Molecular Plant Breeding 2012, Vol.3, No.5, 50-56
http://mpb.sophiapublisher.com
Research Report
Open Access
Optimization of Minimal Inhibitory Dose of Selective Agent (Basta) for
Selection of Transgenics in Sugarcane
Siddra Ijaz , Naweed Anjum , Iqrar Ahmad Rana , Iqrar Ahmad Khan
Centre of Agricultural Biochemistry and Biotechnology (CABB), University of Agriculture Faisalabad, Pakistan
Corresponding authors email: siddraijazkhan @ yahoo.com;
Authors
Molecular Plant Breeding, 2012, Vol.3, No.5 doi: 10.5376/mpb.2012.03.0005
Received: 13 Mar., 2012
Accepted: 16 Apr., 2012
Published: 30 Apr., 2012
This is an open access article published under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction
in any medium, provided the original work is properly cited.
Preferred citation for this article:
Ijaz et al., 2012, Optimization of Minimal Inhibitory Dose of Selective Agent (Basta) for Selection of Transgenics in Sugarcane, Molecular Plant Breeding,
Vol.3, No.5 50-56 (doi: 10.5376/mpb.2012.03.0005)
Abstract Success rate in the selection of putative transformants is mainly dependent upon the dose rate of selective agent. Selection
pressure determines the survival frequency of transformant and non transformant cells. Dose of selective agent, which is lethal for the
non transformants, would be the optimum for the transgenic selection. We investigated the optimum dose of basta (selective agent),
in two sugarcane genotypes viz., S-2003-us-359 and S-2003-us-127, in which we have already established a proficient in vitro
regeneration system (Ijaz et al., 2012; Anjum et al., 2012). Different dosages of basta viz., 1 mg/L, 3 mg/L, 5 mg/L, 7 mg/L and 10
mg/L were studied for regeneration media (RM) of both genotypes. For determining the optimal inhibitory dose of basta on
regeneration, 21 days old calli of S-2003-us-359 were induced on CIM1, 28 days old calli of S-2003-us-127 were induced on CIM2
and were shifted to RSM1 and RSM2 respectively. In genotype S-2003-us-359, early callus death was observed on RSM having 10
mg/L basta, and RSM having 5 mg/L, 7 mg/L, 10 mg/L basta proved to be lethal for S-2003-us-127 with early death of calli. For
genotype S-2003-us-127, among 5 mg/L, 7 mg/L and 10 mg/L basta levels, 5 mg/L basta was selected for regeneration media as
optimal dose for the selection of transgenics of this genotype. For transgenic selection in both sugarcane genotypes, the affectivity of
selected optimal doses of basta was checked. Twenty one (21) days old calli of S-2003-us-359 and 28 days old calli of S-2003-us-127
were bombarded with bar gene and plant were selected at 10 mg/L and 5 mg/L of basta respectively. Putative transgenic plants with
integrated copy of bar gene were confirmed with PCR analysis.
Keywords Basta; Bar gene; Sugarcane; Transgenics
1
are approximately 50 selectable marker genes being
used or being developed in transgenic plant research
(Miki and McHugh, 2004). In genetic transformation
study the bar gene has been widely used as an effective
selectable marker in many crop species (Gordon-Kamm
et al., 1990; Akama et al., 1995). Bar gene was isolated
from Streptomyces hygroscopicus (Block et al., 1987)
and confers resistance to phosphinothricin, the active
ingredient for the herbicides bialaphos, Liberty and
Basta, an analogue of glutamate, a competitive
inhibitor of the enzyme glutamine synthetase.
Phosphinothricin acetyltransferase, coded by bar gene
inactivates phosphinothricin by acetylation.
Background
Transformation of crop genomes is used for many
purposes such as increased nutritive value, plant
disease resistance, insect resistance, herbicide
resistance, and for high yield. The success of the
genetic transformation process is monitored through
the following 3 steps: the proof for DNA integration,
protein expression and transmission of the transgene
into its progenies. Practically, during genetic
transformation, foreign gene is transferred into target
tissues, which contains thousands of cells, and only a
few cells will become transgenic or will have the
transgene stably integrated into its genome. It is very
important to isolate these transformed cells from the
majority of untransformed cells by using a selection
agent. The transform cells should carry a selectable
marker gene, which will make the cell survive on a
particular selection agent. It was reported that there
The concentration of selection agents need to be
carefully chosen to avoid either being too low and
thereby allowing undesirable numbers of ‘escapes’
to develop, or too high so that transformants expressing
50
Molecular Plant Breeding 2012, Vol.3, No.5, 50-56
http://mpb.sophiapublisher.com
one (21) days old calli were transferred to a regime of
Regeneration Selection Media (RSM) containing 1, 3,
5,7,10 mg/L basta (Table 2) respectively to select the
optimal dose of basta, which was then used for the
selection of transgenic plants from bombarded tissues.
Calli on 10 mg/L basta showed death signs early. On
second day of shifting, approximately 15% embryos
died on this dose rate, and calli on 1 mg/L, 3 mg/L,
5 mg/L, 7 mg/L basta were unaffected. On the third
day of shifting, approximately 55% embryos died
on 10 mg/L and 10% embryos were died on 7 mg/L
basta, but other calli were still unaffected. On 4th day,
approximately 40%, 20%, and 10% death was observed
on 5 mg/L, 3 mg/L, 1 mg/L basta respectively. More
than 70 % death was observed on 10 mg/L basta and
50% embryos died on media having 7 mg/L basta. Fifth
day, all calli died on me1dia containing 10 mg/L basta
(Figure 2). But approximately 45%, 50%, 70% and
90% calli survived on 7 mg/L, 5 mg/L, 3 mg/L basta
respectively (Figure 1; Figure 2).
moderated levels of resistance are lost. Therefore
optimization of selective agent is very crucial for
selection of transgenic. Therefore, economical optimal
concentration of the selective agent is the most preferred
in the selection of stable transformed cells.
Selectable marker gene presence in transformed cells is
necessary for the survival of the transformed cells on the
selective agent. Until now almost 50 selectable marker
genes are used in transgenic development research (Miki
and Mchugh, 2004). Selective agent selection varies
from crop to crop. Hygromycin as selective agent did not
prove beneficial on the turf grass mature embryo
development (Cao et al., 2006) while in case of apricot,
kanamycin was proved to be excellent selective agent
because it also improved the proliferation rate of the
transformed tissues (Petri et al., 2005).
Basta is an efficient selective agent for monocot like
sugarcane (Chowdhury and Vasil, 1992), rice
(Christou et al., 1991), wheat (Vasil et al., 1992) and
maize (Fromm et al., 1990). Therefore for our study
basta was selected as selective agent for the selection
of transgenics in sugarcane. So, Basta dose was
optimized for sugarcane genotypes which were selected
for genetic transformation study.
calli death, in case of 7 mg/L, 5 mg/L, 3
1 Complete
mg/L basta was observed on 9 , 11 and 14 day
th
th
th
respectively. Up to 90% calli were survived on 1 mg/L
basta even on 14th day. Though death started earlier on
10 mg/L basta but it was not so sudden and it seemed,
on this basta dose if the calli are transgenic for bar
they will survive and if not then die in 5 days.
1 Results
The concentration of selection agent in the tissue
culture media is very important. Less amount of
selective agent may give rise to many false positives.
Therefore an optimal amount of selective agent in the
media is too necessary. Selection pressure determines
the survival frequency of transformants and non
transformed cells. Optimization of basta dose for
genotypes viz., S-2003-us-359 and S-2003-us-127,
five different concentrations of Basta (1 mg/L, 3 mg/L,
5 mg/L, 7 mg/L, 10 mgl-) were studied for transgenic
selection on regeneration media. Basta concentrations
for both genotypes were found which becomes lethal
for non transformed cells. It was assumed that this
concentration will not be lethal for transformed cells.
Figure 1 Optimization of basta dose for selection of transgenic
1.1 Selection of optimal basta dose for genotype
S-2003-us-359 to be used in regeneration selection
media for transformation experiment
For the selection of optimal basta dose for regeneration
media, calli were induced on CIM1 (Table 1). Twenty
regenerants in genotype S-2003-us-359;
Note: 10 mg/L basta showed early death and after 5 days on
selection all calli were died. At 1 mg/L basta only 10%
embryos died even after 15 days, and survival rate was 90%
51
Molecular Plant Breeding 2012, Vol.3, No.5, 50-56
http://mpb.sophiapublisher.com
Figure 2 Calli response on regeneration selection medium (RSM) at various levels of basta
Note: A: 1 mg/L; B: 3 mg/L; C: 5mg/L; D: 7mg/L; E: 10 mg/L
1.2 Selection of optimal basta dose for genotype
S-2003-us-127 to be used in regeneration selection
media for transformation experiment
Calli of genotype S-2003-us-127 were induced on
CIM2 (Table 1) and 28 days old healthy and
proliferated calli were transferred on regeneration
selection media (RSM) in which five levels of basta
(1 mg/L, 3 mg/L, 5 mg/L, 7 mg/L, 10 mg/L) were
used (Table 2) followed by incubation at (26±1)℃
under 16/8 hrs light dark period. Proliferated calli
were survived (100%) for one day only on all basta
level. After one day of shifting on basta selection
pressure, basta showed effect. It was observed that at
1 mg/L and 3 mg/L calli survived (80%) while at 5 mg/L,
7 mg/L and 10 mg/L calli survival response was 50%,
40% and 30% respectively. On fifth day, survival
frequency of embryo was 5% and 3% on 5 mg/L, 7 mg/L,
and 10 mg/L basta level respectively. While complete
death of embryo was observed at 5 mg/L, 7 mg/L, and
10 mg/L basta level on 7th day (Figure 3 and Figure 4).
1
Figure 3 Optimization of basta dose for selection of transgenic
regenerants in genotype S-2003-us-127
Figure 4 Calli response on regeneration selection medium (RSM) at various levels of basta
Note: A: 1 mg/L; B: 3 mg/L; C: 5mg/L; D: 7mg/L; E: 10 mg/L
But 50% and 45 % embryo were survived at 1 mg/L and 3
mg/L basta respectively. On 1 mg/L basta regeneration
was starting after 12 days (Figure 5).
After the selection of basta doses for genotype
S-2003-us-359 and S-2003-us-127, affectivity or
efficiency of these optimal doses was determined by
integrating the bar gene in to these genotypes using
Figure 5 Regeneration on RSM having 1 mg/L basta
52
Molecular Plant Breeding 2012, Vol.3, No.5, 50-56
http://mpb.sophiapublisher.com
pressure were extracted. PCR was performed by using
gene specific primers. bar gene sequence was absent
in wild type (non transformed plant) but presence of
bar gene sequence was observed in putative transgenics
(transformed plants) those were selected by giving the
selection pressure of basta (Figure 7).
gene gun DNA delivery method. Putative transgenic
plants of both genotypes were selected on their
respective optimal basta dose.
1.3 Selection of transgenic plants of both genotypes
Twenty one (21) days old calli of genotype
S-2003-us-359 and 28 days old calli of S-2003-us-127
those were induce on CIM1 and CIM2 respectively
were bombarded with bar gene and shifted to RSM
having 10 and 5 mg/L basta. RSM with 10 mg/L basta
was used for the selection of transgenics of genotype
S-2003-us-359 and RSM with 5 mg/L basta was used
for the selection of transgenics of genotype
S-2003-su-127 (Figure 6).
Figure 7 PCR analysis of putative transgenics for bar
Note: M = I kb ladder, E= Empty lane, WT= Wild type plants,
P1, P2, P3 =Transgenic plants of genotype S-2003-us-359, P4,
P5 =Transgenic plants of genotype S-2003-us-127, -ve control
(water), E=Empty lane, + ve control (plasmid DNA)
2 Discussion
1
Figure 6 Selection of transgenics on selection regime having
basta as selective agent
Note: (A & B) transgenic plants selection of genotype
S-2003-us-359 on RSM having 10 mg/L basta; (C & D)
transgenic plants selection of genotype S-2003-us-127 on RSM
having 5 mg/L basta
1.4 Genomic analysis of putative transgenic plants
with PCR
Putative transgenic plants those bears the selection
pressures of basta were confirmed for the presence of
bar gene in their genome with PCR analysis by using
gene specific primers. DNA of wild type plant as well
as putative transgenics those bear basta selection
Selection of transformed cells containing stably
integrated gene is one of the major steps in production
of transgenic plants which can be achieved by
knowing the minimum concentration of selective
agent that can inhibit the growth of non-transformed
cells and allow transformed cells to survive. Due to
this, transformation process has become more efficient
that results in a very low occurrence of chimeras.
Sreeramanan et al., (2006) highlight the significance
of dose rate optimization of the selective agent and
determine that it is the most important step in the
selection of the transformed plants because it makes
the selection process very easy and efficient. Dose rate
optimization of the selective agent is highly tissue and
species specific described by Parveez et al (1996).
Due to high dependence against genotype in monocot,
it might be the variation in the endogenous resistance.
Therefore, optimization of the selective agent becomes
very crucial. Under these circumstances, this study was
organized for the efficient selection of transgenic
plants. It was observed that basta is an efficient
selective agent in the selection of sugarcane
transformed plants. It was also reported that prolonged
exposure to selection in medium containing Basta is
needed to reduce escapes.
Basta dose was optimized for transgenic selection and
five levels of basta (1 mg/L, 3 mg/L, 5 mg/L, 7 mg/L
53
Molecular Plant Breeding 2012, Vol.3, No.5, 50-56
http://mpb.sophiapublisher.com
and 10 mg/L) were used. 10 mg/L basta was selected
for transformation study of genotype S-2003-us-359
and 5 mg/L basta was selected for the transformation
study of S-2003-us-127 because at these level early
calli death was observed but Ahmad (2009) used 3
mg/L basta dose for transgenic selection in wheat.
Manickavasagam et al (2004) suggested 5 mg/L basta
as most effective selective agent for transgenic
selection in sugarcane. These results showed, the dose
of selective agent (basta) varying in both genotypes
and these results reveal that dose rate of selective
agents is also genotype dependent. These results were
also agreed with the results of van Boxtel et al (1995),
who also reported that the sensitivity to selective
agents was genotype dependent. Therefore it
concluded that optimization of optimal dose of selective
agents should be done before the transformation of any
crop plant.
the minimal inhibitory dose of basta on regeneration,
Calli of both genotypes were induced on their
respective callus induction media (CIM).
3 Materials and Methods
(RSM)
3.1 Germplasm/ plant materials
Two genotypes were selected viz., S-2003-us-359 and
S-2003-us-127, in which we have already established
an in vitro regeneration system (Ijaz et al., 2012;
Anjum et al., 2012).
Twenty one (21) days old Calli of S-2003-us-359 and
28 days old calli of S-2003-us-127 were transferred to
regeneration selection medium 1 (RSM 1) and
regeneration selection medium 2 (RSM 2) respectively.
RSM 1 containing 2, 4-D (0.1 mg/L), BAP (0.25 mg/L),
sucrose (40 g/L) and basal MS Salt with different
levels (1 mg/L, 3 mg/L, 5 mg/L, 7 mg/L, and 10 mg/L)
of basta (selective agent) but RSM 2 containing 2, 4-D
(0.1 mg/L), BAP (1 mg/L), sucrose (30 g/L) and basal
MS Salt with different levels (1 mg/L, 3 mg/L, 5 mg/L,
7 mg/L, and 10 mg/L) of basta (Table 2). Experiment
was repeated three times and data were collected on
the basis of survival rate.
Table 2 Media composition for regeneration selection media
Regeneration selection media (RSM)
1
3.2 Selection of basta dose rate for in vitro
regeneration media to select transgenics
Young innermost leaves of sugarcane genotypes viz.,
S-2003-us-359 and S-2003-us-127 were cultured on
CIM 1 and CIM 2 respectively (Table 1). For determine
Table 1 Media composition for callus induction media (CIM)
MS Salt
Sucrose
2,4D
Kinetin
Myoinositol
Nicotinic acid
Pyridoxine HCl
Thymine HCl
Glycine
Basta
Phyta gel
Callus induction media (CIM)
CIM 1
CIM 2
4.33 g/L
4.33 g/L
40 g/L
30 g/L
3 mg/L
3 mg/L
0
0.1 mg/L
0.1 g/L
0.1 g/L
1 g/L
1 g/L
1 g/L
1 g/L
2 g/L
2 g/L
4 g/L
4 g/L
0
0
2.66 g/L
2.66 g/L
RSM 1
RSM 2
MS Salt
4.33 g/L
4.33 g/L
Sucrose
40 g/L
30 g/L
2,4D
0.1 mg/L
0.1 mg/L
BAP
0.25 mg/L
1 mg/L
Myoinositol
0.1 g/L
0.1 g/L
Nicotinic acid
1 g/L
1 g/L
Pyridoxine Hcl
1 g/L
1 g/L
Thymine Hcl
2 g/L
2 g/L
Glycine
4 g/L
4 g/L
Basta
1 mg/L, 3 mg/L, 5 1 mg/L, 3 mg/L, 5
mg/L, 7 mg/L, and 10 mg/L, 7 mg/L, and
Phyta gel
mg/L
10 mg/L
2.66 g/L
2.66 g/L
Note: RSM 1 is the medium for genotype S-2003-us-359; RSM
2 is the medium for genotype S-2003-us-127
3.3 Genetic transformation of both genotypes with
bar gene to check the efficiency of selected basta
doses for transgenic selection
Genotype S-2003-us-359 and S-2003-us-127 were
genetically transformed with bar gene by using gene
gun delivery method to check the affectivity of
selected doses of basta for transgenic selection in both
Note: CIM 1 is the callus induction medium for genotype
S-2003-us-359; CIM 2 is the callus induction medium for
genotype S-2003-us-127
54
Molecular Plant Breeding 2012, Vol.3, No.5, 50-56
http://mpb.sophiapublisher.com
genotypes. Transgenic plants were selected on
selection regime having at 10 mg/L basta and 5 mg/L
basta for genotype S-2003-us-359 and S-2003-us-127
respectively.
pellets. The pellet was dissolved in R40 (40 μg/mL
RNAse A in 1× TE, pH 8.2). DNA quantity and
quality was checked with nanophotometer and by
running on 0.8% agarose gel.
3.4 Preparation of gold particle
Gold particles (40 mg) with an average size (0.6 µM)
were suspended in 1ml of 96% ethanol. Centrifugation
was done at 4 200 rpm for 1 minute. Supernatant was
removed followed by the addition of 1 mL (96%)
ethanol. Resuspended the particles again for short
time and repeated three times. Particles were
washed in 1 mL ultra pure water for three times.
Resuspended the particles again in 1 mL ultra pure
water after last centrifugation treatment. Aliquots of
50 µL were formed and stored aliquots at -80℃.
3.7 PCR analysis
Plants which were survived on basta were analyzed
with PCR (Polymerase chain reaction) analysis.
Putative plants which were survived on basta were
compared with wild type. PCR was carried out in a
25 µL reaction volume, containing 13.75 µL d3H2O,
2.5 µL 10×Taq buffer, 2.5 µL MgCl2, 1 µL dNTPs,
0.25 µLTaq DNA Polymerase, 1 µL of each primer
(reverse and forward primers flanking the bar gene)
and 3µl Template DNA. The sequences of reverse and
forward primers of bar gene are as follows.
3.5 Bombardment of calli with bar gene and
selection of putative transformed plants
The plasmid DNA having bar gene (Figure 8) was
precipitated on to 0.6 μ gold particles. DNA coated
gold particles were bombarded (PDS 1000/He). The
bombarded calli of genotype S-2003-us-359 and
S-2003-us-127 were transferred to Regeneration
selection media having 5 and 10 mg/L basta respectively,
incubated for 8~16 hrs dark and light condition at
(26±1)℃. Only those plants were survived on basta
which have bar gene and others were died.
Table 3 Primers used for the amplification of bar gene for
transgenic confirmation
Primer name
Primer sequence (5'→3')
Length
IQR/BAR-1
IQR/BAR-2
GAGACCAGTTGAGATTAGGCC
ATCTGGGTAACTGGCCTAACT
21
21
1 3.8 PCR (RAPD) amplification profile
PCR amplification was done by incubating the each
DNA samples at 95℃ for 3 minutes, then 35 cycles
comprising of denaturation at 95 ℃ for 1 minute,
annealing of primers at 58 ℃ for 1 minute and
extension at 72℃ for 1 minute. The final extension
was carried out at 72℃ for 10 minutes. Resolving of
PCR product was done by gel electrophoresis using
ethidium bromide staining solution. Agarose gel
electrophoresis separates macromolecules on the basis
of charge, size, or other physical properties. PCR
product were resolved on 0.8 Agarose in 0.5×TAE.
After electrophoresis, gels were photographed using gel
documentation system, and gel pictures were saved.
Figure 8 PCa bar Expression cassette with 35S promoter, bar
and T35S terminator and restriction sites
3.6 DNA extraction
Leaf tissues (200 mg) were ground in liquid nitrogen
700 µL Extraction buffer was added in each reaction
tube followed by the addition of 800 µL phenol
chloroform Isoamylalcohol (25:24:1). Centrifugation
was done for 3 minute at 5 000 rpm at 4℃ .
Supernatant was taken followed by the addition of
1/10 of sodium acetate into each tube. Equal volume
of Iso-propanol was added into each tube. Centrifugation
was performed at 13 200 rpm for 15 minutes.
Supernatant was removed. Washing of pellets with
80% ethanol was done, followed by air drying the
Reference
Akama K., Puchata H., and Hohn B., 1995, Efficient Agrobacterium
mediated transformation of Arabidopsis thaliana using the bar gene as
selectable marker, Plant Cell Rep., 14: 450-454 http://dx.doi.org/10.1007/
BF00234053
Anjum N., Ijaz S., Rana I.A., Khan T.M., Khan I.A., Khan M.N., Mustafa G.,
Joyia F.H., and Iqbal A., 2012, Establishment of an in vitro
regeneration system as a milestone for genetic transformation of
sugarcane (Saccharum officinarum L.) against Ustilago scitaminea,
Bioscience Methods, 3(2): 7-20
Cao M. X., Huang J.Q., He Y.L., Liu S.J., Wang C.L., Jiang W.Z., and Wei
55
Molecular Plant Breeding 2012, Vol.3, No.5, 50-56
http://mpb.sophiapublisher.com
Manickavasagam M., Ganapathi A., Anbazhagan V.R., Sudhakar B.,
Selvaraj N., Vasudevan A., and Kasthurirengan S., 2004,
Agrobacterium-mediated genetic transformation and development of
herbicide-resistant sugarcane (Saccharum species hybrids) using
axillary buds, Plant Cell Rep., 23: 134-143
http://dx.doi.org/10.1007/s00299-004-0794-y PMid:15133712
Miki B., and McHugh S., 2004, Selectable marker genes in transgenic plants:
applications, alternatives and biosafety, Journal of Biotechnology, 107:
193-232 http://dx.doi.org/10.1016/j.jbiotec.2003.10.011 PMid:14736458
Parveez G.K.A., Chowdhury M.K.U., and Saleh N.M., 1996, Determination
of minimal inhibitory concentration of selection agents for oil palm
(Elaeis guineensis Jacq.) transformation, Asia Pacific J. Mol. Biol.
Biotech., 4: 219-228
Petri C., Albuquerque N., and Burgos L., 2005, The effect of
aminoglycoside antibiotics on the adventitious regeneration from
apricot leaves and selection of nptII-transformed leaf tissues, Plant Cell,
Tissue and Organ Culture, 80: 271-276 http://dx.doi.org/10.1007/
s11240-004-1019-3
Rana A. I., 2009, Reverse and Forward Genetic Approaches for the
Development of Disease Resistant Wheat (Triticum aestivum L.), PhD
thesis, University of Agriculture Faisalabad, Pakistan
Sreeramanan M., Maziah M., Abdullah M.P., Rosli N.M., and Xavier R.,
2006, Potential selectable marker for genetic transformation in Banana,
Biotech., 5: 189-197 http://dx.doi.org/10.3923/biotech.2006.189.197
Z.M., 2006, Transformation of recalcitrant turf grass cultivars through
improvement of tissue culture and selection regime, Plant Cell Tissue
and Organ Culture, 85: 307-316 http://dx.doi.org/10.1007/s11240-006-9081-7
Chowdhury M.K.U., and Vasil I.K., 1992, Stably transformed herbicide
resistance callus of sugarcane via micropro¬jectile bombardment of
cell suspension cultures and electroporation of protoplasts, Plant Cell
Reports, 11: 494-498 http://dx.doi.org/10.1007/BF00236264
Christou P., Ford T., and Kofron M., 1991, Production of transgenic rice
(Oryza sativa L.) plants from agronomi¬cally important indica and
japonica varieties via electric discharge particle acceleration of
exogenous DNA into immature zygotic embryos, Bio/Technology, 9:
957-962 http://dx.doi.org/10.1038/nbt1091-957
Block, D.M., Botterman J., Vandewiele M., Dockx J., Thoen C., Gossele V.,
Rao V., Movva N., Thompson C., Montagu M.V., and Leemans J., 1987,
Engineering herbicide resistance in plants by expression of a detoxifying
enzyme, EMBO J., 6: 2513-2518 PMid:16453789 PMCid:553667
Fromm M.E., Morrish F., Armstrong C., Williams R., Thom¬as J., and Klein
T.M., 1990, Inheritance and expression of chimeric genes in the
progeny of transgenic maize plants, Bio/Technology, 8: 833-838
http://dx.doi.org/10.1038/nbt0990-833 PMid:1366794
Gordon-Kamm W., Spencer T.M., Mangano M.L., Adams T.R., Daines W.G.,
Start J.V., O'Brien S.A., Chambers W.R.J., Adams N.G., Willetts N.G,
Rice T.B., Mackey C.J., Krueger R.W., Kausch A.P., and Lemaux P.G.,
1990, Transformation of maize cells and regeneration of fertile
transgenic plants, The Plant Cell, 2: 603-618
http://dx.doi.org/10.2307/3869124 PMid:12354967 PMCid:159915
http://dx.doi.org/10.1105/tpc.2.7.603 PMid:12354967
Ijaz S., Rana I.A., Khan I.A., and Saleem M., 2012, Establishment of an in
vitro regeneration system for genetic transformation of selected
sugarcane genotypes, Genet. Mol. Res., 11 (1): 512-530
http://dx.doi.org/10.4238/2012.March.6.4
Vasil V., Castillo A.M., Fromm E.M., and Vasil I.K., 1992, Herbicide
resistant transgenic wheat plants obtained by microprojectile
1
bombardment of regenerable embryo¬genic callus, Bio/Technology, 10:
667-674 http://dx.doi.org/10.1038/nbt0692-667
Van Boxtel J., Eskes A., and Berthouly M., 1995, Glufosinate as an efficient
inhibitor of callus proliferation in coffee tissue, In Vitro Cell. Dev. Biol.
Plant, 33: 6-12 http://dx.doi.org/10.1007/s11627-997-0033-7
56