference genome (see details in the text). For diploid cells different shades of blue mark
chromosome gain (Dark blue corresponds with high copy number of chromosomes). Red marks chromosome loss.
Available for download at http://www.genetics.org/lookup/suppl/doi:10.1534/genetics.113.159202/-/DC1
4 SI
S. Covo et al.
Table S2 Rates of resistance to copper
Genotype
Ploidy
MAT
CuSO4 (mM)
(Events /107 Cell
95% CI
Figure
divisions)
WT
2
a/α
0.9
3
(3-4)
2A
mcd1-1
2
a/α
0.9
2661
(663-6534)
2A
wpl1Δ
2
a/α
0.9
49
(46-71)
2A
ctf4Δ
2
a/α
0.9
541
(52-541)
2A
mcm21Δ
2
a/α
0.9
319
(153-319)
2A
WT
2
a/α
0.9, MMS
8
(4-8)
2B
mcd1-1
2
a/α
0.9, MMS
10354
(10354-18355)
2B
wpl1Δ
2
a/α
0.9, MMS
350
(171-579)
2B
rad51Δ
2
a/α
0.9
12
(7-20)
2B
wpl1Δ rad51Δ
2
a/α
0.9
565
(135-962)
2B
WT
2
a/a
0.9
130
(90-130)
2C
WT
2
α/α
0.9
61
(50-65)
2C
mcd1-1
2
a/a
0.9
16560
(13650-36500)
2C
wpl1Δ
2
a/a
0.9
1591
(587-5302)
2C
wpl1Δ
2
α/α
0.9
289
(60-2295)
2C
dnl4Δ
2
a/a
0.9
175
(100-200)
2D
rad52Δ
2
a/a
0.9
235
(146-390)
2D
CUP1/cup1Δ
2
a/a
0.9
0.5
(*-1)
2D
WT
2
a
1.5
0.5
(0.2-0.9)
2E
WT
2
a/α
1.5
*
mcd1-1
2
a
1.5
71
(50-97)
2E
mcd1-1
2
a/α
1.5
77
(18-502)
2E
WT
1
a
0.9
1
(0.5-1)
4A&B
mcd1-1
1
a
0.9
169
(55-254)
4A&B
wpl1Δ
1
a
0.9
1
(0.7-1)
4A&B
ctf4Δ
1
a
0.9
27
(17-61)
4A&B
mcm21Δ
1
a
0.9
27
(17-43)
4A&B
cin2Δ
1
a
0.9
15
(4-29)
4A
cin2Δ
2
a/α
0.9
658
(161-1897)
4A
mad1Δ
1
a
0.9
16
(13-38)
4A
mad1Δ
2
a/α
0.9
1433
(347-2220)
4A
2E
Cells from different genotypes were grown on YPDA or YPDA+ MMS plates then spread on 0.9 mM or 1.5 mM CuSO4 containing
plates (see Material and Methods).* indicates for rate lower than 5/10-8 events/cell division.
S. Covo et al.
5 SI