Genetics: Published Articles Ahead of Print, published on October 3, 2005 as 10.1534/genetics.105.044495
SER-7, a Caenorhabditis elegans 5-HT7-like receptor, is essential for the 5-HT
stimulation of pharyngeal pumping and egg-laying
Robert J. Hobson*, Vera M. Hapiak*, Hong Xiao*, Kara L. Buehrer†, Patricia R.
Komuniecki and Richard W. Komuniecki*
*
Department of Biological Sciences
University of Toledo, Toledo, Ohio 43606-3390 USA
†
Department of Biomedical Engineering
Case Western Reserve University,
Cleveland, Ohio 44106 USA
1
Running Title: SER-7 regulates feeding and egg-laying
Keywords: C. elegans; serotonin; G-protein coupled receptor; pharyngeal pumping; egglaying
To whom correspondence should be addressed:
Richard W. Komuniecki
Department of Biological Sciences,
Mail Stop 601,
University of Toledo,
2801 W. Bancroft Street,
Toledo, Ohio 43606-3390 USA
[email protected]
Abbreviations used: 5-CT, 5-carboxamidotryptamine; EPG, electropharyngeogram;
GFP, green fluorescent protein; GPCR, G-protein coupled receptor; HSN, hermaphrodite
specific neuron; 5-HT, 5-hydroxytryptamine; LSD, Lisergic acid diethylamide; 5-MeOT,
5-methoxytryptamine; PKA, protein kinase A; PKC protein kinase C.
2
ABSTRACT
Serotonin (5-HT) stimulates both pharyngeal pumping and egg-laying in
Caenorhabditis elegans. Four distinct 5-HT receptors have been partially characterized,
but little is known about their function in vivo. SER-7 exhibits most sequence identity to
the mammalian 5-HT7 receptors and couples to a stimulation of adenyl cyclase when
expressed in COS-7 cells. However, many 5-HT7 specific agonists have low affinity for
SER-7. 5-HT fails to stimulate pharyngeal pumping and the firing of the MC
motorneurons in animals containing the putative ser-7(tm1325) and ser-7(tm1728) null
alleles. In addition, although pumping on bacteria is up-regulated in ser-7(tm1325)
animals, pumping is more irregular. A similar failure to maintain “fast pumping” on
bacteria also was observed in ser-1(ok345) and tph-1(mg280) animals that contain
putative null alleles of a 5-HT2-like receptor and tryptophan hydroxylase, respectively,
suggesting that serotonergic signaling, although not essential for the up-regulation of
pumping on bacteria, “fine tunes” the process. 5-HT also fails to stimulate egg-laying in
ser-7(tm1325), ser-1(ok345) and ser-7(tm1325);ser-1(ok345) animals, but only the ser7;ser-1 double mutants exhibit an Egl phenotype. All of the SER-7 mutant phenotypes
are rescued by the expression of full length ser-7::gfp translational fusions. ser-7::gfp is
expressed in several pharyngeal neurons, including the MC, M2, M3, M4 and M5, and in
vulval muscle. Interestingly, 5-HT inhibits egg-laying and pharyngeal pumping in ser-7
null mutants and the 5-HT inhibition of egg-laying, but not pumping is abolished in ser7(tm1325);ser-4(ok512) double mutants. Taken together, these results suggest that SER7 is essential for the 5-HT stimulation of both egg-laying and pharyngeal pumping, but
that other signaling pathways can probably fulfill similar roles in vivo.
3
INTRODUCTION
Serotonin (5-HT) regulates key processes in nematodes, including pharyngeal
pumping and egg-laying. In Caenorhabditis elegans, four 5-HT receptors have been
characterized: 5-HT1 (SER-4), 5-HT2 (SER-1) and 5-HT7 -like G-protein coupled
receptors (GPCRs; SER-7) that appear to couple to Gαi/o, Gαq and Gαs, respectively, as
well as a novel 5-HT-gated Cl- channel (MOD-1) (Olde and McCombie, 1997; Hamdan
et al., 1999; Hobson et al., 2003; Ranganathan et al., 2000). However, the physiological
role of these receptors is unclear.
Feeding in C. elegans consists of two processes: the synchronous contraction of
the corpus, anterior isthmus and terminal bulb, and peristalsis of the posterior isthmus
(Avery and Horvitz, 1987). Serotonin stimulates pumping from about 60 to ~250
pumps/min and increases the frequency and decreases the duration of action potentials in
pharyngeal muscles (Horvitz et al., 1982; Niacaris and Avery, 2003). These effects are
dependent on both the MC and M3 pharyngeal motorneurons and both appear to be
regulated directly by 5-HT (Raizen et al., 1995; Niacaris and Avery, 2003). However,
the 5-HT receptors involved have not been identified. The M4 motorneuron synapses
posteriorly on the pm5 muscles of the pharynx, and is necessary for isthmus peristalsis
(Albertson and Thompson, 1976; Avery and Horvitz, 1987). Laser ablation of the M4
motorneuron results in failure of the pm5 muscles to contract and larval arrest due to
starvation (Avery and Horvitz, 1987). Based on these observations, it appears that the
M4 motorneuron plays a more important role in the regulation of isthmus peristalsis than
in regulating the overall rate of pumping.
4
Serotonin also stimulates egg-laying in C. elegans. The egg-laying machinery
includes 16 muscles (8 vulval and 8 uterine) and two types of neurons, the HSNs and
VCs, both of which appear to be serotonergic (White et al., 1986; Rand and Nonet,
1997). Multiple 5-HT receptors are involved in the regulation of egg-laying. Vulval
muscle appears to express a Gαq-coupled 5-HT receptor (SER-1) that is coupled to the
entry of external Ca2+ through EGL-19, an L-type Ca2+ channel (Dempsey et al., 2005;
Shyn et al., 2003). 5-HT switches the muscle from an inactive to an active state capable
of contraction (Waggoner et al., 1998). In contrast, the VCs, which synapse onto both
the vulval muscle and HSNs neuron, appear to express a Gαi/o-coupled receptors that
inhibits neurotransmitter release from the HSNs and egg-laying (Bany et al. 2003; Shyn
et al., 2003).
In the present study we have identified an essential role for a C. elegans 5-HT7 like receptor (SER-7) in the regulation of both pharyngeal pumping and egg-laying,
suggesting that Gαs-coupled signaling pathways may play a more important regulatory
role than previously appreciated. Activation of SER-7-dependent, Gαs-coupled,
signaling pathways could stimulate these processes directly, for example by increasing
the PKA-dependent phosphorylation of key channel proteins and/or indirectly, by
opposing the action of Gαi/o-mediated inhibition of Gαq-stimulated pathways, as has been
described for the Gαq/Gαi/o signaling network in the regulation of neurotransmitter
release.
MATERIALS AND METHODS
Culture, maintenance of strains and reagents
5
General techniques for culture and handling of worms have been described
(Brenner, 1974). The putative ser-7 knockout strains, tm1325 and tm1728, were obtained
from the National Bioresources Project (Tokyo Women’s Medical University, Tokyo,
Japan), the ser-1(o345);ser-7(tm1325) (DA2109) double mutant was obtained from Leon
Avery and all other strains were obtained from the Caenorhabditis Genetics Center
(Oklahoma Medical Research Foundation, OK). The N2 Bristol strain was used as a
control and is referred to as “wild type” in the text. All experiments used well fed adults
grown at 20°C on standard nematode growth medium (NGM) seeded with the E. coli
strain OP50. ser-7(tm1325) and ser-7(tm1728) were outcrossed 6x and 3x respectively.
The ser-7(tm1325);ser-4(ok512) double mutant was constructed using standard
techniques and confirmed by PCR.
Green fluorescent protein (GFP) reporter constructs were obtained from Andrew
Fire (Carnegie Institute of Washington, Washington DC). cAMP kits were purchased
from Assay Designs (Ann Arbor, MI). [3H]-LSD (specific activity 75 Ci/mmol) was
obtained from Du-Pont - New England Nuclear (Boston, MA). All other chemicals were
purchased from Sigma-Aldrich (St Louis, MO).
Creation of native and mutant ser-7b receptor constructs for expression in
mammalian cells
The cloning of native ser-7b for mammalian expression was described previously
(Hobson et al. 2003). To create a chimeric SER-7B receptor with GFP fused in the
predicted third intracellular loop of the receptor (see Fig. 1B) primers were designed on
either side of the predicted third intracellular loop [ser-75’F(CCCGGGTATGGCCCGTGCAGTCAACATATC), ser-75’R
6
(GGTACCAACCGTTCGGAGGCATCCAC), ser-73’F
(GAATTCCCACGAAATGGATCAGCTG) and ser-73’R
(GCCGGCCTAGACGTCACTTGCTTCGTG)] and used to clone the ser-7b cDNA.
Restriction sites for XmaI, KpnI, EcoRI and NgoMIV respectively, used to subclone the
PCR products into the GFP expresson vector pPD117.01 and create the chimeric
construct pOT7I3, are indicated in italics. A C. elegans cDNA pool prepared from all life
stages was used as a template. To prepare ser-7b with E314A/K316A mutations in the
third intracellular loop (pOT7I3M), the GeneTailor™ site-directed mutagenesis system
was used as per manufacturer’s instructions (Invitrogen, Carlsbad, CA). The following
primers were used for mutagenesis [SER7Mut-F
(CAGACGGAGAAAAGTGcATGCgcAGCCCGGAAAAC) and SER7Mut-R
(ACTTTTCTCCGTCTGCCGAATCAATGGTCCTTTGCA)]. Mutagenized nucleotides
are indicated in lower case. The ser-7b cDNA constructs were cloned into pFLAGCMV2 (Sigma-Aldrich, St. Louis, MO) by amplification with the following primers
[SER-7CDsF (GCGGCCGCGATGGCCCGTGCAGTCAACATATC) and SER-7CDsR
(TCTAGACTAGACGTCACTTGCTTCGTG)]. NotI and XbaI restriction sites used to
subclone the ser-7b cDNA into pFLAG-CMV2 are noted in italics. All constructs were
confirmed by sequencing (MWG Biotech, High Point, NC).
Ligand binding and coupling
All constructs were transiently transfected into COS-7 cells using lipofectamine
2000 (Invitrogen, Carlsbad, CA), essentially as described by Hobson et al. (2003).
Radioligand binding was assayed as described previously (Huang et al., 1999, Hobson et
al., 2003). Briefly, crude membrane preparations (15 µg protein) were incubated with
7
[3H]-LSD (2-60 nM) and Bmax and Kd values were calculated as described below. For
inhibition binding, membranes (30 µg) were incubated with various concentrations of
ligand and 10 nM [3H]-LSD. Non-specific binding was determined in the presence of a
1000-fold excess of cold LSD. Saturation and inhibition binding were determined at
room temperature after one hr in the dark. Reactions were terminated by filtration onto
96-well microplates with GF/B filters (Packard) previously soaked with 0.3%
polyethyleneimine. Filters were then washed 3x with ice cold TEM (50 mM Tris.HCl,
0.5 mM EDTA, 50 mM MgCl2; pH 7.4) buffer, dried overnight and the radioactivity
quantified by liquid scintillation counting. All radioligand binding data was analyzed by
non-linear regression analysis using Deltagraph (Deltagraph, Version 4.05e; Deltapoint
Inc., 1993). An F-test was used to determine if the data best fit a one or two site binding
model. To assay coupling, COS-7 cells, transfected as described above, were incubated
with ligand and cAMP levels determined as previously described (Hobson et al., 2003).
Creation of rescue constructs
The rescue constructs are illustrated in Fig. 1 and the corresponding transgenic
lines are designated as follows: ser-7::gfp (erEx1517), ser-1::gfp (erEx1617). The ser1::gfp and ser-7::gfp constructs are full length translational fusions with sequence coding
for GFP inserted in the predicted C-terminus and third intracellular loops of the receptors,
respectively.
All rescue constructs were created by overlap fusion PCR (Hobert, 2002). To
create the full length ser-7::gfp translational fusion with sequence coding for GFP
inserted into the predicted third intracellular loop of the receptor (exon III, in the same
position as the chimeric cDNA construct), 3 different PCR fragments were fused by 2
8
rounds of PCR. Primers were used to amplify 1) the 5’ end of the gene and half of exon
III [A3ILPF and BFL5R (CCGTTCGGAGGCATCCACAG)], 2) the 3’ end of the gene
including the other half of exon III, and 100 nucleotides downstream of the 3’ UTR from
a C. elegans genomic DNA preparation [CFL3F (CCACGAAATGGATCAG CTGAG)
and DFL3R (CACCTTCTGAAATGCACATAATTGC)] and 3) a portion of pOT7I3
spanning a portion of the third intracellular loop including gfp. The fragment of the third
intracellular loop containing gfp contained a 150 nucleotide overlap on either side of the
gfp with both the 5’ and 3’ PCR fragment, so when combined and amplified using
A3ILPF and DFL3R, a full length gene product with GFP inserted into exon III and the
ser-7 3’ UTR was generated. The construct was injected into ser-7(tm1325) animals with
pRF4 to create the transgenic strains, erEx1517.
To create the full length ser-1::gfp rescue construct with sequence coding for
GFP inserted into the predicted C-terminus of the receptor, three PCR fragments were
fused by two rounds of PCR. Primers were designed to amplify 1) the 5’ end of the gene
including part of exon IV [(SER-1promexonIVF: 5’CGTTTTCACGGACCTCCTCCCACAC) and (SER-1promexonIVR: 5’CGACGCAACCCAATCAGGAATCTGC)], 2) the 3’ end of the gene and 3’ UTR with
part of exon IV [(SER-1exonIVF: 5’-GACTCTCATCAAATGTATTCGCGA) and (SER13’UTRR: 5’-GTGTGAGGTGTGCGGCAAATCTAC)] and 3) and a portion of
pOT17S1, a plasmid containing the full length ser-1 cDNA with sequence for gfp
inserted into exon IV, spanning the C-terminal tail of the receptor and GFP [(SER1exonIVGFPF: 5’- CCGCAACTCAAGATCTTGCAA and SER-1exonIVGFPR: 5’GTGTACGTATCCGGAACAATTG)]. The fragment of the C-terminal tail containing
9
GFP contained a 100 nucleotide overlap either side of gfp with the 5’ and 3’ PCR
fragments, so when combined and amplified using SER-1promexonIVF and SER13’UTRR a full length ser-1 gene with the ser-1 3’UTR and GFP in the tail of the
receptor was created. The construct was injected in ser-1(ok345) animals to create
erEx1617.
Overlap fusion PCR constructs (at 0.05-5 ng/µl) were co-injected with the rol-6
plasmid (pRF4) into C. elegans gonads by standard techniques (Kramer et al., 1990;
Mello and Fire 1995). Lines expressing the construct were screened by observing the
roller phenotype and by GFP expression using a confocal inverted laser-scanning
microscope (Olympus-Fluoview, Olympus America, Melville, NY). At least three
different overlap fusion PCR reactions were injected and five or more lines carrying the
arrays were analyzed for each construct.
Behavioral assays
All behavioral assays were performed on young adult N2s synchronized by
growing fourth-stage larvae at 20°C for 24 hours prior to assay. For 5-HT stimulated
pumping, worms were placed on plates containing 13 mM 5-HT (creatinine sulfate salt)
in the presence or absence of E. coli OP50, left for 15 min, and the number of pumps
(defined as full backwards grinder movements in the terminal bulb) counted for 30
seconds, the number of pumps was multiplied by two to obtain pumps/min. Due to the
relative impermeability of the nematode cuticle, high concentrations of 5-HT have been
used routinely by C. elegans researchers to examine 5-HT dependent phenotypes. To
assay pumping on bacteria, pumps were either counted for 30s, or single animals were
followed for 10 min and pumps/10s were counted every 30s. For the latter assay to
10
measure “fast pumping” on bacteria, at least 7 animals per genotype were assayed and the
results pooled. Basal pumping rates were measured as described by Keane and Avery
(2003). Egg-laying was assayed on synchronized animals that had already begun to lay
eggs on bacteria. Worms were placed on plates containing OP50 alone, 13 mM 5-HT
alone or both 5-HT and OP50 and eggs laid were counted after one hour. To determine
the number of eggs in the uterus, i.e. to determine if the mutant animals retained eggs and
exhibited an egg-laying defective (Egl) phenotype, fourth-stage larvae were grown at
20°C for 24 hours, when they had already begun to lay eggs on bacteria, and the number
of eggs in the uterus counted after mounting the worms on 2% agarose pads on
microscope slides. All assays were performed at 20-22°C.
Pharyngeal pumping and egg-laying were analyzed using Students T-test
(Student, 1908). To analyze variation in the pumping assay, where pumps/10s were
recorded every 30s for 10 min from individual animals, a Kolmogorov-Smirnov test,
which makes no assumptions about the distribution of the data, was used.
Electropharyngeograms
Electropharyngeograms (EPGs) were recorded essentially as described by Raizen
and Avery (1994). Briefly, worms were placed on slides containing 10 mM 5-HT in
Ascaris saline (4 mM NaCl, 125 mM Sodium Acetate, 24.5 mM KCl, 5.9 mM CaCl2, 4.9
mM MgCl2, 5 mM Hepes pH 7.4; del Castillo and Morales, 1967) and recordings begun
by sucking the head of the worm into the tip of a low-impedance glass micropipette (2-6
MΩ). Pipettes were pulled from Corning 8161 Patch Clamp Glass with ID 1.65mm, OD
1.20mm (Warner Instrument Corp., Hamden, CT) by a P-87 Flaming/Brown micropipette
puller (Sutter Instruments, Novato, CA) to have tip openings between 20 and 40 µm.
11
Signals were amplified 100x and low-passed filtered at 1 KHz with an Axoprobe-1A
microelectrode amplifier (Molecular Devices, Sunnyvale, CA), and an FLA-01 amplifier
(Cygnus Technologies, Southport, NC). All data was recorded and stored on a 2-channel
scientific digital tape recorder (DT-200, Microdata Instruments, S. Plainfield, NJ), and
analyzed using Matlab (The Mathworks Inc., Natick, MA).
12
RESULTS
ser-7 encodes a 5-HT7-like receptor with a unique pharmacology: We previously
reported the partial characterization of a C. elegans 5-HT receptor (SER-7B; Hobson et
al., 2003). In the present study, we have expanded the pharmacological characterization
of SER-7B, and more importantly, evaluated its potential function in animals carrying the
putative ser-7 null mutants, tm1325 and tm1728. Multiple SER-7 isoforms have been
identified in the C. elegans EST database that differ in their C-termini (Fig. 1A). When
transiently expressed in COS-7 cells, SER-7B exhibits a pharmacological profile that
differs from its closest mammalian homologue, the 5-HT7 receptor, even though both
receptors couple to a 5-HT dependent increase in cAMP levels (Fig. 2). For example,
SER-7B has a low affinity for many specific mammalian 5-HT7 receptor ligands,
including methysergide and SB-269970 (Table 1) and the binding potencies for SER-7B
expressed in COS-7 cells is different to mammalian 5-HT7 receptors (Table 2).
Interestingly, gramine, a serotonin receptor antagonist that can block firing of the
inhibitory pharyngeal motorneuron M3 in response to 5-HT has a pKi identical to that of
5-HT (Niacaris and Avery, 2003). However, it is worth noting that nematode-specific
cell lines are not available and, although nematode receptors expressed in mammalian
cells appear to couple to the G-protein(s) predicted based on sequence alignments, no
studies have yet confirmed that the pharmacology of a cloned nematode GPCR
heterologously expressed in mammalian cells mimics the pharmacology exhibited in
vivo.
13
5-HT does not stimulate pharyngeal pumping in putative ser-7 null mutants: To
clarify the physiological role of SER-7, the effects of exogenous 5-HT were examined in
the putative ser-7 null mutants, ser-7(tm1325) and ser-7(tm1728). ser-7(tm1325) has a
742 bp deletion in exon V that results in the deletion of a portion of transmembrane VII
and most of the C-terminus of the receptor (Figure 1A). ser-7(tm1728) has a 666 bp
deletion also resulting in the loss of exon V (Figure 1A). Therefore, ser-7(tm1325) and
ser-7(tm1728) are predicted null alleles, as transmembrane VII is required for ligand
binding and the C-terminus is required for effective G-protein coupling and receptor
trafficking (Cheung et al., 1989; Duvernay et al. 2004).
In wild type animals, exogenous 5-HT dramatically stimulated pharyngeal
pumping (Fig. 3). In contrast, 5-HT had no effect on pharyngeal pumping in either ser7(tm1325) or ser-7(tm1725) mutants (Fig. 3). Since pumping in both mutants appeared
to be dramatically up-regulated when the animals were maintained on bacteria (Fig. 3;
see below), but not 5-HT, serotonergic signaling may be redundant in the regulation of
pumping, and other signaling pathways, possibly mediated by neuropeptides, also might
be involved. Indeed, a role for neuropeptides in the regulation of nematode pharyngeal
pumping has been suggested previously (Rogers, et al., 2001; Brownlee et al., 1995). In
fact, 5-HT actually inhibited pumping on bacteria in the ser-7 null mutants (Fig. 3),
perhaps through presynaptially localized 5-HT autoreceptors, as discussed more fully
below.
Pharyngeal pumping on bacteria is up-regulated, but more variable, in ser-7 null
mutants: To examine the up-regulation of pharyngeal pumping on bacteria more
14
carefully, an assay was developed in which the pumping rates of individual animals
(pumps/10s) were measured on bacteria every 30 seconds for 10 minutes (Fig. 4). In
wild type animals, bacterially-stimulated pumping was consistent and rates/10 sec
exhibited a modest variation around the mean (from 32-48 pumps/10 sec, mean 43 ± 0.3
pumps/10 sec; Fig. 4A). In contrast, while pumping on bacteria also was dramatically
increased in ser-7(tm1325) animals, rates were more variable than those observed in wild
type worms, resulting in slightly lower overall mean pumping rates (5-48 pumps/10 sec,
mean 38.3 ± 0.6 pumps/10 sec; Fig. 4B). A similar, but more pronounced response, was
observed in tph-1(mg280) animals that lacked tryptophan hydroxylase, an enzyme
required for the biosynthesis of 5-HT (Fig. 4G). Previous reports suggested that tph1(mg280) animals did not increase their rate of pharyngeal pumping on bacteria (Sze et
al., 2000). However, in our assay, tph-1(mg280) worms were capable of elevating their
pumping rates to near wild type levels, but only for brief periods. Most of the time, they
pumped at significantly lower rates (2-48 pumps/10 sec, mean 30.4 ± 0.6 pumps/10 sec;
Fig. 4G).
The inability to maintain a “fast-pumping” phenotype was more pronounced in
tph-1(mg280) than the ser-7(tm1325) animals, suggesting that other 5-HT receptors
might be involved. At least two distinct 5-HT receptors are expressed in the pharynx, a
Gαq-coupled 5-HT receptor in pharyngeal muscle (SER-1; Tsalik et al., 2003) and SER-7
in the pharyngeal nervous system (Hobson et al., 2003; see below). Therefore, a putative
ser-1 null mutant ok345 also was examined for 5-HT and bacterially-stimulated pumping
(Fig. 4D). ser-1(ok345) has an 859 nucleotide deletion and 25 nucleotide insertion
removing exon IV that in turn deletes a portion of the 3rd intracellular loop (10 aa), the
15
6th and 7th transmembrane domains and a portion of the C-terminus (41aa) from the
predicted receptor, suggesting that the receptor was non-functional (Fig. 1A). ser1(ok345) mutants, in contrast to the ser-7(tm1325) animals, dramatically increased
pumping in response to 5-HT, indicating that SER-1 is not the major 5-HT receptor
involved in the 5-HT dependent up-regulation of pumping (Fig. 3). However, the ser1(ok345) animals also exhibited a more variable pumping rate on bacteria (mean 39.2 ±
0.5 pumps/10 sec; Fig. 4D) than wild type animals. As predicted, the altered pumping in
ser-7(tm1325);ser-1(ok345) double mutants was nearly identical to that observed in the
tph-1(mg280) animals (Fig. 4F and 4G). Taken together, these data suggest that
serotonergic signaling is not essential for the up-regulation of pharyngeal pumping on
bacteria, but may play a role in “fine tuning” the process. Most importantly, the pumping
phenotypes observed in the ser-1(ok345) and ser-7(tm1325) animals could be rescued
using the corresponding full length ser-7::gfp or ser-1::gfp translational fusions,
respectively (see Fig. 1A for rescue constructs and Figs. 3 and 4 for the rescue data).
Localization of ser-7 expression and rescue of 5-HT stimulated pharyngeal pumping
in ser-7(tm1325) animals: Initial attempts to rescue 5-HT stimulated pharyngeal
pumping in ser-7(tm1325) animals using the minimal ser-7 promoter 2 kb upstream of
the ATG and a ser-7b cDNA with sequence coding for GFP inserted into the third
intracellular loop were unsuccessful (0.5-0.005 ng/µl), as transgenic worms could not be
isolated. Hobson et al. (2003) have noted previously that this minimal ser-7 promoter
drove expression exclusively in the M4. The insertion of GFP into the third intracellular
loop had no apparent effect on coupling, as SER-7B and SER-7BI3GFP had nearly
16
identical EC50s for the 5-HT dependent stimulation of cAMP levels, when the receptors
were transiently expressed in COS-7 cells (30 ± 3 nM vs. 47 ± 5 nM, respectively, Fig.
2). In addition, the expression of a modified SER-7B (SER-7B E314A/K316AI3GFP)
designed to couple less effectively to G-proteins by mutation of key amino acids in the
third intracellular loop of the receptor (Fig. 1B; Obosi et al., 1997) under the control of
the same promoter also failed to generate robust transgenic lines. As predicted, when
SER-7B E314A/K316AI3GFP was expressed in COS-7 cells, the 5-HT stimulation of cAMP
levels was dramatically reduced compared to SER-7B, with an EC50 of 1.8 ± 0.5 µM and
a maximal activation of less than half that SER-7B, suggesting that SER-7B
E314A/K316I3GFP
was functional, but attenuated (Fig. 2).
In contrast to most C. elegans introns, the first three introns in the ser-7 gene are
large, 0.7, 3.3 and 1.5 kb respectively, suggesting that they might contain elements
important for the regulation of expression (Fig. 1A). Therefore, the rescue of 5-HT
dependent pumping in ser-7(tm1325) animals was attempted with a PCR-fusion encoding
the full length ser-7 gene with sequence coding for GFP inserted into the predicted third
intracellular loop of the receptor (ser-7::gfp). As noted above, the insertion of GFP into
this position of the receptor has little apparent effect on G-protein coupling (Fig. 2). ser7::gfp DNA injected into C. elegans at 0.5-0.05 ng/µl produced lines that exhibited
marked GFP fluorescence in a number of pharyngeal neurons, including the MCs, M4,
I2s, I3, M5 and occasionally in the M3s, I4, I6 and M2s, supporting a general
neuromodulatory role for 5-HT in the regulation of pumping and feeding (Fig. 5A).
Strong GFP fluorescence was also observed in the vulval muscles (Fig. 5B). However,
these lines exhibited a stuffed pharynx phenotype and did not carry effectively. When
17
ser-7::gfp DNA was injected from 0.05-0.005 ng/µl, GFP fluorescence decreased
dramatically and was barely detectable at the lower expression levels. However, under
these conditions, 5-HT dramatically stimulated pharyngeal pumping in the rescued ser7(tm1325)(+) animals (Fig. 3). For example, basal rates of pumping were similar in WT,
ser-7(tm1325) and ser-7(1325)(+) animals, and were stimulated over 5-fold by 5-HT in
both the wild type and rescued ser-7(tm1325)(+) worms. Similarly, these rescued ser7(1325)(+) animals exhibited a wild-type pumping phenotype on bacteria (Fig. 4C).
SER-7 regulation of pharyngeal pumping appears to involve the MC pharyngeal
motorneuron: To investigate the possible mechanism of the SER-7 mediated
stimulation of pharyngeal pumping, electropharyngeograms (EPGs), which measure
changes in pharyngeal muscle membrane potential, were examined from wild-type, ser7(tm1325) and ser-7(tm1325)(+) animals (Fig. 6A). In response to exogenous 5-HT,
EPGs from WT worms exhibit two initial positive transients, called E phase transients
(Raizen et al., 1995; Fig. 6A). E1 appears to result from input from the MC
motorneurons, and E2 from the depolarization of the pharyngeal muscle (Raizen et al.,
1995). For example, laser ablation of the MC results in the inability of the worm to
increase pharyngeal pumping and a loss of E1 from the EPG (Raizen et al., 1995).
Similarly, EPGs from ser-7(tm1325) worms incubated with 5-HT also lack an E1
transient, suggesting that cholinergic input from the MC to the pharyngeal muscle is
absent in these worms (Fig. 6A). For example, EPGs from nearly all (>90%, 20 pumps
examined from 10 worms; Fig. 6B) of the wild type and ser-7(tm1325)(+) animals
contained an E1 spike, whereas EPGs from less than 5% of the ser-7(tm1325) (20 pumps
18
examined from 10 worms; Fig. 6B) animals had an E1 spike. The EPGs from the ser7(tm1325) animals also exhibited small positive transients similar to those observed in
MC minus worms or eat-2 mutants that express altered nicotinic acetylcholine receptors
on their pharyngeal muscles (Raizen et al. 1995, Fig. 6A inset). The EPG data along with
the observation that SER-7 is expressed in the MCs suggests that SER-7 mediates the
increase in the overall rate of pharyngeal pumping by increasing the firing of the MC
motorneurons.
SER-7 is also essential for 5-HT stimulated egg-laying: Since SER-7 was robustly
expressed in vulval muscle, ser-7(tm1325) and ser-7(tm1728) animals were examined for
5-HT stimulated egg-laying (Fig. 7). In contrast to wild type animals, 5-HT had no effect
on egg-laying in either ser-7(tm1325) or ser-7(tm1728) mutants and the 5-HT stimulation
of egg-laying was rescued in ser-7(tm1325) animals carrying a full length ser-7::gfp
translational fusion (Fig. 7). Previous studies have suggested a role for a Gαq-coupled 5HT receptor in vulval muscle (Shyn et al., 2003). Indeed, the expression of SER-1 in
vulval muscle also appears to be essential for 5-HT stimulated egg-laying and 5-HTstimulated egg-laying in ser-1(ok345) mutants lacking a functional SER-1 receptor could
be rescued by the expression of SER-1 in the vulval muscle (Dempsey et al., 2005; Hong
et al., submitted).
The ser-7(tm1325), ser-7(tm1728) and ser-1(ok345) animals failed to exhibit any
obvious Egl (Egg-laying defective) phenotype (Table 3), suggesting that serotonergic
signaling may be at least partially redundant in the regulation of egg-laying, as was
observed above for pharyngeal pumping, and that other pathways, perhaps mediated by
19
one of the many neuropeptide receptors in the C. elegans genome, can also stimulate egglaying (Schinkmann and Li, 1992; Waggoner et al., 2000). In contrast, ser7(tm1325);ser-1(ok345) double mutants exhibited a modest, but statistically significant
Egl-phenotype, suggesting that both 5-HT receptors may couple to at least some common
downstream target(s) (Table 3). Interestingly, as observed above for pumping, 5-HT also
appeared to dramatically inhibit normal egg-laying on bacteria in ser-7 null mutants (Fig.
7). In contrast, 5-HT did not inhibit egg-laying on bacteria in ser-7(tm1325);ser4(ok512) double mutants and actually stimulated egg-laying in these animals when
applied alone (Fig. 7). As discussed more fully below, we hypothesize that SER-4 may
function presynaptically to inhibit the release of neurotransmitters involved in the
stimulation of egg-laying. Finally, ser-4(ok512) mutants appeared to retain fewer eggs
than wild type animals, and also appeared to be slightly hyperactive for egg-laying in the
presence of 5-HT (Table 3; Fig. 7).
20
DISCUSSION
Serotonin regulates a number of key processes in nematodes, including
pharyngeal pumping, locomotion and egg-laying, as well complex behaviors such as the
enhanced slowing response on bacteria (Horvitz et al., 1982; Sawin et al., 2000). Indeed,
5-HT appears to prime starved C. elegans for the exploitation of abundant food sources.
In the present study, we have demonstrated that a predicted Gαs-coupled 5-HT receptor
(SER-7) is essential for the 5-HT stimulation of both pharyngeal pumping and egglaying. SER-7 is most closely related to mammalian 5-HT7 receptors, based on sequence
alignments and the observation that both receptors couple to Gαs when expressed in
mammalian cells. However, as predicted, the pharmacological profiles of the two
receptors differ significantly. For example, SER-7 has very low affinity for 5-CT, a
potent agonist of mammalian 5-HT7 receptors.
Mammalian 5-HT7 receptors couple to Ca2+/calmodulin-sensitive adenyl cyclase
isoforms and are expressed in both the CNS and peripheral tissues. 5-HT7 receptors have
been implicated in the modulation of a variety of processes, including the relaxation of
vascular smooth muscle, circadian rhythms, REM sleep, hypothermia and migraine
(Thomas and Hagan, 2004). In rat hippocampal neurons, 5-HT7 receptors reduce the
period of hyperpolarization between periods of neuronal excitability by enhancing the
hyperpolarization-activated current, Ih, and inhibiting Ca2+ activated K+ channels (Gill et
al., 2002). These observations fit well with proposed roles for SER-7 in the
neuromodulation of pharyngeal pumping and egg-laying discussed below.
Surprisingly, SER-7 does not appear to be necessary for the stimulation of either
pharyngeal pumping or egg-laying under physiological conditions, when the worms are
21
on bacteria, suggesting that serotonergic signaling may be redundant and/or overlapping
with other signaling pathways. However, both SER-7 and SER-1 appear to “fine tune”
the elevated rate of bacterially-stimulated pumping. Interestingly, previous reports
suggested that 5-HT was essential for the up-regulation of pharyngeal pumping on
bacteria, based on studies with tph-1 mutants that lack tryptophan hydroxylase and have
dramatically reduced 5-HT levels (Sze et al., 2000). In contrast, the results of the present
study suggest that this tph-1 mutant can indeed up-regulate pumping on bacteria, albeit
less efficiently than wild type worms, but does not maintain this “fast pumping”
phenotype.
5-HT facilitates rapid pharyngeal muscle contraction-relaxation cycles through its
direct action on the MC and M3 motorneurons (Raizen et al., 1995; Niacaris and Avery,
2003). The MCs are excitatory cholinergic neurons that depolarize pharyngeal muscle
and regulate the rate of pumping through nicotinic cholinergic receptors expressed on
pharyngeal muscle (Raizen et al., 1995). Ablation of the MCs causes a drastic reduction
in both 5-HT and bacterially-stimulated pumping. More importantly, EPGs from 5-HT
stimulated MC minus worms reflect the lack of MC input. Typically, the excitation
phase (E phase) of the EPG consists of two transients associated with the depolarization
of the pharyngeal muscle. In 5-HT stimulated MC minus and ser-7(tm1325) worms, only
a single E phase transient is observed, suggesting that input from the MCs is
compromised (Raizen et al., 1995; Fig. 6). Taken together, these data suggest that SER-7
plays a direct role in the 5-HT stimulation of acetylcholine release from the MCs and that
Gαs coupled pathways may play a more general role in regulating the neurotransmitter
release from presynaptic neurons than previously described.
22
The regulation of egg-laying in C. elegans has been studied extensively, through
laser ablation of VC4/5, inactivation of the HSNs in egl-1 mutants, measurements of Ca2+
transients, the rescue of individual receptor mutants and a wealth of pharmacological
studies. However, no role for SER-7 or for any Gαs-coupled receptor in the regulation of
egg-laying has been described. Both the VCs and HSNs secrete multiple
neurotransmitters, including acetylcholine, 5-HT and at least one, but probably several,
related peptides (Rand and Nonet, 1997; Schinkmann and Li, 1992). Acetylcholine can
either stimulate egg-laying, as demonstrated by the addition of the nicotinic agonist
levamisole or can inhibit egg-laying, by the activation of Gαi/o-coupled muscarinic
receptors (GAR-2?) on the HSNs that inhibit neurotransmitter release (Weinshenker et
al., 1995; Bany et al., 2003). Physiologically, the overall effects of acetylcholine appear
to be inhibitory (Bany et al., 2003). 5-HT acts directly on vulval muscle to increase the
rate and alter the temporal pattern of egg-laying, switching the muscle from a pattern of
sporadic Ca2+ activity to a pattern of continuous activity (Waggoner et al., 1998; Shyn et
al., 2003). 5-HT increases the frequency of Ca2+ transients in vulval muscle through a
pathway that appears to involve a Gαq-coupled 5-HT receptor (SER-1), Gαq (EGL-30),
PKC (TPA-1) and a voltage-gated L-type Ca2+ channel (EGL-19).
The expression of both SER-1 and SER-7 in vulval muscle is essential for 5-HT
stimulated egg-laying, but the precise roles of the two receptors remain to be determined.
It is clear that the inactivation of either SER-1 or SER-7 alone does not have any gross
effect on the egg-laying system, as the effects are 5-HT-specific and the mutation of
either receptor alone does not yield any obvious Egl phenotype. Presumably, 5-HT
signaling in vulval muscle is at least partially redundant, as hypothesized above for
23
pharyngeal pumping. For example, the egg-laying neurons secrete a number of different
FARPs and their role in the regulation of egg-laying has been predicted (Schinkmann and
Li, 1992). However, ser-7;ser-1 double mutants do exhibit an Egl phenotype,
suggesting that a least some of the downstream effectors of the SER-1 and SER-7
mediated pathways may overlap. Either or both SER-1 and SER-7 may be involved in
the phosphorylation of the vulval muscle L-type Ca2+ channel, EGL-19. EGL-19 is
essential for 5-HT-dependent vulval muscle Ca2+ transients and egg-laying, as partial loss
of function egl-19 mutations strongly interfere with the ability of 5-HT to stimulate both
processes (Shyn et al., 2003). Most importantly, neither the VC nor HSN egg-laying
neurons are required for these effects, confirming a direct role for EGL-19 in vulval
muscle (Shyn et al., 2003).
In mammals, multiple G-protein coupled receptors act through cAMP/PKA
pathways to regulate cardiac L-type Ca2+ channels. For example, the robust upregulation
of ICa by the β-adrenergic receptor/cAMP/PKA pathway is well documented and appears
to require both the specific subcellular localization of PKA through AKAP and the
phosphorylation of the EGL-19-like, α1c channel subunit (Gao et al., 1997). Indeed,
EGL-19 contains a number of consensus PKA phosphorylation sites and the 5-HT
dependent stimulation of SER-7 may directly regulate the phosphorylation state of EGL19 and the activity of Ca2+ channel. A similar but less well documented role for PKCmediated phosphorylation of cardiac L-type Ca2+ channels also has been described and
might explain the dependence of 5-HT dependent egg-laying on SER-1 and EGL-30
(Gαq) (Trautlwein and Heschler, 1990). However, while the direct PKA/PKC dependent
24
phosphorylation of EGL-19 is the most straight-forward model, a number of other
scenarios are possible, including the phosphorylation of vulval muscle K+ channels.
Surprisingly, 5-HT dramatically inhibited both pharyngeal pumping and egglaying when ser-7 null animals were placed on bacteria. As noted above, 5-HT failed to
stimulate either pumping or egg-laying in ser-7(tm1325) or ser-7(tm1728) animals, but
both processes were dramatically stimulated when these mutant animals were placed on
bacteria. The mechanism of this 5-HT inhibition is unclear, but may involve the
feedback inhibition of neurotransmitter release mediated by presynaptic 5-HT
autoreceptor(s) (SER-4/MOD-1?) on key neurons regulating these processes. Since ser7(tm1325) or ser-1(ok345) animals are not Egl and lay eggs and elevate pumping on
bacteria, other redundant receptors, perhaps mediated by neuropeptides must be operating
to elevate both egg-laying and pumping in these mutants. In fact, a role for
neuropeptides in the regulation of egg-laying has been proposed (Schinkmann and Li,
1992). The exogenous application 5-HT in these egg-laying experiments may be
inhibiting the release of these other stimulatory neurotransmitters. Although 5-HT
dramatically stimulates egg-laying, both acetylcholine and 5-HT also appear to inhibit
neurotransmitter release from the HSNs by the presynaptic activation of Gαo coupled
pathways. For example, Bany et al. (2003) have demonstrated that acetylcholine released
from the VCs inhibits egg-laying by inhibiting the presynaptic release of 5-HT and
presumably other neuromodulators from the HSNs by activating a Gαo (GOA-1)–coupled
muscarinic receptor (GAR-2?) on the HSNs. Similarly, Shyn et al. (2003) demonstrated
that 5-HT released from the HSNs can feedback inhibit through GOA-1 and silence the
HSNs, although the 5-HT autoreceptor involved was not identified. The role of
25
presynaptic GOA-1 (C. elegans Gαo) signaling in inhibiting neurotransmitter release in
ventral cord neurons is well documented. The presynaptic activation of GOA-1 appears
to move UNC-13, a protein required for synaptic vesicle priming, away from
neurotransmitter release sites (Nurrish et al., 1999). More importantly, the expression of
a constitutively active GOA-1 in the HSNs was sufficient to induce an Egl-phenotype
(Moresco and Koelle, 2004). Similarly the expression of a constitutively active Gαocoupled GPCR, EGL-47, in the HSNs also dramatically inhibited egg-laying, suggesting
the GOA-1 integrates signaling from multiple receptors in the HSNs (Moresco and
Koelle, 2004).
As predicted from these observations, 5-HT did not inhibit egg-laying on bacteria
in ser-7;ser-4 double mutants. In contrast, 5-HT still dramatically inhibited pumping in
the ser-7;ser-4 double mutants, suggesting that additional 5-HT receptors are probably
involved. These studies are continuing with the intention of identifying the downstream
effectors linked to SER-7 and the signaling pathways involved in the 5-HT inhibition of
pumping and egg-laying.
ACKNOWLEDGEMENTS
This work was supported by National Institutes of Health grant AI-145147 awarded to R.
W. K. We would like to thank Dr. Dominique Durand for the use of his
electrophysiology equipment, Dr. Leon Avery for the ser-1(ok345);ser-7(tm125) double
mutant, Dr. Shohei Mitani at the National Bioresources Project for the ser-7(tm1325) and
ser-7(tm728) mutants, and the Caenorhabditis elegans Genetics Center, which is
supported by the National Institutes of Health National Center for Research Resources,
26
for additional strains. We would also like to thank Dr. John Plenefisch and Sushant
Khandekar for critical discussion of the work.
27
LITERATURE CITED
Albertson, D. G. and Thompson, J. N. (1976) The pharynx of Caenorhabditis elegans.
Phil. Trans. R. Soc. Lond. B 275:299-325.
Avery, L. and Horvitz, H. R. (1987) A cell that dies during wild-type C. elegans
development can function as a neuron in ced-3 mutant. Cell 51:1071-1078.
Avery, L. and Horvitz, H. R. (1989) Pharyngeal pumping continues after laser killing of
the pharyngeal nervous system of C. elegans. Neuron 3:473-485.
Avery, L. and Thomas, J. H. (1997) Feeding and Defecation. In: C. elegans II, (Riddle,
D. L., Blumenthal, T., Meyer, B. J. and Priess, J. R., eds), pp. 679-719. Cold Spring
Harbor, New York: Cold Spring Laboratory Press.
Bany, I. A., Dong, M. Q. and Koelle, M. R. (2003) Genetic and cellular basis for
acetylcholine inhibition of Caenorhabditis elegans egg-laying behavior. J. Neuorsci.
23:8060-8069.
Brenner, S. (1974) The genetics of Caenorhabditis elegans. Genetics 77:71-94.
Brownlee, D. J., Holden-Dye, L., Walker, R. J. and Fairweather, I. (1995) The pharynx of
the nematode Ascaris suum: structure and function. Acta. Biol. Hung. 46:195-204.
Cheung, A. H., Sigal, I. S., Dixon, R. A. and Strader, C. D. (1989) Agonist-promoted
sequestration of the beta 2-adrenergic receptor requires regions involved in functional
coupling with Gs. Mol. Pharmacol. 35:132-138.
del Castillo, J. and Morales, T. (1967) The electrical and mechanical activity of the
esophageal cell of Ascaris lumbricoides. J. Gen. Physiol. 50:603-629.
28
Dempsey, C. M., Mackenzie, S. M., Gargus, A., Blanco, G. and Sze, J. Y. (2005) 5HT,
fluoxetine, imipramine and dopamine target distinct 5HT receptor signaling to modulate
Caenorhabditis elegans egg-laying behavior Genetics. 169:1425-1436.
Duvernay, M. T., Zhou, F. and Wu, G. (2004) A conserved motif for the transport of G
protein-coupled receptors from the endoplasmic reticulum to the cell surface. J. Biol.
Chem. 279:30741-30750.
Gao, T., Yatani, A., Dell'Acqua, M. L., Sako, H., Green, S. A., Dascal, N., Scott, J. D.
and Hosey, M. M. (1997) cAMP-dependent regulation of cardiac L-type Ca2+ channels
requires membrane targeting of PKA and phosphorylation of channel subunits. Neuron
19:185-196.
Gill, C. H., Soffin, E. M., Hagan, J. J. and Davies, C. H. (2002) 5-HT7 receptors
modulate synchronized network activity in rat hippocampus. Neuorpharmacology 42:8292.
Hamdan, F. F., Ungrin, M. D., Abramovitz, M. and Ribeiro, P. (1999) Characterization of
a novel serotonin receptor from Caenorhabditis elegans: cloning and expression of two
splice variants. J. Neurochem. 72:1372-1383.
Hobert, O. (2002) PCR fusion-based approach to create reporter gene constructs for
expression analysis in transgenic C. elegans. Biotechniques 32:728-730
Hobson, R. J., Geng, J., Gray, A. D. and Komuniecki, R. W. (2003) SER-7B, a
constitutively active Galphas coupled 5-HT7-like receptor expressed in the
Caenorhabditis elegans M4 pharyngeal motorneuron. J. Neurochem. 87:22-29.
Horvitz, H. R., Chalfie, M., Trent, C., Sulston, J. and Evans, P. D. (1982) Serotonin and
octopamine in the nematode C. elegans. Science 216:1012-1014.
29
Huang, X., Duran, E., Diaz, F., Xiao, H., Messer, W. S. Jr. and Komuniecki, R. W.
(1999) Alternative-splicing of serotonin receptor isoforms in the pharynx and muscle of
the parasitic nematode, Ascaris suum. Mol. Biochem. Parasitol. 101: 95-106.
Keane, J. and Avery, L. (2003) Mechanosensory inputs influence Caenorhabditis elegans
pharyngeal activity via ivermectin sensitivity genes. Genetics 164:154-162.
Komuniecki, R. W., Hobson, R. J., Rex, E. B., Hapiak, V. M. and Komuniecki, P. R.
(2004) Biogenic amine receptors in parasitic nematodes: what can be learned from
Caenorhabditis elegans? Mol. Biochem. Parasitol. 137:1-11.
Kramer, J. M., French, R. P., Park, E. C. and Johnson, J. J. (1990) The Caenorhabditis
elegans rol-6 gene, which interacts with sqt-1 collagen gene to determine organismal
morphology, encodes a collagen. Mol. Cell Biol. 10:2081-2089.
Krobert, K. A., Bach, T., Syversveen, T., Kvingedal, A. M. and Levy, F. O. (2001) The
cloned human 5-HT7 receptor splice variants: a comparative characterization of their
pharmacology, function and distribution. Naunyn Schmiedebergs Arch. Pharmacol.
363:620-632.
McKay, J. P., Raizen, D. M., Gottschalk, A., Schafer, W. R. and Avery, L. (2004) eat-2
and eat-18 are required for nicotinic neurotransmission in the Caenorhabditis elegans
pharynx. Genetics 166:161-169.
Mello, C. and Fire, A. Z. (1995) DNA transformation. In: Methods in Cell Biology
Caenorhabditis elegans: Modern Biological Analysis of an Organism (Epstein, H. F. and
Shakes, D. C. eds), Vol. 48 pp452-482. San Diego: Academic Press.
30
Moresco, J. J. and Koelle, M. R. (2004). Activation of EGL-47, Gαo-coupled receptor,
inhibits function of hermaphrodite specific neurons to regulate Caenorhabditis elegans
egg-laying behaviour. J. Neurosci. 24(89):8522-8530.
Niacaris, T. and Avery, L. (2003) Serotonin regulates repolarization of the C. elegans
pharyngeal muscle. J. Exp. Biol. 206:223-231.
Nurrish, S., Segalat, L. and Kaplan, J. M. (1999) Serotonin inhibition of synaptic
transmission: Galpha(0) decreases the abundance of UNC-13 at release sites. Neuron
24:231-242.
Obosi, L. A., Hen, R., Beadle, D. J., Bermudez, I. and King, L. A. (1997) Mutational
analysis of the mouse 5-HT7 receptor: importance of the third intracellular loop for
receptor-G-protein interaction. FEBS Lett. 412:321-324.
Olde, B. and McCombie, W. R. (1997) Molecular cloning and functional expression of a
serotonin receptor from Caenorhabditis elegans. J. Mol. Neurosci. 8:53-62.
Raizen, D. M. and Avery, L. (1994) Electrical activity and behavior in the pharynx of
Caenorhabditis elegans. Neuron 12:483-495.
Raizen, D. M., Lee, R. Y. and Avery, L. (1995) Interacting genes required for pharyngeal
excitation by motor neuron MC in Caenorhabditis elegans. Genetics 141:1365-1382.
Rand, J. B. and Nonet, M. L. (1997) Neurotransmitter assignments for specific neurons.
In: C. elegans II (Riddle, D. L., Blumenthal, T., Meyer, B. J., Preiss, J. R. and eds),
pp1049-1052. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Ranganathan, R., Cannon, S. C. and Horvitz, H. R. (2000) MOD-1 is a serotonin-gated
chloride channel that modulates locomotory behaviour in C. elegans. Nature 408:470475.
31
Rogers, C. M., Franks, C. J., Walker, R. J., Burke, J. F. and Holden-Dye, L. (2001)
Regulation of the pharynx of Caenorhabditis elegans by 5-HT, octopamine, and
FMRFamide-like neuropeptides. J. Neuorbiol. 333:235–244.
Ruat, M., Traiffort, E., Leurs, R., Tardivel-Lacombe, J., Diaz, J., Arrang, J. M. and
Schwartz, J. C. (1993) Molecular cloning, characterization, and localization of a highaffinity serotonin receptor (5-HT7) activating cAMP formation. Proc. Natl. Acad. Sci. U.
S. A. 90:8547-8551.
Schade, M. A., Reynolds, N. K., Dollins, C. M. and Miller, K. G. (2005) Mutations that
rescue the paralysis of Caenorhabditis elegans ric-8 (synembryn) mutants activate the G
alpha(s) pathway and define a third major branch of the synaptic signaling network.
Genetics 169:631-649.
Sawin, E. R., Ranganathan, R. and Horvitz, H. R. (2000) C. elegans locomotory rate is
modulated by the environment through a dopaminergic pathway and by experience
through a serotonergic pathway. Neuron 26:619-631.
Schinkmann, K. and Li, C. (1992) Localization of FMRFamide-like peptides in
Caenorhabditis elegans. J. Comp. Neurol. 316:251-260.
Shen, Y., Monsma, F.J., Metcalf, M.A., Jose, P.A., Hamblin, M.W. and Sibley, D.R.
(1993) Molecular cloning and expression of a 5-hydroxytrypamine7 serotonin receptor
subtype. J. Biol. Chem. 268:18200-18204.
Shyn, S. I., Kerr, R. and Schafer, W. R. (2003) Serotonin and Go modulate functional
states of neurons and muscles controlling C. elegans egg-laying behavior. Curr. Biol.
13:1910-1915.
Student (Gosset W.S.) (1908) The probable error of a mean. Biometrika 6:1-25.
32
Sze, J. Y., Victor, M., Loer, C., Shi, Y. and Ruvkun, G. (2000) Food and metabolic
signalling defects in a Caenorhabditis elegans serotonin-synthesis mutant. Nature
403:560-564.
Thomas, D. R. and Hagan, J. J. (2004) 5-HT7 receptors. Curr. Drug Targets CNS Neurol.
Disord. 3:81-90.
Trautwein, W. and Hescheler, J. (1990) Regulation of cardiac L-type calcium current by
phosphorylation and G proteins. Annu. Rev. Physiol. 52:257-274.
Tsalik, E. L., Niacaris, T., Wenick, A. S., Pau, K., Avery, L. and Hobert, O. (2003) LIM
homeobox gene-dependent expression of biogenic amine receptors in restricted regions of
the C. elegans nervous system. Dev. Biol. 263:81-102.
Waggoner, L. E., Zhou, G. T., Schafer, R. W. and Schafer, W. R. (1998) Control of
alternative behavioral states by serotonin in Caenorhabditis elegans. Neuron 21:203214.
Waggoner, L. E., Hardaker, L. A., Golik, S. and Schafer, W. R. (2000) Effect of a
neuropeptide gene on behavioral states in Caenorhabditis elegans egg-laying. Genetics
154:1181-1192.
Weinshenker, D., Garriga, G. and Thomas, J. H. (1995). Genetic and pharmacological
analysis of neurotransmitters controlling egg laying in C. elegans. J. Neurosci 15:69756985.
White, J., Southgate, E., Thomson, N. and Brenner, S. (1986) The structure of the
nervous system of the nematode Caenorhabditis elegans. Philos. Trans. R. Soc. Lond.
[Biol.] 314:1-340.
33
Table 1
Pharmacological profile of SER-7B transiently expressed in COS-7 cells
Ligand
pKi
Methiothepin
7.5 ± 0.02
Ritanserin
6.8 ± 0.1
Metergoline
6.7 ± 0.01
Clozapine
6.5 ± 0.02
Risperidone
6.4 ± 0.01
Digydroergotamine
6.4 ± 0.01
Cyproheptadine
6.1 ± 0.1
5-Methoxytryptamine
5.4 ± 0.2
5-HT
5.1 ± 0.02
SB-269970
5.1 ± 0.02
Gramine
5.1 ± 0.01
Methysergide
5.0 ± 0.01
Ketanserin
4.8 ± 0.1
Tryptamine
4.6 ± 0.02
α-methyl 5-HT
4.4 ± 0.1
WAY-100635
<4
5-CT
<4
Octopamine
<4
Tyramine
<4
34
Dopamine
<4
Epinephrine
<4
Norepinephrine
<4
Membranes from COS-7 transiently expressing SER-7B, with Kd and Bmax values of 86 ±
3 nM and 24 ± 3 pmol/mg respectively, were incubated with 10 nM [3H]-LSD in the
presence of unlabelled ligand at a range of concentrations to calculate the pKi. Data
represent the means ± SEM of at least three independent experiments performed in
triplicate. All binding data best fit a one-site model, with Hill slopes for all compounds
tested of around -1.0.
35
Table 2
Pharmacological profile of SER-7B compared to mammalian 5-HT7 receptors
Receptor
Radioligand
Cells
Pharmacological Profile
C. elegans
[3H]-LSD
COS-7
Methiothepin>Ritanserin=Metergoline>Clozapine>
Risperidone=Dihydroergotamine>Cyproheptadine>5-
SER-7B
MeOT>5-HT=SB-269970=gramine=methysergide>
Ketanserin>Tryptamine>α-methyl-5-HT>5-CT
a
R. norvegicus [3H]-LSD
COS-7
5-CT>Methiothepin>5-MeOT>5-HT>Metergoline>
Clozapine>Ritanserin>Tryptamine>Cyproheptadine>
5-HT7
Ketanserin
b
R. norvegicus [3H]-5-HT
5-HT7(a)
c
H. sapiens
5-HT7(a)
a
CHO
5-CT>5-HT>5-MeOT>Metergoline>Clozapine>
Cyproheptadine>Dihydroergotamine>Ketanserin
[3H]-5-HT
HEK293 5-CT>Methiothepin>5-HT>Metergoline>Clozapine>
Methysergide>Ritanserin>Ketanserin
Shen et al. (1993). bRuat et al. (1993). cThomas et al. (1998).
36
Table 3
Egg retention in C. elegans serotonin receptor mutants
Strain
# of eggs in uterus ± SEM N
N2
19.4 ± 0.9
32
ser-7(tm1325)
22.3 ± 1.2
29
ser-7(tm1728)
21.2 ± 1.2
15
ser-1(ok345)
18.4 ± 0.6
36
ser-7;ser-1
31 ± 1.2*
33
ser-4(ok512)
13.7 ± 0.8*
27
ser-7;ser-4
18.5 ± 0.9
33
Eggs retained within the uterus were counted in one day old adult animals, as described
in Methods. * significantly different from N2 (P<0.005).
37
FIGURE LEGENDS
Figure 1. Genomic structure of ser-7 and characterization of ser-1 and ser-7 rescue
constructs. A. Exons are shown in white, introns as a single line and 5’ and 3’ UTRs in
grey. The positions of GFP in the ser-7::gfp and ser-1::gfp translational fusions are
illustrated, as are the positions of the deletions in ser-7(tm1325), ser-7(tm1728) and ser1(ok345) animals. The name of transgenic line created with each construct is shown in
brackets. B. Predicted membrane topology of SER-7, showing the position of GFP in
the third intracellular loop. GFP is located after residue R251. Arrows indicate mutations
in SER-7BE314A/K316AI3GFP.
Figure 2. The insertion of GFP into the SER-7B third intracellular loop has no effect on
G-protein coupling. Native SER-7B (open circles), SER-7BI3GFP (closed circles) and
SER-7BE314A/K316AI3GFP (closed squares) were transiently expressed in COS-7 cells and
EC50s for 5-HT were determined, as described in Methods. 5-HT did not alter cAMP
levels in untransfected COS-7 cells (open squares).
Figure 3. SER-7 is essential for 5-HT stimulated pharyngeal pumping. Pharyngeal
pumping was assayed either in the presence of E. coli OP50 and/or 13 mM 5-HT, as
described in Methods, in N2s, or animals carrying the ser-7 null alleles (tm1325 or
tm1728), the ser-1 null allele (ok345), the ser-4 null allele (ok512) or in ser7(tm1325);ser-4(ok512) or ser-7(tm1325);ser-1(ok345) double mutants. In addition, ser7(tm1325) animals were rescued with a full length ser-7::gfp translational fusion (ser-
38
7(tm1325)(+)). * different from N2 in the presence of bacteria (P<0.005), † different
from N2 in the presence of 5-HT (P <0.0005), ‡ different from N2 in the presence of 5HT and bacteria (P <0.0005). n = 30 for each strain.
Figure 4. Serotonin receptor and synthesis mutants exhibit more variation in rates of
pharyngeal pumping on bacteria than N2s. Pharyngeal pumping (pumps/10s) on bacteria
was measured in individual animals every 30 seconds for 10 minutes, as described in
Methods. Pumping rates/10 seconds from at least 7 animals were pooled and plotted as
histograms for each strain. A-G. N2, ser-7(tm1325), ser-7(tm1325)(+)(erEx1517), ser1(ok345), ser-1(ok345)(+)(erEx1617), ser-7(tm1325);ser-1(ok345) and tph-1(mg280)
animals were examined. Inset on each histogram shows the mean pumping rate ± SEM
and the n for each strain. * mean pumping rate/10 sec different from N2 by T test
(P<0.0005). † distribution of pumping rates different from N2 by Kolmogorov-Smirnov
test (P<0.005) . The black line on each graph represents 43 pumps/10s, the mean value
for N2s.
Figure 5. Expression of the full length ser-7::gfp translational fusion with sequence
coding for GFP inserted into the predicted SER-7 third intracellular loop is limited to a
number of pharyngeal neurons and vulval muscle. The ser-7::gfp PCR fusion was
injected into ser-7(tm1325) animals and the transgenic worms (erEx1517) were examined
for fluorescence using a confocal microscope. A. Fluorescence from SER-7::GFP in a
subset of pharyngeal neurons. B. SER-7::GFP fluorescence in vulval muscle. Left panel,
39
GFP fluorescence in the vulval muscle. Right panel, an overlay of the GFP stack and a
single DIC image showing the vulval opening.
Figure 6. Electropharyngeograms of N2, ser-7(tm1325) and ser-7(tm1325)(+)
(erEx1517) animals. A. EPGs were recorded in the presence of 13 mM 5-HT, as
described in Methods. * indicates an E1 spike. Most N2s exhibit two E phase transients
(E1 and E2). In contrast, most (> 95%) of the pumps of the ser-7(tm1325) animals lack
the E1 transient, which has been previously been associated with MC activity (Raizen et
al., 1995).. Inset: a few (< %5) of the traces from ser-7(tm1325) animals show an early E
phase transient (marked by the arrow) preceding the large E2 transient. B. Histograms
comparing the number of traces exhibiting an E1 phase transient in N2, ser-7(tm1325)
and ser-7(tm1325)(+) (erEx1517) animals. Data from 20 traces from at least 10 different
animals from each strain were examined.
Figure. 7. SER-7 is essential for the 5-HT stimulation of egg-laying. Synchronized
animals were placed on NGM plates in the presence of 13 mM 5-HT and/or E. coli OP50
and eggs laid were counted after 1hr, as described in Methods. N2s, or animals carrying
the ser-7 null alleles (tm1325 or tm1728), the ser-1 null allele (ok345), the ser-4 null
allele (ok512) or in ser-7(tm1325);ser-4(ok512) or ser-7(tm1325);ser-1(ok345) double
mutants were examined. In addition, ser-7(tm1325) animals were rescued with a full
length ser-7::gfp translational fusion (ser-7(tm1325)(+)) * mean eggs laid/animal
different from N2 in the presence of 5-HT (P <0.005). ** mean eggs laid/animal
40
different from N2 in the presence of 5-HT (P <0.05). † mean eggs laid/animal different
from N2 in the presence of 5-HT and bacteria (P <0.005). n = 45 for each strain.
41
Figure 1
A
tm1728
(erEx1517)
ser-7::gfp
1 kb
GFP
tm1325
GFP
(erEx1617)
ser-1::gfp
ok345
B
A
K
C
E
S
GFP
A
A
R
P
42
% Basal cAMP
Figure 2
[5-HT] M
43
Figure 3
250
N2
ser-7(tm1325)
200
ser-7(tm1728)
*
‡
Pumps/min
ser-1(ok345)
‡
ser-4(ok512)
150
ser-7;ser-1
††
ser-7;ser-4
100
ser-7(tm1325)(+)
†
‡
‡
†
5
0
0
Basal
+ Bacteria
+ 5-HT
44
+ Bacteria
+ 5-HT
Figure 4
A
N2
43 ± 0.3 pumps/10s
N = 160
30
25
Frequency
35
20
15
10
5
Pumps/10s
0
0 5 10 15 20 25 30 35 40 45 50
35
B
ser-7(tm1325) *†
38.3 ± 0.6 pumps/10s
N = 180
35
30
25
20
25
20
15
10
10
5
5
0
0
0 5 10 15 20 25 30 35 40 45 50
0 5 10 15 20 25 30 35 40 45 50
D
35
ser-1(ok345) *†
39.2 ± 0.5 pumps/10s
N = 140
30
25
15
15
10
10
5
5
0
0
0 5 10 15 20 25 30 35 40 45 50
25
20
ser-1(ok345)(+)
44.5 ± 0.2 pumps/10s
N = 140
25
20
30
E
30
20
35
ser-7(tm1325)(+)
41.7 ± 0.7 pumps/10s
N = 140
30
15
35
C
F
0 5 10 15 20 25 30 35 40 45 50
35
ser-7;ser-1 *†
33.9 ± 0.5 pumps/10s
N = 180
30
25
G
tph-1(mg280) *†
30.4 ± 0.6 pumps/10s
N = 200
20
15
15
10
10
5
5
0
0
0 5 10 15 20 25 30 35 40 45 50
0 5 10 15 20 25 30 35 40 45 50
45
Figure 5
A
I6
I2s
MCs
I4
I3
M4
B
46
M2
M5
Figure 6
A.
*
60 mV
N2
100 ms
ser-7(tm1325)
*
ser-7(tm1325)(+)
B.
% pumps with E1 spike
100
80
60
40
20
0
*
N2 (tm1325) (tm1325)(+)
47
Figure 7
25
Eggs laid/animal
20
15
N2
ser-7(tm1325)
ser-7(tm1728)
ser-1(ok345)
ser-4(ok512)
ser-7;ser-1
ser-7;ser-4
ser-7(tm1325)(+)
**
10
5
†††
0
+ Bacteria
** * *
+ 5-HT
†
+ Bacteria
+ 5-HT
48