FEMS Yeast Research, 15, 2015, fov033
doi: 10.1093/femsyr/fov033
Advance Access Publication Date: 8 June 2015
Research Article
RESEARCH ARTICLE
The translation termination factor eRF1 (Sup45p) of
Saccharomyces cerevisiae is required for pseudohyphal
growth and invasion
Alexandra Petrova† , Denis Kiktev‡ , Olga Askinazi§ , Svetlana Chabelskaya¶ ,
Svetlana Moskalenko, Olga Zemlyanko and Galina Zhouravleva∗
Department of Genetics and Biotechnology, St Petersburg State University and St Petersburg Branch Vavilov
Institute of General Genetics, Russian Academy of Science, Universitetskaya emb. 7/9, 199034,
St Petersburg, Russia
∗ Corresponding author: Department of Genetics and Biotechnology, St Petersburg State University, Universitetskaya emb. 7/9, 199034 St Petersburg,
Russia. Tel: +79119384080; E-mail [email protected]
†
Present address: Department of Radiation Oncology, Emory School of Medicine, Emory University, Atlanta, GA 30322, USA
‡
Present address: Laboratory of amyloid biology, St Petersburg State University, Universitetskaya emb. 7/9, 199034 St Petersburg, Russia
§
Present address: Department of Biology, University of Virginia, P.O. Box 400328, Charlottesville, VA 22904-4328, USA
¶
Present address: Inserm U835, Upres EA2311, Université Rennes 1, 2, avenue du prof. Léon Bernard, 35043 Rennes Cedex, France
One sentence summary: Mutations in the SUP45, but not in the SUP35, gene abolish diploid pseudohyphal growth and suggest that they are defective in
the cAMP-dependent cascade inducing pseudohyphal growth.
Editor: Monique Bolotin-Fukuhara
ABSTRACT
Mutations in the essential genes SUP45 and SUP35, encoding yeast translation termination factors eRF1 and eRF3,
respectively, lead to a wide range of phenotypes and affect various cell processes. In this work, we show that nonsense and
missense mutations in the SUP45, but not the SUP35, gene abolish diploid pseudohyphal and haploid invasive growth.
Missense mutations that change phosphorylation sites of Sup45 protein do not affect the ability of yeast strains to form
pseudohyphae. Deletion of the C-terminal part of eRF1 did not lead to impairment of filamentation. We show a correlation
between the filamentation defect and the budding pattern in sup45 strains. Inhibition of translation with specific antibiotics
causes a significant reduction in pseudohyphal growth in the wild-type strain, suggesting a strong correlation between
translation and the ability for filamentous growth. Partial restoration of pseudohyphal growth by addition of exogenous
cAMP assumes that sup45 mutants are defective in the cAMP-dependent pathway that control filament formation.
Keywords: translation termination; nonsense mutations; eRF1; eRF3; pseudohyphal growth; budding; hygromycin B;
cycloheximide; paromomycin; cAMP
INTRODUCTION
In eukaryotes, two protein factors, eRF1 and eRF3, are essential
for the translation termination (Frolova et al. 1994; Zhouravleva
et al. 1995). Factor eRF1 recognizes all three stop codons (UAA,
UAG and UGA) and releases a newly synthesized peptide (Frolova
et al. 1994). Factor eRF3 stimulates termination activity of eRF1
in the GTP-dependent manner (Frolova et al. 1996). Both genes,
SUP45 and SUP35, encoding eRF1 and eRF3, respectively, are
essential in yeast Saccharomyces cerevisiae (Himmelfarb, Maicas
and Friesen 1985; Wilson and Culbertson 1988). Despite this,
we have previously isolated non-lethal nonsense mutations in
SUP45 and SUP35 genes (designated sup45-n and sup35-n, respectively), which reduced the amount of eRF1 or eRF3 (Moskalenko
Received: 10 October 2014; Accepted: 26 May 2015
C FEMS 2015. All rights reserved. For permissions, please e-mail: [email protected]
1
2
FEMS Yeast Research, 2015, Vol. 15, No. 4
et al. 2003; Chabelskaya et al. 2004). Strains carrying these nonsense mutations were shown to have increased levels of endogenous tRNAs, that may be responsible for the viability of cells with
impaired translation termination (Zhouravleva et al. 2006).
Most of the mutations in SUP45 and SUP35 genes selected as
omnipotent suppressors are characterized by pleiotropic manifestations (Inge-Vechtomov, Zhouravleva and Philippe 2003). In
most cases, it is not known whether these effects are a direct result of a translation termination defect, or whether they are mediated by participation of eRF1 and/or eRF3 proteins in cellular
processes not directly related to translation termination. Data
obtained in yeast prove that translation termination factors interact with components of different cellular systems, including
the NMD complex (Czaplinski et al. 1998), poly(A)-binding protein (Hoshino et al. 1999; Cosson et al. 2002; Uchida et al. 2002),
a system of mRNA export from the nucleus (Gross et al. 2007;
Bolger et al. 2008), as well as actin (Bailleul et al. 1999) and tubulin
(Valouev et al. 2004) cytoskeletons. Furthermore, several eRF1linked phenotypes (e.g. sensitivity to caffeine, inability to utilize non-fermentable carbon sources) were recently shown to be
not linked to translation termination (Valouev, Kushnirov and
Ter-Avanesyan 2002; Merritt et al. 2010).
Mutations sup45 and sup35 are associated with the loss of
chromosomes (Borchsenius, Tchourikova and Inge-Vechtomov
2000) and cytokinesis defects (Valouev et al. 2004). A decrease in
the amount of eRF1 or eRF3C (a C-terminal fragment of eRF3)
in the cells influences cell morphology and/or cell cycle progression (Valouev, Kushnirov and Ter-Avanesyan 2002). It is assumed that eRF1 is involved in regulation of the cell cycle in
Arabidopsis thaliana (Petsch, Mylne and Botella 2005). A decrease
in eRF3C in yeast leads to actin depolymerization (Valouev,
Kushnirov and Ter-Avanesyan 2002). In mammalian cells, eRF3
depletion induces cell cycle arrest at the G1 phase through inhibition of the pathway, controlled by mTOR protein (Chauvin,
Salhi and Jean-Jean 2007). Nonsense mutations in the SUP45
gene led to impairment in the pseudohyphal growth of strains
from Peterhof Genetic Collection of St Petersburg State University (PGC) (Zhouravleva and Petrova 2010).
Yeast is a dimorphic fungus able to grow in two morphologically different forms. The ‘yeast’ form is characterized by
ovoid cells, which separate shortly after mitosis. In the filamentous form, cells become elongated, stay attached to each
other and form branched chains. The term ‘pseudohyphal (PH)
growth’ is used to distinguish this filamentous form from true
hyphal growth typical of Candida albicans, a pathogenic yeast
species. Signal cascades that regulate morphological shift in
these species are highly conserved (Whiteway, Dignard and
Thomas 1992; Liu, Kohler and Fink 1994; Kohler and Fink 1996;
Leberer et al. 1996). Only diploid yeast strains possess the ability
to form pseudohyphae in response to environmental changes,
though haploid strains develop a related phenotype, characterized by the invasion of a growing colony into the agar (Roberts
and Fink 1994). PH growth of diploids and invasive growth of
haploids are triggered by largely overlapping regulatory cascades (see Gagiano, Bauer and Pretorius 2002 for review). FLO11,
a target gene of these cascades, encodes GPI-anchored cell surface glycoprotein and plays a crucial role in filamentous growth
development in both diploid and haploid strains (Guo et al. 2000).
In this paper, using strains of different origin, we show that
sup45 mutations that reduce the efficiency of translation termination result in disruption of the PH growth of diploid strains,
while mutations that disrupt eRF1 phosphorylation or improve
the efficiency of translation termination do not have this effect.
Missense and nonsense sup45 mutations lead to a change in the
budding pattern in both diploid and haploid strains, and abolish the invasive growth of haploid strains. However, sup35 mutations do not impair PH growth, proving that this effect is specific
for defects of eRF1.
MATERIALS AND METHODS
Strains
Escherichia coli strain used was XL1-Blue (recA1, endA1, gyrA96,
thi-1, hsdR17, supE44, relA1 [F’, proAB, lacIq, (lacZ)M15, Tn10(tet)])
(Sambrook, Fritsch and Maniatis 1989).
All yeast strains (Table 1) used in this study (except 1a-D1628
and D1631) are congenic to the 1278b genetic background (Liu,
Styles and Fink 1993).
Table 1. Yeast strains.
Strain
Genotype or description
Background
Source
1a-D1628
1b-D1628
D1631
16a-D1608
MATα ade1-14 his3 leu2 ura3 trp1 lys2 sup45::HIS3 [SUP45]
MATa ade1-14 his3 leu2 ura3 trp1 lys2 sup45::HIS3 [SUP45]
MATα/MATa diploid of 1a-D1628 × 1b-D1628
MATa ade1-14 his7-1 lys2-87 met13-A1 thr4-B15 trp1 ura3-52 leu2-3,112
SUP35::TRP1
MATα ura3-52 his3::hisG leu2::hisG
MATa ura3-52 trp1::hisG leu2::hisG his3::hisG
MATa//MATα ura3-52//ura3-52 leu2::hisG//leu2::hisG trp1::hisG//TRP1
his3::hisG//his3::hisG
MATa//MATα ura3-52//ura3-52 leu2::hisG//leu2::hisG trp1::hisG//TRP1
his3::hisG//his3::hisG SUP35//sup35::HIS3
MATα ura3-52 his3::hisG leu2::hisG trp1::hisG sup35::HIS3 [SUP35]
MATa//MATα ura3-52//ura3-52 leu2::hisG//leu2::hisG trp1::hisG//TRP1
his3::hisG//his3::hisG SUP45//sup45::HIS3
MATα ura3-52 his3::hisG leu2::hisG SUP45::HIS3 [SUP45]
MATa//MATα ura3-52//ura3-52 his3::hisG//his3::hisG
leu2::hisG//leu2::hisG trp1::hisG//TRP1 sup35::HIS3// sup35::HIS3 [SUP35]
MATa//MATα ura3-52//ura3-52 his3::hisG//his3::hisG
leu2::hisG//leu2::hisG trp1::hisG//TRP1 sup45::HIS3// sup45::HIS3 [SUP45]
GT81
GT81
GT81
GT81
Moskalenko et al. (2003)
Moskalenko unpublished
This study
Chabelskaya et al. (2004)
1278b
1278b
1278b
From H-U. Mosch
1278b
This study
1278b
1278b
This study
This study
1278b
1278b
This study
This study
1278b
This study
10560-23c
10560-4a
D1639
D1640
8a-D1640
D1641
9a-D1641
D1642
D1643
This study
Petrova et al.
Table 2. Mutations in SUP45 and SUP35 genes, studied in this work.
Mutation
In SUP45 gene:
sup45-101
sup45-102
sup45-104
sup45-105
sup45-107
sup45-103
sup45-113
A2
A8
B1
C6
C11
S421D/S432D
S421A/S432A
In SUP35 gene:
sup35-21
sup35-228
Amino acid change
Source
E266 → stop
Y 53 → stop
L283 → stop
E385 → stop
L317 → stop
L21S
M48I
E360V
E104K
Q76R
Q76K
N58K
S421D, S432D
S421A, S432A
Moskalenko et al. (2003)
Q422→ stop
R372→stop
Cosson et al. (2002)
Chabelskaya et al. (2004)
Hatin et al. (2009)
Kallmeyer et al. (2006)
Strain D1631 is the autodiploid derivative of 1a-D1628 (Le Goff
et al. 2002) induced by the YRp-HO plasmid, which contains the
homothallism (HO) gene. Strain 1a-D1628 is the isogenic derivative of strain GT81 (Chernoff et al. 2000). The diploid strains
D1640 (sup35::HIS3) and D1641 (sup45::HIS3) are derivatives of
the strain 10560 (obtained from H-U. Mosch) in a 1278b background (Rupp et al. 1999) http://wiki.yeastgenome.org/index.
php/History of Sigma). The diploid strain D1639 was obtained by
mating 10560-23c and 10560-4a. This strain was further used for
construction of D1640 (sup35::HIS3) and D1641 (sup45::HIS3) using the PCR-targeting procedure (Longtine et al. 1998). HIS3 cassettes were amplified by PCR from plasmid pFA6a-His3MX6 with
a pair of primers that included 40 bp upstream and downstream
of the SUP35 or SUP45 open reading frame and integrated into the
genome by homologous recombination. The haploid strains 8aD1640 and 9a-D1641 were recovered from the meiotic progeny
of D1640 and D1641, respectively.
Yeast plasmids
The centromeric (CEN) plasmids pRS315/SUP45, pRS315/sup45
and pRS316/SUP45 (Moskalenko et al. 2003) express SUP45 or
its mutant alleles from its own promoter. Construction of
pRSU1/ sup35-21 was described earlier (Chabelskaya et al. 2004),
pRSU1/sup35-228 plasmid was constructed by replacing the
1.3-kb PstI-NcoI fragment of SUP35 from pRSU1 by the PstI-NcoI
fragments from pGEMT/sup35-228 plasmid. The presence of
sup35 mutation was verified by sequencing. Plasmids bearing
mutations affecting the phosphorylation sites of eRF1 or different sup45 antisuppressor mutations (Table 2) were described
earlier. Plasmid pDB843 encodes eRF1 protein lacking the Cterminal 19 amino acids (Kallmeyer, Keeling and Bedwell 2006).
Derivatives of pGP564 contain segments of the yeast S. cerevisiae genome (Yeast Genomic Tiling Collection, Open Biosystems) (Jones et al. 2008).
Genetic and microbiological procedures
Standard rich YPD medium, synthetic complete SC medium and
selective media lacking individual components of SC were used
3
(Sherman, Fink and Hicks 1986). Yeast strains were grown at
25◦ C. Synthetic low-ammonia dextrose medium (SLAD) used to
induce PH development was prepared as described (Gimeno et al.
1992). Strains scored for PH filament formation were streaked
on SLAD plates, and representative colonies were photographed
after 5 days of growth at 25◦ C. Haploid invasive growth was assayed as described (Roberts and Fink 1994). Haploid strains were
grown on YPD medium for 3 days. Surface cells were washed off,
and the plate was incubated for 30 h at 25◦ C. The plate-washing
assay was performed as previously described (Roberts and Fink
1994).
Yeast transformation was performed by lithium acetate
procedure (Gietz et al. 1995). For E. coli transformation, the
high-efficiency procedure was performed (Inoue, Nojima and
Okayama 1990). The haploid strain (sup::HIS3 [CEN URA3 SUP45])
was transformed with [CEN LEU2 sup45] plasmids. Transformants, selected on −Ura−Leu medium, were replica plated onto
5-FOA medium (1 mg ml−1 , purchased from Sigma), which counterselects against URA3 plasmids and thus against wild-type
SUP45 gene (Boeke, LaCroute and Fink 1984).
For quantitative characterization of nonsense suppression,
β-galactosidase reporter system (Stansfield, Akhmaloka and
Tuite 1995) was employed. In this the vector-based assay, we
used plasmids that were not subjected to NMD (Wang et al. 2001).
Previously, we also showed that the steady-state levels of wildtype and nonsense-containing lacZ transcripts were nearly identical and proportional to the amount of actin mRNA (Cosson
et al. 2002). Yeast strains were transformed with UAA, UAG or
UGA plasmids carrying TAA, TAG or TGA (termination codons),
respectively, cloned in frame with lacZ or with control LacZ
plasmid containing the lacZ gene without the stop codon (all
plasmids were a gift of S. Peltz and W. Wang). Only in the
case of nonsense suppression could active β-galactosidase be
synthesized. Efficiencies of suppression were calculated as a
ratio of β-galactosidase activity in cells harboring lacZ with
premature termination codon to that in cells with a normal allele of lacZ. Values for liquid β-galactosidase assay represent the
mean of at least three assays from each of three independent
transformants.
Qualitative assessment of intracellular cAMP levels was conducted using iodine staining of intracellular glycogen (Chester
1968; Enjalbert et al. 2000), which gives inverse proportional estimation of cAMP (Kubler et al. 1997). For this purpose, cells were
spotted on YNB plates supplemented with uracil. After 6 days of
incubation, plates were inverted over iodine crystals for 1 min,
removed for 15 s and exposed again for 2 min.
Photomicroscopy
For calcofluor staining, cultures were grown on YPD or SC liquid
medium to the mid-logarithmic phase (OD600 ∼ 0.6–0.8). About
108 cells were harvested, washed and mixed with 20 μl of calcofluor white (Sigma) solution (1 mg ml−1 ). After 10 min of incubation, cells were washed three times in 1× PBS, mounted in
50% glycerol/PBS and viewed using Zeiss Axiolab system (Zeiss).
Fluorescent images were acquired at 100× magnification with
Canon Powershot 7.2 camera. Budding pattern analysis was performed as described (Cali et al. 1998) with minor alterations. Cells
with four bud scars were scored. At least 200 cells were scored
for each strain.
Pearson product moment correlation coefficient (r) was calculated using Microsoft Excel software.
4
FEMS Yeast Research, 2015, Vol. 15, No. 4
Reverse transcription of RNA from yeast cells
For extraction of RNA, cultures were grown in SC liquid medium
to the mid-logarithmic phase (OD600 ∼ 0.6–0.8). Cells were harvested, washed and further grown in SLAD liquid medium during 8 h. Total RNA was extracted from cultures with the Ambion
RiboPure-Yeast (Applied Biosystems) according to the manufacturer’s instructions. Purified RNA was reverse transcribed with
iScript Select kit (Bio-Rad).
Quantitative polymerase chain reaction
The expression of target genes was analyzed by quantitative PCR
(qPCR) with iQ SYBR Green supermix (Bio-Rad) according to the
manufacturer’s instructions. The following primers were used:
ACT1-F (TCGAACAAGAAATGCAAACCGCTGC),
ACT1-R (TGACTTGACCATCTGGAAGTTCGTAGG)
FLO11-F (TATTGACCTGAAGTATCTATGG)
FLO11-R (TATTGAGCGGCACTACCT).
Triplicate qPCRs were performed for each sample. The CT
method (Livak and Schmittgen 2001) was used to measure the
relative fold quantification.
Protein isolation
Protein isolation, SDS-PAGE electrophoresis and western blotting were described previously (Chabelskaya et al. 2004). Polyclonal rabbit antibodies (SE-45-2; Kiktev et al. 2009) were used
to detect the Sup45 protein.
RESULTS
Mutations in the SUP45 gene impair formation
of pseudohyphae in diploid strains
All sup45-n (nonsense) and sup45-m (missense) mutations used
in this study were selected by the effect of simultaneous suppression of nonsense mutations his7-1 (UAA) and lys9-A21 (UAA)
(Moskalenko et al. 2003), and therefore affect the main function of the Sup45 protein—termination of translation. We compared the induction of PH growth among sup45-n or sup45-m mutants with that in yeast strains bearing either mutations that
disrupt eRF1 phosphorylation (Kallmeyer, Keeling and Bedwell
2006) or mutations that improve the efficiency of translation
termination (Hatin et al. 2009). For this purpose, we used yeast
strains with 1278b and GT81 genetic backgrounds. Derivatives of 1278b are traditionally used to study PH growth, while
derivatives of GT81 have not previously been used for this
purpose. The full list of sup45 mutations studied is given in
Table 2: among them were five nonsense mutations (sup45-101,
sup45-102, sup45-104, sup45-105 and sup45-107) and two missense mutations (sup45-103 and sup45-113) described in our previous studies (Moskalenko et al. 2003, 2004), as well as two mutations that disrupt eRF1 phosphorylation (Kallmeyer, Keeling and
Bedwell 2006) and five mutations that improve the efficiency of
translation termination (Hatin et al. 2009).
Strains D1631 (GT81 background) and D1643 (1278b background) are diploid strains homozygous for deletion of the SUP45
gene. Viability of the strains is maintained by a CEN plasmid
with a URA3 marker bearing the wild-type SUP45 gene. A plasmid shuffle technique (see the section ‘Materials and Methods’)
was used to substitute this plasmid with a CEN plasmid with a
LEU2 marker bearing a mutant allele of the SUP45 gene. Since
only MATa/α diploids are able to shift to PH form, we monitored
the heterozygosity of strains for mating type locus by crossing
the strains with haploid testers. This was necessary because
sup45 mutations increase chromosomal instability (Borchsenius,
Tchourikova and Inge-Vechtomov 2000) and loss of MAT heterozygosity would lead to the blocking of PH growth. PH growth
was evaluated in low-ammonia medium (SLAD) only for nonmating colonies. The diploid strain D1643 bearing any sup45
nonsense mutations or missense mutation sup45-103 did not
form pseudohyphae (Fig. 1A, upper panel). Similar results were
obtained for the strain D1631 (Fig. 1A, lower panel). Missense
mutation sup45-113 did not completely abolish pseudohyphae
formation in either of the genetic backgrounds.
To detect the amount of the Sup45 protein in the sup45
mutants in different conditions, we used western blot hybridization (Fig. S1, Supporting Information). In accordance with previous data (Moskalenko et al. 2003), cells bearing nonsense mutations sup45-104 and sup45-105 contained decreased amount of
full-length Sup45p accompanied by truncated fragments with
molecular mass consistent with the predicted one (31.5 and
43.0 kDa, respectively). Western blot analysis did not reveal the
presence of truncated protein in lysates prepared from the
sup45-107 strain (Fig. S1, Supporting Information). Failure to detect such truncated protein with a predicted molecular mass of
35.2 kDa can be explained by antigen-binding specificities of antibodies. Relative to the level of Sup45p in the wild-type strain
(set to 1), the amount of full-length Sup45p in the sup45-113
(missense), sup45-104, sup45-105, sup45-107 strains were 0.90,
0.28, 0.20, 0.26 on YPD medium and 0.80, 0.15, 0.18, 0.24 in SLAD
medium, respectively. Thus, inability of sup45 mutants to undergo PH growth cannot be explained by a decreased amount of
Sup45 protein in low-ammonia medium.
Double amino acid substitutions that prevent Sup45p phosphorylation (S421A/S432A) or mimic constitutive phosphorylation (S421D/S432D) did not lead to impairment of PH growth in
diploids with a different genetic background (Fig. 1B, left). Mutations in the SUP45 gene that increase translation termination efficiency had different effects on PH differentiation (Fig. 1B, right).
Mutations A2 and B1 diminished the ability of strains of both
1278b and GT81 backgrounds to form pseudohyphae. Mutation
C6 abolished PH growth in the strain of GT81 but not the 1278b
background. Mutation C11 did not influence PH growth of either
strain.
Prolonged incubation of haploid strains on the rich medium
provokes them to penetrate the agar; hence, this growth type
is known as invasive growth. We found that wild-type haploid strains of the GT81 genetic background are not able to invade the agar (data not shown). A haploid strain 9a-D1641 of
1278b genetic background developed a strong invasive phenotype and was employed in a plasmid shuffle experiment to check
the effects of mutant sup45 alleles. Two tested nonsense mutations, sup45-102 and sup45-104, and a missense mutation, sup45103, reduced the ability of the haploid strain to invade the agar
(Fig. 2).
Transcription profiles were previously built for wild-type
strains and strains bearing sup45-103 mutation grown in lowammonia medium compared to the same strains grown in standard SD medium using the Affymetrix Genechip WT Sense Target Labeling Assay (Petrova et al., unpublished). These data will
be presented elsewhere. Amount of sup45-103 mRNA was not
changed in SLAD medium compared with SD medium. Thus,
defect in PH growth of this mutant cannot be explained by decreased level of the SUP45 mRNA. FLO11 transcript was not detected in the global transcription assay, so FLO11 expression was
checked by a quantitative real time PCR. ACT1 was used as a
reference gene. A small but reproducible increase in the FLO11
Petrova et al.
5
Figure 1. Yeast cells with sup45 nonsense and missense mutations are defective in PH development. Diploid strains D1643 (1278b background) and D1631 (GT81
background) bearing SUP45 (WT) or plasmids with sup45 mutations were induced to undergo PH growth in a nitrogen-limiting SLAD medium; colony morphology was
estimated after 5 days at 30◦ C. (A) Mutations selected as nonsense suppressors. (B) Mutations affecting Sup45p phosphorylation or leading to antisuppression.
mRNA levels was detected in the strains bearing sup45-102 (1.27
± 0.085) or sup45-103 (2.95 ± 0.326) mutation. Thus, a lack of PH
and invasive growth is not likely to be due to a low level of Flo11p.
To learn more on how reduced and expressed level on these
genes affects PH growth and budding, we have tested whether
high copy expression of some of the genes suppresses the observed phenotypes. Overexpression of TAO3, BUD8, PHD1, DFG16
and GPI1 in sup45 mutants had no effect on PH growth (data not
shown).
Suppressor mutations in the SUP45 gene lead to a
change in the budding pattern in diploid and haploid
strains
Upon nitrogen source depletion, vegetative diploid cells with
bipolar budding acquire an axial budding pattern and form long
chains of cells (Gimeno et al. 1992; Kron, Styles and Fink 1994).
We hypothesized that the inability of sup45 mutants for PH
growth can be attributed to changes in budding pattern. We analyzed the distribution of budding sites in the D1631 derivatives
bearing different sup45 mutant alleles (we could not apply a similar analysis to the strain D1643 due to the strong flocculation
of all D1641 derivatives that prevented accurate counting of the
bud scars).
The presence of sup45 suppressor mutations led to a significant decrease in cells with bipolar budding while the proportion of cells with the random budding was 3–5-fold higher compared to the wild-type strain (Fig. 3A). Double amino acid substitutions that prevent Sup45p phosphorylation (S421A/S432A)
or mimic constitutive phosphorylation (S421D/S432D) led to an
increase in the proportion of cells with an axial budding type
and to a complementary decrease in the number of cells with
bipolar budding without changing the proportion of cells with
random budding (Fig. 3B). Strains bearing sup45 mutations that
increase translation termination efficiency had a higher proportion of cells with a random type of budding, although to a lesser
extent than strains with mutations that decrease the efficiency
of translation termination (Fig. 3C). Apparently, the altered budding pattern in the sup45-n and sup45-m mutant strains is one of
the factors that reduce the capacity for PH growth.
In the haploid state, yeast cells typically exhibit axial budding type as detected for the strain 1a-D1628 (Fig. 4A). The
same strain bearing mutant sup45 alleles had a significant (7–
20%) decrease in the proportion of cells with axial budding, and
had a complementary increased number of cells with random
and bipolar budding pattern. This effect was most pronounced
in the presence of nonsense mutations sup45-104, sup45-105
and sup45-107. The strain bearing weak missense mutation
6
FEMS Yeast Research, 2015, Vol. 15, No. 4
Figure 2. SUP45 is required for invasive growth. Haploid strain 9a-D1641 (1278b background) bearing pRS315/SUP45 (WT) or pRS315/sup45 plasmids was patched on
a YPD plate and incubated for 5 days at 30◦ C. The plate was photographed before (total growth) and after (invasive growth) washing the cells off the agar surface.
sup45-113 showed a budding pattern identical to the wild
type. Supporting these data, strain 9a-D1641 bearing mutations
sup45-102, 103 and 105 had a significant decrease in the proportion of cells with an axial budding pattern and a higher number of randomly budding cells compared to the wild-type strain
(Fig. 4B). We also tested the budding pattern in different sup45
antisuppressor mutants. As shown in Fig. S2 (Supporting Information), the character of budding was not changed compared to
the wild-type cells.
To test the relationship between the budding pattern and
efficiency of nonsense suppression, we measured stop codon
readthrough in the same derivatives of the strain 1a-D1628
(Fig. 4A) grown under the same conditions that were used for
budding analysis. For this purpose, a vector-based assay system
for quantification of nonsense codon readthrough in vivo was
employed (Stansfield, Akhmaloka and Tuite 1995). In the omnipotent mutants tested, nonsense suppression levels of all stop
codons varied between 2 and 8% for UAA, between 3 and 13%
for UAG and between 3 and 15% for UGA (Fig. 4C). A strong positive correlation (r = 0.9) between stop codon readthrough at UAG
codon and random budding was observed with lower positive
correlation for other two stop codons (0.5 and 0.77 for UAA and
UGA, respectively) (Fig. 4C).
Previously we have performed transcriptome analysis to find
global gene expression differences between sup45 mutants and
wild-type cells (Moskalenko et al., unpublished). These data will
be presented elsewhere. Using these data we identified few
genes, participating in budding and downregulated in sup45 mutants. We chose three of them which are known as involved in
bud-site selection by different ways: RSR1 (Chant and Pringle
1995), BUD8 (Zahner, Harkins and Pringle 1996) and BUD32 (Ni
and Snyder 2001; Kato et al. 2011). To check the effect of these
genes overexpression on character of budding in sup45 mutants,
we transformed sup45-102 and sup45-103 mutants with derivatives of pGP564 which contain corresponding segments of the
yeast S. cerevisiae genome (Jones et al. 2008). Presence of multicopy plasmids bearing RSR1 or BUD32 did not significantly
change budding in the sup45 mutants (Fig. S3, Supporting Information). In the meantime, overexpression of BUD8 in diploid
strain bearing sup45-102 mutation decreased proportion of cells
with axial budding in the same way as a wild copy of SUP45.
However, derivatives of D1631 strain bearing sup45-102 mutation transformed by plasmid pGP564/BUD8 still were not able to
form pseudohyphae (see the previous section). No obvious effect
of BUD8 overexpression on PH growth in sup45 mutants may be
due to insufficient restoration of bipolar budding compared to
the wild-type SUP45.
Mutations in SUP35 do not affect PH and invasive
growth
The effect of sup45 mutations on PH growth may be mediated by
the non-specific damage of translation termination. To address
this possibility, we tested the effects of mutations in the SUP35
gene that encodes a functional partner of Sup45p needed for the
efficient translation termination. For this purpose, we used two
sup35 mutations, which decreased an accuracy of translation
termination (Chabelskaya et al. 2004). Previously, one of them,
nonsense mutation sup35-21, was characterized as a strong suppressor (Cosson et al. 2002). Missense mutation sup35-228 is also
an efficient suppressor (Chabelskaya et al. 2004) comparable with
sup35-21 (Fig. S4, Supporting Information).
We used diploid strain D1642 that had chromosomal SUP35
genes deleted. Viability of the strain was supported by plasmids
bearing a wild type or mutant alleles of the SUP35 gene. D1642
derivatives proven to be heterozygous by MAT locus were used
for the analysis of the capacity for PH growth. Both tested mutant alleles did not inhibit filamentous growth (Fig. 5A) and did
not affect the invasive growth of 8a-D1640 (Fig. 5B).
cAMP restores the ability of sup45 mutants to form
pseudohyphae
One of the key components of the signaling cascade that controls the transition to the filamentous form of growth is cAMP
(Rupp et al. 1999). An increase in cAMP levels in response to
environmental changes, including nitrogen starvation, triggers
FLO11 expression, which is essential for PH and invasive growth.
We found that the addition of cAMP to a final concentration of
10 mM in low-ammonium medium partly restored PH growth
of D1631 derivatives bearing sup45 mutant alleles (Fig. 6), suggesting that sup45 mutants are defective in the cAMP-dependent
cascade inducing pseudohyphae formation.
To estimate the level of intracellular cAMP in vivo, we used
iodine staining of the intracellular glycogen (Chester 1968;
Enjalbert et al. 2000). This method is used for detection of the
defects in the Ras-cAMP pathway (Kubler et al. 1997). We did
not find significant difference in staining between sup45 mutants compared to the wild-type strain (Fig. S5, Supporting
Information).
Petrova et al.
7
Figure 3. Influence of different types of sup45 mutations on budding in diploid cells. Budding patterns of diploid strain D1631 (GT81 background) derivatives bearing
different sup45 mutations, grown at 25o C, were determined after calcofluor staining. A total of 200–300 cells were counted for each strain in three independent sets of
experiments. The average percentage of each budding pattern is shown (SD < 2%); axial (black bar), bipolar (white bar) and random (gray bar). (A) Mutations selected
as nonsense suppressors. (B) Mutations affecting Sup45p phosphorylation. (C) Mutations leading to antisuppression.
High levels of cAMP led to a higher rate of random budding pattern in both diploid wild type and sup45-101 mutant
strains with a reduction of bipolar budding (Fig. S6A, Supporting Information). The sup45-102 mutant was characterized by
high percentage of cells forming branched chains when grown in
the presence of cAMP (Fig. S6B, Supporting Information). Thus,
cAMP does not restore the bipolar budding in sup45 mutants.
Inability of sup45 mutants to form pseudohyphae is
connected with a defect in translation but not with
the interaction eRF1–eRF3
The main function of Sup45p is participation in translation termination. To address the question of whether translation termination efficiency is involved in filamentation in yeast, we
checked the PH growth of a wild-type strain D1639 (1278b
background) in a low-ammonia medium supplemented with
translational antibiotic hygromycin B, or cycloheximide, or paromomycin. The ability of yeast to form pseudohyphae was repressed by all three drugs (Fig. 7A) at concentrations that still allowed strains to grow (Fig. 7B). Thus, filamentous growth of yeast
can be abolished not just by a general inhibition of translation
caused by cycloheximide but also by drugs affecting translation
accuracy such as paromomycin or hygromycin B.
In order to check whether the influence of eRF1 on PH formation depends on its interaction with eRF3, we used a C-terminal
deleted variant of eRF1 (eRF1-C19). It was shown previously
that deletion of the last 19 amino acids importantly decreases
the interaction of eRF1 with eRF3 and leads to an enhancement
of nonsense suppression (Eurwilaichitr et al. 1999; Kallmeyer,
Keeling and Bedwell 2006). We compared the PH growth of
diploid strains D1643 and D1631 containing full-length Sup45p
with derivatives of the same strains but bearing the pDB843 plasmid encoding truncated version of Sup45p, and found that deletion of the C-terminal part of eRF1 did not lead to impairment of
PH growth; moreover, strains bearing eRF1-C19 actually had an
enhanced hyphae formation (Fig. 7C). Thus, impaired filamentous growth is specific to sup45 mutants and could not be explained by defects in translation termination.
DISCUSSION
The main function of Sup45 and Sup35 proteins is to participate in termination of protein synthesis. Numerous phenotypes
of sup45 and sup35 mutations imply that multiple intracellular
8
FEMS Yeast Research, 2015, Vol. 15, No. 4
Figure 4. Suppressor mutations in SUP45 change bud-site selection in haploid strains. Budding patterns of derivatives of haploid strains 1a-D1628 (A), 9a-D1641 (B)
bearing sup45 suppressor mutations, grown at the 25◦ C, were determined after calcofluor staining. A total of 200–300 cells were counted for each strain in three
independent sets of experiments. The average percentage of each budding pattern is shown (SD < 2%); axial (black bar), bipolar (white bar) and random (gray bar).
(C) Stop codon readthrough of haploid strains showed on panel A. Results are the means of at least three separate experiments. Pearson product moment correlation
coefficients for readthrough efficiency and type of budding are given, a—axial, b—bipolar, r—random. Statistically significant relationships are shown by one or two
asterisks (P < 0.05 and P < 0.01, respectively).
Figure 5. Mutations in SUP35 do not affect PH and invasive growth. (A) Derivatives of diploid strain D1642 (1278b background) bearing sup35 mutations were induced
to undergo PH growth in a nitrogen-limiting SLAD medium; colony morphology was estimated after 5 days at 30◦ C. (B) Haploid strain 8a-D1640 (1278b background)
bearing pRSU1/SUP35 (WT) or pRSU1/sup35 plasmids was patched on a YPD plate and incubated for 5 days at 30◦ C. The plate was photographed before (total growth)
and after (invasive growth) washing the cells off the agar surface. Three independent transformants were tested in each case.
systems are modified by low efficiency in the translation termination or that these proteins participate in processes other than
translation termination. In this study, we show that filamentous
growth of both haploid and diploid yeast strains is diminished by
mutations in the SUP45 gene, and it was restored, at least partly,
by the high external concentration of cAMP.
Mutations in the SUP45 gene, used in this study, were selected as spontaneous reversions to prototrophy for histidine
and lysine in the strains carrying the UAA nonsense mutations
in the HIS7 and LYS9 genes (Moskalenko et al. 2003). All mutants, except for the missense mutant sup45-113, are omnipotent nonsense suppressors. Additionally, all nonsense but not
Petrova et al.
9
Figure 6. cAMP restores the ability of sup45 mutants to form pseudohyphae. Derivatives of diploid strain D1631 (PGC background) bearing indicated sup45 mutations
were incubated on SLAD media containing 0, 1 or 10 mM cAMP for 5 days at 30◦ C.
Figure 7. Translation-inhibiting antibiotics (but not Sup45p-delta C) influence PH growth. (A) Diploid strain D1639 (1278b background) was induced to undergo PH
growth in a nitrogen-limiting SLAD medium with the addition of hygromycin B (HY), cycloheximide (CH) or paromomycin (Par); colony morphology was estimated after
5 days. (B) A total of 10 serial dilutions of the same strain as in panel A at equal cell density were spotted onto SC medium with or without corresponding antibiotics. (C)
Deletion of Sup35-interacting region in Sup45p (C19) does not disturb PH growth. Diploid strains D1643 (1278b background) and D1631 (GT81 background) contain
plasmid encoding WT Sup45p or C-terminally truncated Sup45p.
missense mutants are characterized by a decreased amount of
full-length eRF1 ranging from 8 to 32% compared to the amount
of eRF1 in the wild-type strain (Moskalenko et al. 2003). Previous
studies revealed a correlation between a low amount of eRF1
and increased nonsense suppression (Valouev, Kushnirov and
Ter-Avanesyan 2002; Moskalenko et al. 2003). Missense muta-
tions in the SUP45 gene do not influence the amount of eRF1 and
do not break its interaction with eRF3; therefore, nonsense suppression is likely to be caused by changes in the spatial structure
of eRF1 (Moskalenko et al. 2004).
Mutations in the SUP45 gene lead to a multitude of pleiotropic
effects (Inge-Vechtomov, Zhouravleva and Philippe 2003). It was
10
FEMS Yeast Research, 2015, Vol. 15, No. 4
shown that at least some of the eRF1-specific phenotypes such
as cell length, cell diameter and caffeine sensitivity are unlinked
to translation termination and may be caused by defects in nontranslational functions of eRF1 (Merritt et al. 2010). In this work,
we used several approaches to clarify the role of eRF1 in the
regulation of PH differentiation. Despite the fact that the filamentous growth in yeast is controlled by several regulatory cascades that overlap only partially and activate various transcription factors, inactivation of solely the FLO8 gene is sufficient
to disrupt the ability of the strain to form hyphae (Liu, Styles
and Fink 1996). Many laboratory yeast strains, including strain
S288C, contain a nonsense mutation in the FLO8 gene, which
leads to the formation of non-functional protein. Strains with a
1278b background, commonly used for the study of filamentous growth, do not contain this mutation (Liu, Styles and Fink
1996). Strain D1631, used in our work to study the PH differentiation, had a different genotypic background than the derivatives of the S288C or 1278b strains. The FLO8 gene sequencing
confirmed the absence of mutation and allowed the Flo8 protein dysfunction to be excluded as a cause of the absence of filamentous growth in D1631 strain derivatives (Zhouravleva and
Petrova 2010).
Also a lack of PH growth of sup45 mutants could not be explained by repression of FLO11 because level of its mRNA measured by qPCR is not decreased in mutants and overexpression
of FLO11 does not restore PH growth.
The analysis of the budding pattern of strains carrying different sup45 mutant alleles showed that both nonsense and missense mutations used in this experiment led to a change in the
proportion of cells manifesting different budding types in both
diploid and haploid strains. Suppression efficiencies of UAG and
UGA codons in sup45-n and sup45-m mutants correlate with an
increase in random budding: the Pearson correlation coefficients
are 0.90 and 0.77, respectively, both above the 95% confidence
level (0.71). Derivatives of the diploid strain D1631 bearing sup45
mutant alleles and retaining heterozygosity at the MAT locus
had an increased proportion of cells with a random budding
pattern that, as was shown earlier, impedes PH growth (Gimeno
et al. 1992).
Nonsense and missense mutations in the SUP45 gene have a
strong effect on the accuracy of translation termination and cell
viability in general (Inge-Vechtomov, Zhouravleva and Philippe
2003). If the absence of filamentous growth is a direct consequence of the translation defects, the sup45 mutations that do
not disturb the eRF1 function in translation termination should
not affect the ability of mutant strains for filamentous growth.
We showed that mutations that cause a loss of eRF1 phosphorylation (Kallmeyer, Keeling and Bedwell 2006) do not affect the
ability of strains to form pseudohyphae and did not promote
random budding. However, some mutations that increase the
accuracy of translation termination (Hatin et al. 2009) impaired
PH differentiation. Thus, the filamentous growth defect caused
by mutations in the SUP45 gene may be explained by alternate
non-translational functions of eRF1.
Translation termination factor eRF3 is a partner of eRF1 in
translation termination. The SUP35 gene, as well as the SUP45
gene, is essential, and mutations in these genes have the same
or a very similar manifestation. Pleiotropic effects of sup45
and sup35 mutations are similar in the most of the described
cases. The resemblance of sup35 and sup45 phenotypes is in
good agreement with the fact that translation termination factors eRF1 and eRF3, the products of these two genes, interact in translational termination and possibly participate in several other cellular processes (Inge-Vechtomov, Zhouravleva and
Philippe 2003). If the defects in filamentous growth in the sup45
mutants are caused by decreased efficiency in translation termination, it is logical to assume that an impairment of the eRF3
function will cause a similar effect. However, in this study we
did not detect a defect in filamentous growth in the presence
of sup35 mutant alleles selected as strong omnipotent suppressors. Moreover, deletion of the eRF3 interacting domain of eRF1
does not affect PH differentiation. Thus, the altered efficiency
of translation termination is not the reason for defects in filamentous growth in sup45 mutants and suggests a specific role of
eRF1 in its regulation. Influence of several other eRF1-interacting
proteins on invasive and PH growth was tested previously. Deletions of non-essential genes NAM7 (UPF1) or ITT1 had no effect
on either phenotypes (Ryan et al. 2012), while overexpression of
essential DBP5 increased filamentous growth (Jin et al. 2008).
A variety of evidence indicates a role of efficient protein
synthesis in the control of PH differentiation in yeast. In the
early studies of the developmental switch from vegetative to
PH growth, the inhibitory effect of cycloheximide on PH growth
was noted (Kron, Styles and Fink 1994). It was shown that
sublethal concentrations of the translation inhibitor cycloheximide inhibit PH growth (Cutler et al. 2001) and adhesion of
yeast cells (Ross, Saxena and Altmann 2012). Our data show
that translation inhibition by hygromycin B, cyclohexymide and
paromomycin blocks the conversion of wild-type diploid yeast
cells to PH growth. However, inability of sup45 mutants to form
pseudohyphae cannot be explained by decreased rate of overall protein synthesis because this model is not supported by the
observation that in the presence of exogenic cAMP sup45 mutants restore the ability to form pseudohyphae. Previously, it was
shown that overall protein synthesis is not impaired in different
sup45 mutants in permissive conditions (Surguchov et al. 1980;
Stansfield et al. 1997).
Several genes implicated in translation are also able to influence PH growth. It was shown that proper regulation of translation initiation by the eIF4E binding proteins is required for the
PH response (Ibrahimo, Holmes and Ashe 2006). Mutation in the
SUP70 gene (sup70-65) which encodes the tRNACUG (Gln) induces
PH growth even on a rich medium (Murray et al. 1998; Beeser and
Cooper 1999). Recently, it was proposed that the sup70-65 mutation alters the efficiency of translation of the mRNA encoding
a negative regulator of PH growth. The authors speculated that
gene encoding such a regulator contains CAG codons towards
the 5 end of its open reading frame which will be efficiently read
by CAG-decoding tRNA (Kemp et al. 2013).
Interestingly, the deletion of DOM34 gene leads to defects in
PH growth and budding in diploid cells (Davis and Engebrecht
1998). Dom34p of S. cerevisiae consists of three domains, two of
which (M and C) are homologous to the corresponding domains
in eRF1, while the N-terminal domain of Dom34p is different
from that of eRF1 and is probably necessary for the recognition
of the mRNA stem (Graille, Chaillet and van Tilbeurgh 2008). We
have shown that deletion of C-terminal 19 aa of eRF1 has no
effect on PH growth; however, similar effects of DOM34 deletion and SUP45 mutations on PH growth prompted us to propose
the existence of a common mechanism/or factor including both
Dom34p or eRF1.
The level of cAMP is a signal in the cascades that regulate
the cell cycle, sporulation, cell growth and stress response (see
Santangelo 2006). Increased cAMP induces PH and invasive
growth in response to a change in the amount of nutrients in
the environment (Rupp et al. 1999). Impaired signal transduction due to improper function of one or more cascade components may lead to the loss of sensitivity for the changes in cAMP
Petrova et al.
levels and, in turn, to the absence of PH growth. We showed
that strains bearing sup45 mutant alleles form pseudohyphae on
the medium supplemented with 10 mM of cAMP. Partial restoration of PH growth by addition of exogenous cAMP assumes that
sup45 mutants are defective in the cAMP-dependent pathway
that control filament formation. However, we found no differences between mutant and wild-type cells in the amount of
intracellular cAMP. Thus, the effect of sup45 mutations on PH
development could not be due to the decreased level of intracellular cAMP, but defects in other components of Ras/cAMP pathway cannot be excluded. Further studies will be required to find
the molecular mechanism of this effect.
Nonetheless, our data imply a possibility to affect a PH
growth of fungi through decreased efficiency of translation termination that can be achieved by some antibiotics, such as hygromycin B and paromomycin. These drugs inhibit cell growth
through an arrest of protein biosynthesis as a result of the drugs
binding to translating ribosomes. The biggest difficulty in treating fungal infections is that fungi are eukaryotic organisms that
respond to the same antibiotic that affects human cells. Our results prove that the filamentation of fungi can be prevented by
some known translational antibiotics in concentrations that do
not have a lethal effect on cells, and that can be used as a therapeutic approach.
SUPPLEMENTARY DATA
Supplementary data are available at FEMSYR online.
ACKNOWLEDGEMENTS
We are very grateful to M. Philippe for his constructive suggestions in the beginning of this work and to H.-U. Mosch for
the strains, plasmids and helpful discussions. We thank also W.
Wang, I. Hatin and D. Bedwell for plasmids, and Polina Drozdova
for help.
FUNDING
The authors acknowledge Saint Petersburg State University
for following research grants: (0.37.696.2013, 15.61.2218.2013,
1.37.291.2015). This work was also supported by RFBR (1304-00645), as well as DAAD and FEMS fellowship programs
for A.P. This work was supported by research resource center ‘Molecular and cell technologies’ of Saint Petersburg State
University.
Conflict of interest. None declared.
REFERENCES
Bailleul PA, Newnam GP, Steenbergen JN, et al. Genetic study of
interactions between the cytoskeletal assembly protein Sla1
and prion-forming domain of the release factor Sup35 (eRF3)
in Saccharomyces cerevisiae. Genetics 1999;153:81–94.
Beeser AE, Cooper TG. Control of nitrogen catabolite repression
is not affected by the tRNAGln-CUU mutation, which results
in constitutive pseudohyphal growth of Saccharomyces cerevisiae. J Bacteriol 1999;181:2472–6.
Boeke JD, LaCroute F, Fink GR. A positive selection for mutants lacking orotidine-5 -phosphate decarboxylase activ-
11
ity in yeast: 5-fluoro-orotic acid resistance. Mol Gen Genet
1984;197:345–6.
Bolger TA, Folkmann AW, Tran EJ, et al. The mRNA export factor
Gle1 and inositol hexakisphosphate regulate distinct stages
of translation. Cell 2008;134:624–33.
Borchsenius AS, Tchourikova AA, Inge-Vechtomov SG. Recessive
mutations in SUP35 and SUP45 genes coding for translation
release factors affect chromosome stability in Saccharomyces
cerevisiae. Curr Genet 2000;37:285–91.
Cali BM, Doyle TC, Botstein D, et al. Multiple functions for actin
during filamentous growth of Saccharomyces cerevisiae. Mol
Biol Cell 1998;9:1873–89.
Chabelskaya S, Kiktev D, Inge-Vechtomov S, et al. Nonsense mutations in the essential gene SUP35 of Saccharomyces cerevisiae
are non-lethal. Mol Genet Genomics 2004;272:297–307.
Chant J, Pringle JR. Patterns of bud-site selection in the yeast Saccharomyces cerevisiae. J Cell Biol 1995;129:751–65.
Chauvin C, Salhi S, Jean-Jean O. Human eukaryotic release factor 3a depletion causes cell cycle arrest at G1 phase through
inhibition of the mTOR pathway. Mol Cell Biol 2007;27:
5619–29.
Chernoff YO, Galkin AP, Lewitin E, et al. Evolutionary conservation of prion-forming abilities of the yeast Sup35 protein. Mol
Microbiol 2000;35:865–76.
Chester VE. Heritable glycogen-storage deficiency in yeast and
its induction by ultra-violet light. J Gen Microbiol 1968;51:
49–56.
Cosson B, Couturier A, Chabelskaya S, et al. Poly(A)-binding protein acts in translation termination via eukaryotic release
factor 3 interaction and does not influence [PSI+ ] propagation. Mol Cell Biol 2002;22:3301–15.
Cutler NS, Pan X, Heitman J, et al. The TOR signal transduction
cascade controls cellular differentiation in response to nutrients. Mol Biol Cell 2001;12:4103–13.
Czaplinski K, Ruiz-Echevarria MJ, Paushkin SV, et al. The surveillance complex interacts with the translation release factors
to enhance termination and degrade aberrant mRNAs. Gene
Dev 1998;12:1665–77.
Davis L, Engebrecht J. Yeast dom34 mutants are defective in multiple developmental pathways and exhibit decreased levels
of polyribosomes. Genetics 1998;149:45–56.
Enjalbert B, Parrou JL, Vincent O, et al. Mitochondrial respiratory
mutants of Saccharomyces cerevisiae accumulate glycogen
and readily mobilize it in a glucose-depleted medium. Microbiology 2000;146:2685–94.
Eurwilaichitr L, Graves FM, Stansfield I, et al. The C-terminus
of eRF1 defines a functionally important domain for translation termination in Saccharomyces cerevisiae. Mol Microbiol
1999;32:485–96.
Frolova L, Le Goff X, Rasmussen HH, et al. A highly conserved eukaryotic protein family possessing properties of polypeptide
chain release factor. Nature 1994;372:701–3.
Frolova L, Le Goff X, Zhouravleva G, et al. Eukaryotic polypeptide chain release factor eRF3 is an eRF1- and ribosomedependent guanosine triphosphatase. RNA 1996;2:334–41.
Gagiano M, Bauer FF, Pretorius IS. The sensing of nutritional
status and the relationship to filamentous growth in Saccharomyces cerevisiae. FEMS Yeast Res 2002;2:433–70.
Gietz RD, Schiestl RH, Willems AR, et al. Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 1995;11:355–60.
Gimeno CJ, Ljungdahl PO, Styles CA, et al. Unipolar cell divisions
in the yeast S. cerevisiae lead to filamentous growth: regulation by starvation and RAS. Cell 1992;68:1077–90.
12
FEMS Yeast Research, 2015, Vol. 15, No. 4
Graille M, Chaillet M, van Tilbeurgh H. Structure of yeast Dom34:
a protein related to translation termination factor eRF1 and
involved in No-Go decay. J Biol Chem 2008;283:7145–54
Gross T, Siepmann A, Sturm D, et al. The DEAD-box RNA helicase Dbp5 functions in translation termination. Science
2007;315:646–9.
Guo B, Styles CA, Feng Q, et al. A Saccharomyces gene family involved in invasive growth, cell-cell adhesion, and mating.
P Natl Acad Sci USA 2000;97:12158–63.
Hatin I, Fabret C, Rousset JP, et al. Molecular dissection of translation termination mechanism identifies two new critical regions in eRF1. Nucleic Acids Res 2009;37:1789–98.
Himmelfarb HJ, Maicas E, Friesen JD. Isolation of the SUP45
omnipotent suppressor gene of Saccharomyces cerevisiae and
characterization of its gene product. Mol Cell Biol 1985;5:
816–22.
Hoshino S, Imai M, Kobayashi T, et al. The eukaryotic polypeptide
chain releasing factor (eRF3/GSPT) carrying the translation
termination signal to the 3 -Poly(A) tail of mRNA. Direct association of erf3/GSPT with polyadenylate-binding protein. J
Biol Chem 1999;274:16677–80.
Ibrahimo S, Holmes LE, Ashe MP. Regulation of translation initiation by the yeast eIF4E binding proteins is required for the
pseudohyphal response. Yeast 2006;23:1075–88.
Inge-Vechtomov S, Zhouravleva G, Philippe M. Eukaryotic release factors (eRFs) history. Biol Cell 2003;95:195–209.
Inoue H, Nojima H, Okayama H. High efficiency transformation
of Escherichia coli with plasmids. Gene 1990;96:23–8.
Jin R, Dobry CJ, McCown PJ, et al. Large-scale analysis of yeast
filamentous growth by systematic gene disruption and overexpression. Mol Biol Cell 2008;19:284–96.
Jones GM, Stalker J, Humphray S, et al. A systematic library
for comprehensive overexpression screens in Saccharomyces
cerevisiae. Nat Methods 2008;5:239–41.
Kallmeyer AK, Keeling KM, Bedwell DM. Eukaryotic release factor 1 phosphorylation by CK2 protein kinase is dynamic but
has little effect on the efficiency of translation termination
in Saccharomyces cerevisiae. Eukaryot Cell 2006;5:1378–87.
Kato Y, Kawasaki H, Ohyama Y, et al. Cell polarity in Saccharomyces cerevisiae depends on proper localization of the
Bud9 landmark protein by the EKC/KEOPS complex. Genetics
2011;188:871–82.
Kemp AJ, Betney R, Ciandrini L, et al. A yeast tRNA mutant that
causes pseudohyphal growth exhibits reduced rates of CAG
codon translation. Mol Microbiol 2013;87:284–300.
Kiktev D, Moskalenko S, Murina O, et al. The paradox of viable sup45 STOP mutations: a necessary equilibrium between
translational readthrough, activity and stability of the protein. Mol Genet Genomics 2009;282:83–96.
Kohler JR, Fink GR. Candida albicans strains heterozygous and homozygous for mutations in mitogen-activated protein kinase
signaling components have defects in hyphal development.
P Natl Acad Sci USA 1996;93:13223–8.
Kron SJ, Styles CA, Fink GR. Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae. Mol Biol Cell
1994;5:1003–22.
Kubler E, Mosch HU, Rupp S, et al. Gpa2p, a G-protein alphasubunit, regulates growth and pseudohyphal development
in Saccharomyces cerevisiae via a cAMP-dependent mechanism. J Biol Chem 1997;272:20321–3.
Leberer E, Harcus D, Broadbent ID, et al. Signal transduction
through homologs of the Ste20p and Ste7p protein kinases
can trigger hyphal formation in the pathogenic fungus Candida albicans. P Natl Acad Sci USA 1996;93:13217–22.
Le Goff C, Zemlyanko O, Moskalenko S, et al. Mouse GSPT2, but
not GSPT1, can substitute for yeast eRF3 in vivo. Genes Cells
2002;7:1043–57.
Liu H, Kohler J, Fink GR. Suppression of hyphal formation in
Candida albicans by mutation of a STE12 homolog. Science
1994;266:1723–6.
Liu H, Styles CA, Fink GR. Elements of the yeast pheromone response pathway required for filamentous growth of diploids.
Science 1993;262:1741–4.
Liu H, Styles CA, Fink GR. Saccharomyces cerevisiae S288C has a
mutation in FLO8, a gene required for filamentous growth.
Genetics 1996;144:967–78.
Livak KJ, Schmittgen TD. Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta
C(T)) Method. Methods 2001;25:402–8.
Longtine MS, McKenzie A, III, Demarini DJ, et al. Additional
modules for versatile and economical PCR-based gene
deletion and modification in Saccharomyces cerevisiae. Yeast
1998;14:953–61.
Merritt GH, Naemi WR, Mugnier P, et al. Decoding accuracy in
eRF1 mutants and its correlation with pleiotropic quantitative traits in yeast. Nucleic Acids Res 2010;38:5479–92.
Moskalenko SE, Chabelskaya SV, Inge-Vechtomov SG, et al. Viable nonsense mutants for the essential gene SUP45 of Saccharomyces cerevisiae. BMC Mol Biol 2003;4:2.
Moskalenko SE, Zhuravleva GA, Soom MI, et al. Characterization of missense mutations in the SUP45 gene of Saccharomyces cerevisiae encoding translation termination factor
eRF1. Genetika 2004;40:599–606.
Murray LE, Rowley N, Dawes IW, et al. A yeast glutamine tRNA
signals nitrogen status for regulation of dimorphic growth
and sporulation. P Natl Acad Sci USA 1998;95:8619–24.
Ni L, Snyder M. A genomic study of the bipolar bud site selection pattern in Saccharomyces cerevisiae. Mol Biol Cell 2001;12:
2147–70.
Petsch KA, Mylne J, Botella JR. Cosuppression of eukaryotic release factor 1–1 in Arabidopsis affects cell elongation and radial cell division. Plant Physiol 2005;139:115–26.
Roberts RL, Fink GR. Elements of a single MAP kinase cascade
in Saccharomyces cerevisiae mediate two developmental programs in the same cell type: mating and invasive growth.
Gene Dev 1994;8:2974–85.
Ross D, Saxena M, Altmann M. eIF4E is an important determinant of adhesion and pseudohyphal growth of the yeast S.
cerevisiae. PLoS One 2012;7:e50773.
Rupp S, Summers E, Lo HJ, et al. MAP kinase and cAMP filamentation signaling pathways converge on the unusually
large promoter of the yeast FLO11 gene. EMBO J 1999;18:
1257–69.
Ryan O, Shapiro RS, Kurat CF, et al. Global gene deletion analysis exploring yeast filamentous growth. Science 2012;337:
1353–6.
Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning a Laboratory
Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
Santangelo GM. Glucose signaling in Saccharomyces cerevisiae. Microbiol Mol Biol R 2006;70:253–82.
Sherman F, Fink GR, Hicks JB. Laboratory Course Manual for Methods in Yeast Genetics. New York: Cold Spring Harbor Laboratory, 1986.
Stansfield I, Akhmaloka, Tuite MF. A mutant allele of the SUP45
(SAL4) gene of Saccharomyces cerevisiae shows temperaturedependent allosuppressor and omnipotent suppressor phenotypes. Curr Genet 1995;27:417–26.
Petrova et al.
Stansfield I, Kushnirov VV, Jones KM, et al. A conditional-lethal
translation termination defect in a sup45 mutant of the yeast
Saccharomyces cerevisiae. Eur J Biochem 1997;245:557–63.
Surguchov AP, Beretetskaya YV, Fominykch ES, et al. Recessive
suppression in yeast Saccharomyces cerevisiae is mediated by
a ribosomal mutation. FEBS Lett 1980;111:175–8.
Uchida N, Hoshino S, Imataka H, et al. A novel role of the
mammalian GSPT/eRF3 associating with poly(A)-binding
protein in Cap/Poly(A)-dependent translation. J Biol Chem
2002;277:50286–92.
Valouev IA, Kushnirov VV, Ter-Avanesyan MD. Yeast polypeptide chain release factors eRF1 and eRF3 are involved in cytoskeleton organization and cell cycle regulation. Cell Motil
Cytoskel 2002;52:161–73.
Valouev IA, Urakov VN, Kochneva-Pervukhova NV, et al. Translation termination factors function outside of translation:
yeast eRF1 interacts with myosin light chain, Mlc1p, to effect
cytokinesis. Mol Microbiol 2004;53:687–96.
Wang W, Czaplinski K, Rao Y, et al. The role of Upf proteins
in modulating the translation read-through of nonsensecontaining transcripts. EMBO J 2001;20:880–90.
13
Whiteway M, Dignard D, Thomas DY. Dominant negative selection of heterologous genes: isolation of Candida albicans genes that interfere with Saccharomyces cerevisiae mating factor-induced cell cycle arrest. P Natl Acad Sci USA
1992;89:9410–4.
Wilson PG, Culbertson MR. SUF12 suppressor protein of yeast. A
fusion protein related to the EF-1 family of elongation factors. J Mol Biol 1988;199:559–73.
Zahner JE, Harkins HA, Pringle JR. Genetic analysis of the bipolar pattern of bud site selection in the yeast Saccharomyces
cerevisiae. Mol Cell Biol 1996;16:1857–70.
Zhouravleva G, Frolova L, Le G, et al. Termination of translation in
eukaryotes is governed by two interacting polypeptide chain
release factors, eRF1 and eRF3. EMBO J 1995;14:4065–72.
Zhouravleva GA, Moskalenko SE, Shabel’skaia SV, et al. Increased
tRNA concentration in yeast containing mutant termination
translation factors eRF1 and eRF3. Mol Biol 2006;40:724–30.
Zhouravleva GA, Petrova AV. The role of translation termination factor eRF1 in the regulation of pseudohyphal growth in
Saccharomyces cerevisiae cells. Dokl Biochem Biophys 2010;433:
209–11.