Original Article
Endothelial Uncoupling Protein 2 Regulates Mitophagy
and Pulmonary Hypertension During Intermittent Hypoxia
Maria Haslip, Iva Dostanic, Yan Huang, Yi Zhang, Kerry S. Russell, Michael J. Jurczak,
Praveen Mannam, Frank Giordano, Serpil C. Erzurum, Patty J. Lee
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Objectives—Pulmonary hypertension (PH) is a process of lung vascular remodeling, which can lead to right heart dysfunction
and significant morbidity. The underlying mechanisms leading to PH are not well understood, and therapies are limited.
Using intermittent hypoxia (IH) as a model of oxidant-induced PH, we identified an important role for endothelial cell
mitophagy via mitochondrial uncoupling protein 2 (Ucp2) in the development of IH-induced PH.
Approach and Results—Ucp2 endothelial knockout (VE-KO) and Ucp2 Flox (Flox) mice were subjected to 5 weeks of IH.
Ucp2 VE-KO mice exhibited higher right ventricular systolic pressure and worse right heart hypertrophy, as measured
by increased right ventricle weight/left ventricle plus septal weight (RV/LV+S) ratio, at baseline and after IH. These
changes were accompanied by increased mitophagy. Primary mouse lung endothelial cells transfected with Ucp2 siRNA
and subjected to cyclic exposures to CoCl2 (chemical hypoxia) showed increased mitophagy, as measured by PTENinduced putative kinase 1 and LC3BII/I ratios, decreased mitochondrial biogenesis, and increased apoptosis. Similar
results were obtained in primary lung endothelial cells isolated from VE-KO mice. Moreover, silencing PTEN-induced
putative kinase 1 in the endothelium of Ucp2 knockout mice, using endothelial-targeted lentiviral silencing RNA in vivo,
prevented IH-induced PH. Human pulmonary artery endothelial cells from people with PH demonstrated changes similar
to Ucp2-silenced mouse lung endothelial cells.
Conclusions—The loss of endothelial Ucp2 leads to excessive PTEN-induced putative kinase 1–induced mitophagy,
inadequate mitochondrial biosynthesis, and increased apoptosis in endothelium. An endothelial Ucp2–PTEN-induced
putative kinase 1 axis may be effective therapeutic targets in PH. (Arterioscler Thromb Vasc Biol. 2015;35:00-00.
DOI: 10.1161/ATVBAHA.114.304865.)
Key Words: endothelium ◼ hypertension, pulmonary ◼ mitochondrial degradation
◼ mitochondrial uncoupling protein 2
P
ulmonary hypertension (PH) is a progressive and incurable disorder associated with the remodeling of lung
vessels, with subsequent right heart failure and early death.
Therapies and our molecular understanding of PH remain
limited. Dysregulated angiogenesis,1 growth factor induction,
and pulmonary artery smooth muscle cell (PASMC) apoptosis resistance2 have been invoked as important pathogenetic
mechanisms. Recently, the role of the mitochondria in altering PASMCs and pulmonary artery endothelial cells (PAECs)
to an apoptosis-resistant phenotype has gained attention.3–5
There are many different rodent models for PH, both genetic
and pharmacological,6,7 including intermittent hypoxia (IH).8
We selected IH as a model of oxidant-induced vascular injury,
which is thought to be a common mechanism underlying
PH-associated disorders, such as parenchymal lung disease,
obstructive sleep apnea, and heart failure, as well as idiopathic
pulmonary arterial hypertension (PAH).9–11
Uncoupling protein 2 (Ucp2) belongs to a family of anion
transporters that are localized on inner mitochondrial membrane and dissipate proton gradient originated from mitochondrial electron transport chain.12 Thus far, 5 Ucp family
members have been discovered.13 Ucp1, known as thermogenin, is expressed in brown adipose tissue and dissipates the
proton gradient into heat.14 Ucp2 is widely expressed in the
central nervous system, pancreas, liver, and lungs and known
to regulate fatty acid metabolism,15 mitochondrial calcium
uptake,16 and mitochondrial reactive oxygen species (ROS)
production.16–18 Ucp2 has been studied primarily in the central
nervous system and pancreas, where its role was established in
neurotransmission, synaptic plasticity, and neurodegenerative
processes,19 as well as in insulin resistance.20 Recently, Ucp2
knockout mice were found to have worse hypoxia-induced
PH, and the authors attributed the mechanism to cellular dysfunction in PASMCs, such as endoplasmic reticulum stress,
Received on: April 25, 2014; final version accepted on: March 10, 2015.
From the Section of Pulmonary, Critical Care and Sleep Medicine (M.H., I.D., Y.Z., P.M., P.J.L.), Section of Cardiovascular Disease (Y.H., K.S.R,
F.G.), and Section of Endocrinology and Metabolism (M.J.J.), Yale University School of Medicine, New Haven, CT; and Lerner Research Institute and
Respiratory Institute, Cleveland Clinic, OH (S.C.E.).
The online-only Data Supplement is available with this article at http://atvb.ahajournals.org/lookup/suppl/doi:10.1161/ATVBAHA.114.304865/-/DC1.
Correspondence to Patty J. Lee, MD, Section of Pulmonary, Critical Care and Sleep Medicine, Yale University School of Medicine 333 Cedar St, PO
Box 208057, New Haven, CT 06520. E-mail [email protected]
© 2015 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
1
DOI: 10.1161/ATVBAHA.114.304865
2 Arterioscler Thromb Vasc Biol May 2015
Nonstandard Abbreviations and Acronyms
Atg5
EC
IH
MLEC
PAEC
PAH
PASMC
PGC1α
PH
Pink1
ROS
RVSP
Ucp2
WT
autophagy protein 5
endothelial cell
intermittent hypoxia
mouse lung endothelial cell
pulmonary artery endothelial cell
pulmonary arterial hypertension
pulmonary artery smooth muscle cell
peroxisome proliferator–activated receptor γ coactivator 1-α
pulmonary hypertension
PTEN-induced putative kinase 1
reactive oxygen species
right ventricular systolic pressure
uncoupling protein 2
wild-type
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
mitochondrial calcium influx imbalance, and mitochondrial
hyperpolarization.21,22 However, little is known about Ucp2
in ECs, which also play a key role in PH pathogenesis. EC
apoptosis is thought represent the initial pathological presentation of PH, but the early molecular events associated with
EC apoptosis in PH are not well defined.23
Our studies demonstrate a critical role for Ucp2 in preventing excessive EC apoptosis and mitophagy that lead
to IH-induced PH and right heart dysfunction. Mitophagy
represents selective autophagy of mitochondria—an important mechanism of cellular quality control that eliminates
damaged mitochondria, but in excess it can contribute to
cell death.24 This process is initiated by a change in mitochondrial membrane potential with accumulation of PTENinduced putative kinase 1 (Pink1) on the outer membrane,
leading to recruitment of cytoplasmic Parkin and facilitating ubiquitination of damaged mitochondria.25 Changes in
mitochondrial potential are known to activate mitophagy/
autophagy.26,27 Given that Ucp2 is a regulator of mitochondrial potential,28,29 we tested whether the absence of Ucp2
alters mitophagy, leading to the exaggerated PH phenotype
of endothelial-specific Ucp2 knockout mice using an IH
model of PH in mice and in ECs. We confirmed the clinical
relevance of our experimental findings by also investigating
lung ECs from people with PAH.
Material and Methods
Materials and Methods are available in the online-only Data
Supplement.
Results
Endothelial-Specific Ucp2 Knockout Mice Have
Increased Right Ventricular Systolic Pressure
and Right Ventricular Hypertrophy After IH
Global Ucp2 knockout mice have been already reported to
be more susceptible to chronic hypoxia–induced PH.21,22 To
specifically determine the role of endothelial Ucp2 in regulating right ventricular (RV) systolic pressures (RVSPs), a
measurement of pulmonary artery pressures, and RV remodeling in response to IH, we generated mice with endothelialspecific knockout of the Ucp2 gene by crossing Ucp2 Flox
mice (Flox)30 and mice containing VE-cadherin driving the
transcription of Cre recombinase (VE-KO). Figure I in the
online-only Data Supplement shows the absence of Ucp2
expression in ECs isolated from total lungs of VE-KO mice.
Animals were subjected to 5 weeks of IH, and RVSP was
measured. Figure 1A demonstrates that VE-KO mice have
significantly higher RVSP even at baseline compared with
Flox mice. Moreover, RVSPs markedly increased after IH in
VE-KO mice compared with RVSPs in Flox mice. We also
determined that VE-KO mice have significantly increased RV
remodeling, as measured by the ratio of RV weight/left ventricle (LV) plus septal weight (RV/LV+S), compared with Flox
mice (Figure 1B). These data suggest that endothelial Ucp2 is
an important determinant of PH at baseline and after IH.
Ucp2 VE-KO Mice Demonstrate Increased
Endothelial Apoptosis in Lungs at
Baseline and After 1 Week of IH
We costained lung sections from experimental mice for terminal deoxynucleotidyl transferase dUTP nick-end labeling
staining, a marker for apoptosis, and von Willebrand factor,
an EC marker. After 5 weeks of IH, we did not detect apoptosis in ECs of Flox or VE-KO mice (Figure IIA, IIB, and
IID in the online-only Data Supplement). However, VE-KO
mice showed increased EC apoptosis at baseline (Figure IIC
in the online-only Data Supplement), which may account
for their baseline changes in RVSP. Given that early endothelial apoptosis has been described as a hallmark of PH31,32
Figure 1. Pulmonary hypertension evaluation in uncoupling protein 2 Flox and VE-KO mice at room air and after 5 weeks of intermittent
hypoxia (IH). A, Right ventricle systolic pressure was measured by direct catheter insertion. B, Right ventricle hypertrophy, as measured
by right ventricle (RV) weight divided by left ventricle (LV)+septal weight (RV/LV+S). Mouse hearts were dissected into RV and LV with septum. Each part was weighed, and a RV/LV+S ratio was calculated for each animal; *P<0.05; n=8 to 11 in each group.
Haslip et al Ucp2 in Mitophagy and Endothelium 3
and that later stages of PH may be associated with apoptosis resistance,33 we exposed mice to 1 week of IH and performed terminal deoxynucleotidyl transferase dUTP nick-end
labeling and von Willebrand factor staining, which showed
increased IH-induced endothelial apoptosis in VE-KO mice
compared with Flox mice (Figure III in the online-only Data
Supplement). These data suggested that endothelial apoptosis
may precede the development of overt PH by weeks.
Ucp2 VE-KO Mice Have Increased Mitophagy
and Autophagy Markers in Lungs
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Given that IH is known to generate endothelial oxidant injury
and we recently reported that lung ECs undergo autophagy
and mitophagy in response to oxidant injury,34,35 we hypothesized that the absence of endothelial Ucp2 will alter autophagy and mitophagy. Immunoblotting of the mitochondrial
fraction of total lung protein lysates prepared by differential
centrifugation (Materials and Methods in the online-only
Data Supplement) revealed significantly increased Pink1
and Parkin levels in VE-KO mice at baseline (room air) and
after IH (Figure 2A and 2B). IH significantly increased the
mitochondrial content of Pink1 and Parkin in both VE-KO
mice and Flox animals. At baseline, VE-KO had increased
autophagy, as measured by the LC3BII/LC3BI ratio, compared with Flox animals (room air). IH increased autophagy
in both Flox and VE-KO animals (Figure 2C). Similar to
the VE-KO mice, global Ucp2 knockout mice demonstrated
more baseline Pink1 and Parkin levels in the mitochondrial
fraction and an increased ratio of LC3BII/LC3BI in total lung
lysates compared with control mice (Figure IVA–IVC in the
online-only Data Supplement). These results suggest that the
loss of EC Ucp2 phenocopies the global loss of Ucp2 and
is sufficient to cause baseline increases in lung mitophagy,
autophagy, and PH.
Mouse Lung ECs Lacking Ucp2 Demonstrate
Increased Mitophagy and Autophagy Flux
To more specifically investigate the mitophagy and autophagy
in lung ECs, we isolated primary mouse lung ECs (MLECs)
from the lungs of Flox and VE-KO mice. For all assays, we
used ECs between passages 5 and 8, during which the time
cellular senescence does not seem to play a significant role
(Figure V in the online-only Data Supplement). Our protein
data showed that cultured ECs (which we refer to as cultured MLECs) have increased baseline levels of mitophagyand autophagy-associated proteins (Pink1 and LC3BII/I
ratios, respectively), whereas a major mitochondria biogenesis regulator, peroxisome proliferator–activated receptor γ
coactivator 1-α (PGC1α), was significantly lower after Ucp2
silencing (Figure 3A). Moreover, mitochondrial mass in cultured MLECs, as assessed by MitoTracker Green FM staining and detected by flow cytometry, was significantly lower
in cells transfected with Ucp2 siRNA (Figure 3B). Similarly,
ECs isolated directly from the lungs of VE-KO mice also had
less mitochondrial mass compared with ECs from Flox animals (Figure 3C). This suggests that the accelerated removal
of damaged mitochondria in MLECs is not compensated by
mitochondria biosynthesis. We also transfected cells with
Figure 2. Immunoblots of lung lysates for proteins associated
with mitophagy/autophagy from uncoupling protein 2 Flox and
VE-KO mice. A, PTEN-induced putative kinase 1 (Pink1) protein
in the mitochondrial fraction of total lung lysates. B, Parkin protein in the mitochondrial fraction of total lung lysates. C, LC3BII/
LC3BI ratio in total lung lysates; *P<0.05.
ptfLC3 plasmid that contained LC3 tagged with green and red
fluorescent proteins. When autophagy flux starts, LC3 localizes to the lysosomes, and only red fluorescent proteins can
be detected because green fluorescent proteins are sensitive
to degradation by the acidic environment of the lysosome.
Figure 3D shows that MLECs transfected with Ucp2 siRNA
have baseline increased autophagy flux (which we refer to as
4 Arterioscler Thromb Vasc Biol May 2015
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Figure 3. Mouse lung endothelial cells (MLECs) after uncoupling protein 2 (Ucp2) silencing and kept in room air (RA) or challenged with
CoCl2 intermittent hypoxia (IH). Scrambled siRNA (Sc) was used as a negative control. A, Mitophagy-associated protein PTEN-induced
putative kinase 1 (Pink1), autophagy-associated proteins LC3BI and LC3BII, and mitochondrial biogenesis–associated protein peroxisome proliferator–activated receptor γ coactivator 1-α (PGC1α) in RA after Sc or Ucp2 siRNA transfection. B, Mitochondrial mass in
cultured MLECs as assessed by fluorescence-activated cell sorter (FACS) in RA or after CoCl2 IH. C, Mitochondrial mass as assessed by
FACS in ECs isolated from Flox or VE-KO lungs in RA and after 5 weeks of IH; *P<0.05. D, Autophagy levels as assessed by immunofluorescent ptfLC3 plasmid. Original magnification of all photomicrographs, ×40.
hyperactive autophagy) compared with MLECs transfected
with scrambled siRNA.
As additional confirmation, cultured MLECs transfected
with Ucp2 siRNA had significantly lower mitochondrial membrane potential, as measured by MitoTracker Red CMXRos,
compared with control cells both in room air and after CoCl2
IH (Figure 4A). Mitochondrial membrane potential of ECs
isolated from the lungs of VE-KO mice also demonstrated significantly lower mitochondrial potential compared with Flox
lung ECs in room air and after 5 weeks of IH (Figure 4B).
Figure 4C shows that Ucp2 silencing increased cultured
MLEC apoptosis in room air and after IH, suggesting that
increased autophagy/mitophagy can lead to MLEC apoptosis,
an important mechanism of PH. It has been shown that IH
is associated with excessive mitochondrial ROS production36
that can induce autophagy.37,38 To determine whether hyperactive autophagy in MLECs in the absence of Ucp2 is driven
by elevated ROS, we assessed mitochondrial ROS content
in MLECs with and without Ucp2 siRNA. Figure 4D shows
no significant difference in mitochondrial ROS production
between MLECs with and without Ucp2 siRNA at baseline.
However, CoCl2 IH stimulates a significant increase in mitochondrial ROS levels in Ucp2 siRNA–transfected MLECs.
These data suggest that Ucp2 silencing increased baseline
mitophagy in MLECs without increasing mitochondrial ROS
production.
Ucp2 Silencing Mediates Mitochondrial Changes
and Apoptosis via Calcium in MLECs
Increased baseline mitophagy seems to be associated with
decreased mitochondrial membrane potential in cultured
MLECs transfected with Ucp2 siRNA and in ECs isolated
from VE-KO mice, Figure 4). Although a direct effect of
Ucp2 loss may be increased mitochondrial membrane potential,39 calcium levels are also important modulators of membrane potential. We determined whether calcium-dependent
mechanisms mediate Ucp2-silencing effects on mitochondria and apoptosis in MLECs. MLECs were transfected with
Ucp2 siRNA and subjected to CoCl2 IH in the absence or
presence of calcium chelator, BAPTA-AM. Figure 5A shows
that BAPTA-AM eliminated Ucp2 siRNA–induced apoptosis after CoCl2 IH. BAPTA-AM also reversed the effects of
Ucp2 siRNA on mitochondrial mass and potential in MLECs
(Figure 5B and 5C). Of note, BAPTA-AM alone did not significantly change apoptosis, mitochondrial mass, or mitochondrial potential in MLECs. These data suggested that the
Haslip et al Ucp2 in Mitophagy and Endothelium 5
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Figure 4. Mouse lung endothelial cells (MLECs) after uncoupling protein 2 (Ucp2) silencing and kept in room air or challenged with CoCl2
intermittent hypoxia (IH). Scrambled siRNA (Sc) was used as a negative control. A, Mitochondrial membrane potential as assessed by
fluorescence-activated cell sorter (FACS) in room air or after CoCl2 IH. B, Mitochondrial membrane potential as assessed by FACS in ECs
isolated from Flox and VE-KO lungs in room air and after 5 weeks of IH. C, Apoptosis as assessed by annexin-propidium iodide FACS in
room air or after CoCl2 IH. D, Mitochondrial reactive oxygen species (ROS) production as assessed by FACS in room air or after CoCl2 IH;
*P<0.05.
effects of Ucp2 silencing on mitochondria and apoptosis may
be calcium mediated.
Ucp2 Silencing Increases Autophagy
Protein 5 Cleavage in MLECs
Calpains are calcium-dependent proteases that can cleave
autophagy protein 5 (Atg5), a major component of autophagosome formation, leading to increased autophagy and apoptosis.40 Figure 6 shows that Ucp2 siRNA–treated cultured
MLECs have significantly increased cleaved Atg5 compared
with control (sc siRNA) cells. Therefore, Ucp2 silencing
may alter calcium signaling, leading to calpain-induced Atg5
cleavage, which results in increased autophagy and apoptosis
in MLECs.
Pink1 Silencing Partially Reverses
Hyperactive Autophagy in MLECs
To determine whether mitophagy-associated protein, Pink1,
mediates the hyperactive autophagy associated with Ucp2
silencing, we transfected MLECs with both Ucp2 and Pink1
siRNAs before CoCl2 IH. Transfection efficiency of simultaneous transfections with Ucp2 and Pink1 siRNAs is shown in
Figure VIII in the online-only Data Supplement. Figure 7A
and 7B show that Pink1 silencing reduced the hyperactive
autophagy associated with Ucp2 silencing in MLECs. We
quantified autophagy in MLECs by counting the percentage
of cells labeled with the red fluorescent protein in Figure 7B.
We also evaluated the mitophagy rate by cotransfecting cells
with mitochondria-targeted mKeima-Red plasmid.41 The fluorescent protein Keima has an excitation spectrum that changes
with pH. A neutral pH is associated with a short wavelength
(≈440 nm), whereas an acidic pH, as found in lysosomes,
leads to a longer wavelength (≈550 nm). Keima containing
plasmid tagged with a mitochondria-localizing peptide is a
mode of detecting mitophagy flux via 440 nm/550 nm ratios.
This ratio determines the amount of mitochondrion outside
(440 nm) and inside (550 nm) lysosomes, which reflects the
mitophagy rate. Figure 7C shows that MLECs transfected
with Ucp2 siRNA have increased mitophagy flux at baseline
that is not changed by CoCl2 IH but significantly reduced by
Pink1 silencing. Moreover, Pink1 silencing in MLECs that
had been transfected with Ucp2 siRNA–restored mitochondrial potential (Figure 8A) and partially reduced apoptosis, as
well as ROS production (Figure 8C and 8D). We confirmed
our MLECs in CoCl2 IH results by showing similar changes
in mitochondrial potential in MLECs isolated from Flox and
VE-KO mice before and after IH (Figure 8B). To further confirm our results in vivo, we initially constructed an all-celltargeting Pink1 silencing lentiviral construct (Lenti-Pink1
miRNA) for intranasal delivery, per our recent reports of
intranasal lentiviral delivery.34,35,42 We first confirmed adequate
Pink1 silencing in the mitochondria of lung lysates after wildtype (WT) mice were given intranasal lenti-Pink1 miRNA
(Figure 9A). We then subjected mice to 5 weeks of IH and
isolated the mitochondrial fraction from lung lysates. Pink1
6 Arterioscler Thromb Vasc Biol May 2015
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Figure 6. Immunoblot and densitometry of mouse lung endothelial cell (MLEC) lysates demonstrating autophagy protein 5 (Atg5)
cleavage in MLECs transfected with scrambled (sc) or uncoupling
protein 2 (Ucp2) siRNA in room air and after CoCl2 intermittent
hypoxia (IH): 1 and 2, sc siRNA/room air; 3 and 4, Ucp2 siRNA/
room air; 5 and 6, sc siRNA/CoCl2 IH; 7 and 8, Ucp2 siRNA/CoCl2
IH.
silencing restored mitochondrial potential (Figure 9B) and
mitochondrial mass (Figure 9D). Of note, in MLECs in which
Ucp2 was silenced, Pink1 silencing did not restore mitochondrial mass (Figure 9C). These data suggest that Pink1 silencing
has different effects on mitochondrial mass in vitro (MLECs)
versus in vivo, which may be because of the contributing role
of other cells, as proposed in the Discussion section.
Endothelial Pink1 Silencing in Ucp2
Knockout Mice Prevents IH-Induced PH
Figure 5. Mouse lung endothelial cells (MLECs) after uncoupling
protein 2 (Ucp2) silencing and kept in room air or challenged
with CoCl2 intermittent hypoxia (IH) with or without incubation
with 1 μmol/L BAPTA-AM. Scrambled siRNA (Sc) was used
as a negative control. A, Apoptosis as assessed by annexinpropidium iodide fluorescence-activated cell sorter (FACS)
in room air or after CoCl2 IH with or without incubation with
1 μmol/L BAPTA-AM. B, Mitochondrial mass as assessed by
FACS in room air or after CoCl2 IH with or without incubation
with 1 μmol/L BAPTA-AM. C, Mitochondrial membrane potential
as assessed by FACS with or without incubation with 1 μmol/L
BAPTA-AM; *P<0.05.
To demonstrate the specific effect of endothelial Pink1 silencing in vivo, we delivered intranasal endothelial-specific Pink1
silencing RNA (VE-Lenti-Pink1 miRNA) to WT and global
Ucp2 knockout mice before 5 weeks of IH. We recently demonstrated endothelial specificity and effective Pink1 silencing
in endothelium using intranasal VE-Lenti-Pink1 miRNA.35
Figure 10 demonstrates a significant decrease in RVSP and
RV/LV+S ratio in Ucp2 knockout mice treated with VE-LentiPink1 miRNA compared with mice treated with control lentivirus. Of note, WT mice treated with VE-Lenti-Pink1 miRNA
showed an increase in RVSP compared with control virus–
treated mice (Figure 10A). This may be because of the fact the
Pink1 silencing in WT endothelium leads to a phenotype similar to Ucp2 silencing, such as increased apoptosis (Figure 8C),
decreased mitochondrial potential (Figure 9B), and mitochondrial mass (Figure 9C). These data suggest that endothelial
Pink1 is an important determinant of the Ucp2 knockout PH
phenotype in vivo.
PAECs From Patients With PAH Demonstrated
Decreased Ucp2 and PGC1α, as well as
Increased Pink1 Protein Expression
PAECs were obtained from normal lung and 4 PAH-explanted
donor lungs, as we recently described.43 Immunoblotting for
Haslip et al Ucp2 in Mitophagy and Endothelium 7
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Figure 7. PTEN-induced putative kinase 1 (Pink1) knockdown in uncoupling protein 2 (Ucp2)–silenced mouse lung endothelial cells
(MLECs) and kept in room air or challenged with CoCl2 intermittent hypoxia (IH). A, Autophagy levels as assessed by immunofluorescent ptfLC3 plasmid. Original magnification of all photomicrographs, ×40. B, Quantification of autophagy as a percent of red fluorescent
protein (RFP) positive cells. C, Quantification of mitophagy as a 444 nm/544 nm fluorescence ratio. Mitophagy in MLECs treated with
30-μmol/L CCCP for 16 hours is used as a positive control. Data presented as a percent of mitophagy undergoing cells relative to positive
control; *P<0.05.
Pink1, PGC1α, Atg5, and Ucp2 proteins in total lysates from
PAECs showed significantly increased Pink1, Atg5 cleavage
(the relative amount of truncated Atg in comparison with Atg),
as well as decreased PGC1α and Ucp2 protein expression in
patients with PAH compared with normal donors (Figure 11).
These data parallel our findings in IH and in Ucp2 siRNA–
treated MLECs.
Discussion
The overall goal of our study was to determine the role of
EC Ucp2 and identify previously unrecognized mechanisms,
whereby Ucp2 deficiency or silencing results in PH. We
also demonstrate the relevance of EC Ucp2 and mitophagy
to human PH. Unlike previous reports of Ucp2 in PASMCs
and chronic hypoxia-induced PH, we studied IH as a general model for oxidant-induced PH, which is thought to be a
common mechanism underlying both PH and PAH because
of a variety of disease states. IH has been reported to lead
to pulmonary vascular and systemic hypertension. However,
the severity of the vascular changes varies. For example,
IH in rats leads to severe systemic hypertension,44 whereas
IH in mice leads to milder changes.45 Campen et al45 demonstrated increased RV/LV+septal weight ratio in C57Bl6
mice subjected to 5 weeks of IH to levels similar to what we
found in VE-KO mice. Fagan46 showed an increase in RVSP
in WT mice after IH (29.5±0.6 mm Hg in normoxia versus
36±0.9 mm Hg after IH). Our findings were slightly different
(23.6±0.7 mm Hg in normoxia versus 25.7±0.8 mm Hg after
IH) that can be explained by differences in the length of IH
exposure (24 h/d by Fagan versus 10 h/d in our experiments)
and the fact that our mice were floxed for Ucp2, which may
have some effect on the phenotype. IH has been proposed as
an animal model for PH development as a response to cyclic
hypoxia-reoxygenation.46 However, others demonstrated
that the development of PH in response to IH was predominantly observed in transgenic mice.39,47,48 Similarly, our control Flox mice did not show significant increases in RVSP or
RV hypertrophy, as measured by the RV/LV+septal weight
ratio, whereas VE-KO mice demonstrated both higher RVSP
and RV hypertrophy. These results seem to suggest that flox
mice are partially protected against PH development, which
requires future investigation.
8 Arterioscler Thromb Vasc Biol May 2015
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Figure 8. PTEN-induced putative kinase 1 (Pink1) knockdown in uncoupling protein 2 (Ucp2)–silenced mouse lung endothelial cells
(MLECs) and kept in room air or challenged with CoCl2 intermittent hypoxia (IH). A, Mitochondrial membrane potential after scrambled
(sc), Upc2, Pink1, or Ucp2+Pink1 siRNA transfection, assessed by fluorescence-activated cell sorter (FACS) in room air or after CoCl2 IH.
B, Mitochondrial membrane potential as assessed by FACS in ECs isolated from the lungs of Flox and VE-KO mice in room air and after 5
weeks of IH. C, Apoptosis in MLECs as assessed by annexin-propidium iodide FACS in room air or after CoCl2 IH. D, Mitochondrial reactive oxygen species (ROS) production in MLECs as assessed by FACS in room air or after CoCl2 IH; *P<0.05.
We detected apoptosis in endothelium after 1 week of IH
but not after 5 weeks, which is the time point when physiological evidence of PH, such as increased RVSP and RV
hypertrophy, is most evident. These data are consistent with
reports that early, wide-spread EC apoptosis eventually selects
for ECs with hyperproliferative and apoptosis-resistant phenotypes.33 We speculate that between 1 and 5 weeks of IH,
ECs may transition to an apoptosis-resistance phenotype, but
this would require more extensive time course experiments to
confirm. Yamagi-Kegan et al32 recently demonstrated endothelial apoptosis during early time points of inducible PH and
increased remodeling near the end. Interestingly, VE-KO mice
had detectable endothelial apoptosis even at baseline, which
may account for their baseline increases in RVSP and RV
hypertrophy, which will become the basis of future studies.
Our data show that the loss of EC Ucp2 leads to increased
Pink1 expression, mitophagy, and apoptosis in mouse ECs
and that PAH in people is associated with similar changes
in ECs. On the basis of these data, we propose the following mechanism for IH-induced PH: decreased Ucp2 in endothelium results in increased mitophagy–autophagy without
adequate replacement of healthy, newly synthesized mitochondria, which leads to increased endothelial loss, at least in
part via apoptosis and, ultimately, PH. VE-KO mice allowed
us to evaluate the specific role of ECs in vivo. Previous reports
show that endothelial events likely precede PH-associated
vasculopathy.49,50 We demonstrate that VE-KO mice develop
PH, even at baseline, and that their lungs have increased
mitophagy-associated proteins, Pink1 and Parkin, suggesting
higher baseline mitophagy than control mice. Markers of macroautophagy, LC3BII/LC3BI, were also increased in lungs of
VE-KO mice. We found parallel findings in MLECs in which
Ucp2 was silenced and in lungs of global Ucp knockout mice.
Increased autophagy has been recently identified by Long et
al51 in the pathogenesis of monocrotaline-induced PH in rats.
They showed that blocking autophagy with chloroquine, an
inhibitor of autophagic protein degradation, led to decreased
proliferation and increased apoptosis of rat PASMCs.
Mitophagy is a specific type of autophagy in which damaged
mitochondria are removed.24
Mitophagy and mitochondrial biogenesis represent 2 coordinated processes that determine cellular dysfunction and disease.52 To maintain a healthy cellular environment, a balance
between removal of damaged mitochondrion and biosynthesis of new mitochondria is necessary. To evaluate mitochondrial balance, we determined the expression of PGC1α and
mitochondrial mass. PGC1α is a major transcription factor
that controls mitochondrial biogenesis through the coactivation of many nuclear and nonnuclear receptors.53 We evaluated mitochondrial mass not only in cultured MLECs with
Haslip et al Ucp2 in Mitophagy and Endothelium 9
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Figure 9. Lung-targeted PTEN-induced putative kinase 1 (Pink1) silencing in vivo. Wild-type (WT) and uncoupling protein 2 (Ucp2) knockout (KO) mice were given lentiviral Pink1 miRNA intranasally followed by room air or 5 weeks of intermittent hypoxia (IH). A, Immunoblot
for Pink1 protein in the mitochondrial fraction from lung lysates of mice given lentiviral Pink1 miRNA (Lenti-Pink1 miRNA) or lentiviral control (Lenti-ctrl) intranasally and maintained in room air. Hsp60 was used as a loading control for mitochondrial protein. B, Endothelial cells
(ECs) isolated from lungs of WT and KO mice treated with Lenti-control or Lenti-Pink1miRNA and subjected to 5 weeks of IH; C, Mouse
lung ECs (MLECs) after scrambled (Sc), Ucp2, Pink1, or Ucp2+Pink1 siRNA transfection, in room air or after CoCl2 IH. D, ECs isolated
from lungs of WT and KO mice treated with Lenti-control or Lenti-Pink1miRNA and subjected to 5 weeks of IH; *P<0.05.
silenced Ucp2 but also ex vivo in ECs isolated from lungs
of VE-KO mice. Ryan et al54 reported that female rats developed monocrotaline-induced PH through an involvement of
PGC1α. The same authors showed earlier that mitochondrial
fragmentation, increased proliferation, and impaired apoptosis in PASMCs were in the basis of PH development.55
Similar mechanisms may be responsible for IH-induced PH
in VE-KO mice and ECs. Xu and Erzurum56 introduced the
concept of increased glycolysis in the ECs of patients with
PAH, potentially because of decreased mitochondrial function and increased ROS production. The historical work by
Warburg,57 showing a predominance of glycolysis compared
with respiration in tumors, was expanded by Tuder et al3 into
the pathogenesis of PH. Condello et al58 demonstrated that
tumor cells often have fewer, smaller, more fragile, and highly
pleiomorphic mitochondria than their normal counterparts.
Decreased quantities of effective mitochondria in ECs from
Ucp2 knockout mice could potentially lead to a glycolytic
phenotype, resulting in PH.
To verify our in vivo findings in isolated lung ECs, we
developed a chemical IH in vitro model. We avoided using
gaseous hypoxia, which necessitates serum starvation because
serum deprivation activates autophagy. Gaseous hypoxia also
requires at least 2 to 4 hours before the cell culture media
attains hypoxic conditions. To mimic our in vivo model of
IH, in which cycling between hypoxia and normoxia occurs
within minutes, we used the rapid anoxic/hypoxic conditions
achieved by chemical methods. We instituted chemical IH
using CoCl2 and checked many various conditions (intermittent and sustained hypoxia) based on similar signaling protein profiles between in vitro and in vivo experiments. We
analyzed autophagy and mitophagy using complementary
assays. In addition to calculating LC3BII/LC3BI ratios, we
detected autophagy flux with ptfLC3 plasmid transfection, as
others have described.59 To evaluate the mitophagy rate, we
used a relatively new approach by cotransfecting cells with
mitochondrial-targeted mKeima-red plasmid. mKeima protein has a different excitation wavelength depending on the
acidity of the environment, such as the acidic environment
of the lysosomal compartment.41 Ucp2-silenced MLECs had
significantly higher 444 nm/544 nm ratios than the WT cells,
suggesting increased mitophagy rates. Interestingly, CoCl2 IH
induces autophagy but not mitophagy in WT MLECs. These
data suggest that the increased baseline autophagy markers detected after Ucp2 silencing may primarily because of
increased mitophagy rather than autophagy.
Although a direct effect of Ucp2 loss is expected to be
increased mitochondrial membrane potential,39 there may be
counterbalancing, adaptive effects of Ucp2 deficiency that
occur in ECs. We found that excessive apoptosis, loss of mitochondrial mass, and mitochondrial potential in Ucp2-silenced
MLECs after CoCl2 IH can be prevented by a calcium chelator, BAPTA-AM. Calcium homeostasis is vital for normal
cell physiology, and its disruption can lead to heart failure,
10 Arterioscler Thromb Vasc Biol May 2015
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Figure 10. Pulmonary hypertension evaluation in wild-type (WT)
and uncoupling protein 2 (Ucp2) knockout (KO) mice given
endothelial-specific VE-PTEN-induced putative kinase 1 (Pink1)
miRNA lentivirus intranasally followed by 5 weeks of intermittent hypoxia (IH). A, Right ventricle (RV) systolic pressure was
measured by direct catheter insertion. B, RV/LV+S ratio. Mouse
hearts were dissected into RV and left ventricle (LV) with septum.
Each part was weighed and a RV/LV+S ratio was calculated for
each animal; *P<0.05.
diabetes mellitus, and neuronal degeneration. Under physiological conditions, there is constant crosstalk between endoplasmic reticulum, which releases calcium, and mitochondria,
which uptakes calcium. Ucp2 has been shown to play a role in
mitochondrial uptake of intracellular calcium.60 We postulate
that the absence of Ucp2 during IH in ECs results in calcium
accumulation, which leads to mitochondrial depolarization
and apoptotic cell death. The precise mechanisms of calcium
release and the molecular sequence of events leading to calcium-induced apoptosis merit future investigations. We invoke
a potential role for increased cleaved Atg5, which is regulated
by calcium-sensitive proteases and has been shown to cause
both excessive autophagy and apoptosis.61,62 Yousefi et al40
reported that increased Atg5 cleavage by calcium-sensitive
calpains represented the point at which beneficial autophagy
becomes excessive or detrimental apoptosis. Shi et al63 linked
calcium influx, Atg5 cleavage by calpains and mitochondrial
potential disruption with increased apoptosis. Dromparis et
al22 demonstrated that calcium dysregulation plays a role in
PH development in Ucp2 knockout mice, but their findings
were in PASMCs. Our data point to a role for Ucp2 in cleavage of Atg5 in MLECs.
Others have reported that decreasing Ucp2 expression with
antisense oligonucleotides increased mitochondrial membrane potential and ROS production.64 These apparent discrepancies may be because of the specific cells used for the
experiment. For example, Duval et al64 used a CRL-2181 cell
line, which originates from lymph nodes and is immortalized
by SV40. In our study, we used primary MLECs. We also
studied mitochondrial potential and ROS production in both
MLECs and PASMCs (not shown). Unlike MLECs, which
showed decreased mitochondrial potential with Ucp2 silencing, PASMCs transfected with Ucp2 siRNA demonstrated
mitochondrial hyperpolarization. Moreover, mitophagy and
autophagy-related protein expression and autophagy flux
(ptfLC3 plasmid) and mitophagy flux (mKeima plasmid)
were different in PASMCs (not shown). Therefore, the effect
of Ucp2 on mitochondrial membrane potential is likely cell
type specific.
Finally, we invoked a functional role for Pink1, a mediator of mitophagy, in Ucp2 deficiency–induced PH. In vivo
Pink1 silencing, specifically in endothelium, may restore
the balance between removal of nonfunctional mitochondrion and biosynthesis of healthy mitochondria. With Pink1
silencing, we observed mitochondrial potential restoration
in both in vitro and in vivo models. We recently reported that
the absence of Pink1 leads to increased apoptosis, defective
mitochondrion, and increased susceptibility during acute
hyperoxia35 and lipopolysaccharide-induced inflammation65
in WT ECs. Our current studies show that Pink1 silencing
in ECs in the absence of Ucp2 seems to have a beneficial
effect, which we speculate may be because of the restoration of the balance between mitophagy and mitochondria
biogenesis in the setting of Ucp2 deficiency. Therefore, the
physiological role of Pink1-mediated mitophagy is likely
context and model dependent. For example, mitogen-activated protein kinase kinase 3–deficient mice are protected
against lipopolysaccharide-induced inflammation by their
baseline increases in both mitochondrial biosynthesis and
mitophagy—the net result of which is an increased pool
of healthy mitochondria.65 In our model of Ucp2 deficiency, increased mitophagy likely has a detrimental effect
because mitochondrial biosynthesis is decreased, the net
effect being inadequate mitochondrial replenishment
(as evidenced by the decrease in mitochondrial mass we
detected in Ucp2-deficient ECs). When Pink1 was silenced,
mitochondrial mass was restored in vivo only, which also
suggests some degree of specificity of Pink1-induced mitochondrial effects and the requirement for alternative cell
types in modulating mitochondrial mass. Given that smooth
muscle cell proliferation is regulated differently by ECs of
different sources66 and the importance of PASMCs in PH
pathogenesis, specific EC–PASMC interactions involving
Ucp2–Pink1 are likely. A more precise understanding of
these cell–cell interactions, especially in the context of
Ucp2 and mitochondrial biology, is an important area for
future investigations.
Mitochondrial markers, such as decreased expression
of manganese superoxide dysmutase and pyruvate dehydrogenase, have been associated with PH in people.67,68 An
Ucp2–Pink1 axis has not been previously described in clinical
PH. PAECs from people with PAH revealed increased Pink1
and Atg5 cleavage and decreased Ucp2 and PGC1α expression, suggestive of depressed mitochondrial biogenesis and
increased mitophagy compared with healthy donors. These
data are consistent with our mouse and EC IH data, further
supporting the clinical and therapeutic applicability of the
proposed model and pathway.
Haslip et al Ucp2 in Mitophagy and Endothelium 11
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Figure 11. Immunoblots for mitophagy-associated protein PTEN-induced putative kinase 1 (Pink1), autophagy and apoptosis-associated
cleaved Atg5 (tAtg5), mitochondrial biosynthesis marker, peroxisome proliferator–activated receptor γ coactivator 1 (PGC1), and uncoupling protein 2 (Ucp2) performed on lysates from pulmonary artery endothelial cells (PAECs) obtained from 4 patients with pulmonary
arterial hypertension (PAH) and 4 healthy donors. β-actin immunoblots was used as a loading control. Densitometry measurements are
graphically represented; *P<0.05.
Acknowledgments
We thank Dr Chun for his scientific advice and reading of the article
and Drs Fares and Trow for their clinical insights and review of the
data.
Sources of Funding
P.J. Lee was funded by the National Institutes of Health (R01
HL090660 and HL071595) and Flight Attendant Medical Research
Institute Clinical Investigator Award 82384. The metabolic studies
were supported by the Yale MMPC DK059635.
Disclosures
None.
References
1. Tuder RM, Groves B, Badesch DB, Voelkel NF. Exuberant endothelial cell
growth and elements of inflammation are present in plexiform lesions of
pulmonary hypertension. Am J Pathol. 1994;144:275–285.
2. Taraseviciene-Stewart L, Kasahara Y, Alger L, Hirth P, Mc Mahon G,
Waltenberger J, Voelkel NF, Tuder RM. Inhibition of the VEGF receptor
2 combined with chronic hypoxia causes cell death-dependent pulmonary
endothelial cell proliferation and severe pulmonary hypertension. FASEB
J. 2001;15:427–438. doi: 10.1096/fj.00-0343com.
3. Tuder RM, Davis LA, Graham BB. Targeting energetic metabolism: a
new frontier in the pathogenesis and treatment of pulmonary hypertension. Am J Respir Crit Care Med. 2012;185:260–266. doi: 10.1164/
rccm.201108-1536PP.
4. McMurtry MS, Archer SL, Altieri DC, Bonnet S, Haromy A, Harry G, Bonnet
S, Puttagunta L, Michelakis ED. Gene therapy targeting survivin selectively
induces pulmonary vascular apoptosis and reverses pulmonary arterial hypertension. J Clin Invest. 2005;115:1479–1491. doi: 10.1172/JCI23203.
5. Xu W, Koeck T, Lara AR, Neumann D, DiFilippo FP, Koo M, Janocha
AJ, Masri FA, Arroliga AC, Jennings C, Dweik RA, Tuder RM, Stuehr
DJ, Erzurum SC. Alterations of cellular bioenergetics in pulmonary artery
endothelial cells. Proc Natl Acad Sci U S A. 2007;104:1342–1347. doi:
10.1073/pnas.0605080104.
6. Gomez-Arroyo J, Saleem SJ, Mizuno S, Syed AA, Bogaard HJ, Abbate A,
Taraseviciene-Stewart L, Sung Y, Kraskauskas D, Farkas D, Conrad DH,
Nicolls MR, Voelkel NF. A brief overview of mouse models of pulmonary
arterial hypertension: problems and prospects. Am J Physiol Lung Cell
Mol Physiol. 2012;302:L977–L991. doi: 10.1152/ajplung.00362.2011.
7. Baron RM, Choi AJ, Owen CA, Choi AM. Genetically manipulated mouse
models of lung disease: potential and pitfalls. Am J Physiol Lung Cell Mol
Physiol. 2012;302:L485–L497. doi: 10.1152/ajplung.00085.2011.
8.Bosc LV, Resta T, Walker B, Kanagy NL. Mechanisms of intermittent hypoxia induced hypertension. J Cell Mol Med. 2010;14:3–17. doi:
10.1111/j.1582-4934.2009.00929.x.
9. Steudel W, Watanabe M, Dikranian K, Jacobson M, Jones RC. Expression
of nitric oxide synthase isoforms (NOS II and NOS III) in adult rat lung in
hyperoxic pulmonary hypertension. Cell Tissue Res. 1999;295:317–329.
10.Herget J, Wilhelm J, Novotná J, Eckhardt A, Vytásek R, Mrázková L,
Ostádal M. A possible role of the oxidant tissue injury in the development
of hypoxic pulmonary hypertension. Physiol Res. 2000;49:493–501.
11.Fessel JP, Flynn CR, Robinson LJ, Penner NL, Gladson S, Kang CJ,
Wasserman DH, Hemnes AR, West JD. Hyperoxia synergizes with
mutant bone morphogenic protein receptor 2 to cause metabolic stress,
oxidant injury, and pulmonary hypertension. Am J Respir Cell Mol Biol.
2013;49:778–787. doi: 10.1165/rcmb.2012-0463OC.
12. Klingenberg M. Uncoupling protein–a useful energy dissipator. J Bioenerg
Biomembr. 1999;31:419–430.
13. Jezek P, Zácková M, Reháková Z, Růzicka M, Borecký J, Skobisová E,
Brucknerová J, Garlid KD, Gimeno RE, Tartaglia LA. Existence of uncoupling protein-2 antigen in isolated mitochondria from various tissues.
FEBS Lett. 1999;455:79–82.
14.Fleury C, Neverova M, Collins S, Raimbault S, Champigny O, LeviMeyrueis C, Bouillaud F, Seldin MF, Surwit RS, Ricquier D, Warden
CH. Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia. Nat Genet. 1997;15:269–272. doi: 10.1038/ng0397-269.
15.Van Der Lee KA, Willemsen PHM, Van Der Vusse GJ, Van Bilsen M.
Effects of fatty acids on uncoupling protein-2 expression in the rat heart.
FASEB J. 2000;14:495–502.
12 Arterioscler Thromb Vasc Biol May 2015
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
16.Teshima Y, Akao M, Jones SP, Marbán E. Uncoupling protein-2 overexpression inhibits mitochondrial death pathway in cardiomyocytes.
Circ Res. 2003;93:192–200. doi: 10.1161/01.RES.0000085581.60197.4D.
17.Lee KU, Lee IK, Han J, Song DK, Kim YM, Song HS, Kim HS, Lee
WJ, Koh EH, Song KH, Han SM, Kim MS, Park IS, Park JY. Effects of
recombinant adenovirus-mediated uncoupling protein 2 overexpression
on endothelial function and apoptosis. Circ Res. 2005;96:1200–1207. doi:
10.1161/01.RES.0000170075.73039.5b.
18.Pecqueur C, Alves-Guerra MC, Gelly C, Levi-Meyrueis C, Couplan E,
Collins S, Ricquier D, Bouillaud F, Miroux B. Uncoupling protein 2, in
vivo distribution, induction upon oxidative stress, and evidence for translational regulation. J Biol Chem. 2001;276:8705–8712. doi: 10.1074/jbc.
M006938200.
19.Andrews ZB, Diano S, Horvath TL. Mitochondrial uncoupling pro
teins in the CNS: in support of function and survival. Nat Rev Neurosci.
2005;6:829–840. doi: 10.1038/nrn1767.
20. Chan CB, Harper ME. Uncoupling proteins: role in insulin resistance and
insulin insufficiency. Curr Diabetes Rev. 2006;2:271–283.
21.Pak O, Sommer N, Hoeres T, et al. Mitochondrial hyperpolariza
tion in pulmonary vascular remodeling - ucp2 deficiency as disease
model. Am J Respir Cell Mol Biol. 2013;49(3):358–367. doi: 10.1165/
rcmb.2012-0361OC.
22.Dromparis P, Paulin R, Sutendra G, Qi AC, Bonnet S, Michelakis ED.
Uncoupling protein 2 deficiency mimics the effects of hypoxia and endoplasmic reticulum stress on mitochondria and triggers pseudohypoxic
pulmonary vascular remodeling and pulmonary hypertension. Circ Res.
2013;113:126–136. doi: 10.1161/CIRCRESAHA.112.300699.
23.Jin Y, Choi AM. Cross talk between autophagy and apopto
sis in pulmonary hypertension. Pulm Circ. 2012;2:407–414. doi:
10.4103/2045-8932.105029.
24. Ashrafi G, Schwarz TL. The pathways of mitophagy for quality control
and clearance of mitochondria. Cell Death Differ. 2013;20:31–42. doi:
10.1038/cdd.2012.81.
25. Greene AW, Grenier K, Aguileta MA, Muise S, Farazifard R, Haque ME,
McBride HM, Park DS, Fon EA. Mitochondrial processing peptidase
regulates PINK1 processing, import and Parkin recruitment. EMBO Rep.
2012;13:378–385. doi: 10.1038/embor.2012.14.
26.Elmore SP, Qian T, Grissom SF, Lemasters JJ. The mitochondrial permeability transition initiates autophagy in rat hepatocytes. FASEB J.
2001;15:2286–2287. doi: 10.1096/fj.01-0206fje.
27. Priault M, Salin B, Schaeffer J, Vallette FM, di Rago JP, Martinou JC.
Impairing the bioenergetic status and the biogenesis of mitochondria
triggers mitophagy in yeast. Cell Death Differ. 2005;12:1613–1621. doi:
10.1038/sj.cdd.4401697.
28. Mills EM, Xu D, Fergusson MM, Combs CA, Xu Y, Finkel T. Regulation
of cellular oncosis by uncoupling protein 2. J Biol Chem. 2002;277:27385–
27392. doi: 10.1074/jbc.M111860200.
29. Marti A, Larrarte E, Novo FJ, Garcia M, Martinez JA. UCP2 muscle gene
transfer modifies mitochondrial membrane potential. Int J Obes Relat
Metab Disord. 2001;25:68–74.
30.Kong D, Vong L, Parton LE, Ye C, Tong Q, Hu X, Choi B, Brüning
JC, Lowell BB. Glucose stimulation of hypothalamic MCH neurons
involves K(ATP) channels, is modulated by UCP2, and regulates peripheral glucose homeostasis. Cell Metab. 2010;12:545–552. doi: 10.1016/j.
cmet.2010.09.013.
31. Jurasz P, Courtman D, Babaie S, Stewart DJ. Role of apoptosis in pulmonary hypertension: from experimental models to clinical trials. Pharmacol
Ther. 2010;126:1–8. doi: 10.1016/j.pharmthera.2009.12.006.
32. Yamaji-Kegan K, Takimoto E, Zhang A, Weiner NC, Meuchel LW, Berger
AE, Cheadle C, Johns RA. Hypoxia-induced mitogenic factor (FIZZ1/
RELMα) induces endothelial cell apoptosis and subsequent interleukin-4-dependent pulmonary hypertension. Am J Physiol Lung Cell Mol
Physiol. 2014;306:L1090–L1103. doi: 10.1152/ajplung.00279.2013.
33.Sakao S, Taraseviciene-Stewart L, Lee JD, Wood K, Cool CD, Voelkel
NF. Initial apoptosis is followed by increased proliferation of apoptosisresistant endothelial cells. FASEB J. 2005;19:1178–1180. doi: 10.1096/
fj.04-3261fje.
34.Zhang Y, Jiang G, Sauler M, Lee PJ. Lung endothelial ho-1 targeting
in vivo using lentiviral mirna regulates apoptosis and autophagy during oxidant injury. FASEB J. 2013;27(10):4041–4058. doi: 10.1096/
fj.13-231225.
35. Zhang Y, Sauler M, Shinn AS, Gong H, Haslip M, Shan P, Mannam P,
Lee PJ. Endothelial PINK1 mediates the protective effects of NLRP3 deficiency during lethal oxidant injury. J Immunol. 2014;192:5296–5304. doi:
10.4049/jimmunol.1400653.
36.Prabhakar NR, Kumar GK, Nanduri J. Intermittent hypoxia augments
acute hypoxic sensing via HIF-mediated ROS. Respir Physiol Neurobiol.
2010;174:230–234. doi: 10.1016/j.resp.2010.08.022.
37. Son YO, Wang X, Hitron JA, Zhang Z, Cheng S, Budhraja A, Ding S, Lee
JC, Shi X. Cadmium induces autophagy through ROS-dependent activation of the LKB1-AMPK signaling in skin epidermal cells. Toxicol Appl
Pharmacol. 2011;255:287–296. doi: 10.1016/j.taap.2011.06.024.
38. Karna P, Zughaier S, Pannu V, Simmons R, Narayan S, Aneja R. Induction
of reactive oxygen species-mediated autophagy by a novel microtubulemodulating agent. J Biol Chem. 2010;285:18737–18748. doi: 10.1074/jbc.
M109.091694.
39. Yu AY, Shimoda LA, Iyer NV, Huso DL, Sun X, McWilliams R, Beaty T,
Sham JS, Wiener CM, Sylvester JT, Semenza GL. Impaired physiological responses to chronic hypoxia in mice partially deficient for hypoxiainducible factor 1alpha. J Clin Invest. 1999;103:691–696. doi: 10.1172/
JCI5912.
40.Yousefi S, Perozzo R, Schmid I, Ziemiecki A, Schaffner T, Scapozza
L, Brunner T, Simon HU. Calpain-mediated cleavage of Atg5 switches
autophagy to apoptosis. Nat Cell Biol. 2006;8:1124–1132. doi: 10.1038/
ncb1482.
41. Kogure T, Karasawa S, Araki T, Saito K, Kinjo M, Miyawaki A. A fluorescent variant of a protein from the stony coral Montipora facilitates
dual-color single-laser fluorescence cross-correlation spectroscopy.
Nat Biotechnol. 2006;24:577–581. doi: 10.1038/nbt1207.
42. Siner JM, Jiang G, Cohen ZI, Shan P, Zhang X, Lee CG, Elias JA, Lee
PJ. VEGF-induced heme oxygenase-1 confers cytoprotection from
lethal hyperoxia in vivo. FASEB J. 2007;21:1422–1432. doi: 10.1096/
fj.06-6661com.
43. Kim J, Kang Y, Kojima Y, Lighthouse JK, Hu X, Aldred MA, McLean
DL, Park H, Comhair SA, Greif DM, Erzurum SC, Chun HJ. An endothelial apelin-FGF link mediated by miR-424 and miR-503 is disrupted in
pulmonary arterial hypertension. Nat Med. 2013;19:74–82. doi: 10.1038/
nm.3040.
44. Prabhakar NR, Peng YJ, Jacono FJ, Kumar GK, Dick TE. Cardiovascular
alterations by chronic intermittent hypoxia: importance of carotid body
chemoreflexes. Clin Exp Pharmacol Physiol. 2005;32:447–449. doi:
10.1111/j.1440-1681.2005.04209.x.
45. Campen MJ, Shimoda LA, O’Donnell CP. Acute and chronic cardiovascular effects of intermittent hypoxia in C57BL/6J mice. J Appl Physiol
(1985). 2005;99:2028–2035. doi: 10.1152/japplphysiol.00411.2005.
46. Fagan KA. Selected contribution: pulmonary hypertension in mice following intermittent hypoxia. J Appl Physiol (1985). 2001;90:2502–2507.
47. Fagan KA, Morrissey B, Fouty BW, Sato K, Harral JW, Morris KG Jr,
Hoedt-Miller M, Vidmar S, McMurtry IF, Rodman DM. Upregulation
of nitric oxide synthase in mice with severe hypoxia-induced pulmonary
hypertension. Respir Res. 2001;2:306–313.
48. Shimoda LA, Manalo DJ, Sham JS, Semenza GL, Sylvester JT. Partial
HIF-1alpha deficiency impairs pulmonary arterial myocyte electrophysiological responses to hypoxia. Am J Physiol Lung Cell Mol Physiol.
2001;281:L202–L208.
49.Budhiraja R, Tuder RM, Hassoun PM. Endothelial dysfunction in pulmonary hypertension. Circulation. 2004;109:159–165. doi: 10.1161/01.
CIR.0000102381.57477.50.
50. Schermuly RT, Ghofrani HA, Wilkins MR, Grimminger F. Mechanisms of
disease: pulmonary arterial hypertension. Nat Rev Cardiol. 2011;8:443–
455. doi: 10.1038/nrcardio.2011.87.
51. Long L, Yang X, Southwood M, Lu J, Marciniak SJ, Dunmore BJ, Morrell
NW. Chloroquine prevents progression of experimental pulmonary hypertension via inhibition of autophagy and lysosomal bone morphogenetic
protein type II receptor degradation. Circ Res. 2013;112:1159–1170. doi:
10.1161/CIRCRESAHA.111.300483.
52.Zhu J, Wang KZ, Chu CT. After the banquet: mitochondrial biogenesis, mitophagy, and cell survival. Autophagy. 2013;9:1663–1676. doi:
10.4161/auto.24135.
53. Koves TR, Li P, An J, Akimoto T, Slentz D, Ilkayeva O, Dohm GL, Yan
Z, Newgard CB, Muoio DM. Peroxisome proliferator-activated receptorgamma co-activator 1alpha-mediated metabolic remodeling of skeletal
myocytes mimics exercise training and reverses lipid-induced mitochondrial inefficiency. J Biol Chem. 2005;280:33588–33598. doi: 10.1074/jbc.
M507621200.
54. Ryan JJ, Marsboom G, Fang YH, Toth PT, Morrow E, Luo N, Piao L,
Hong Z, Ericson K, Zhang HJ, Han M, Haney CR, Chen CT, Sharp WW,
Archer SL. PGC1α-mediated mitofusin-2 deficiency in female rats and
humans with pulmonary arterial hypertension. Am J Respir Crit Care Med.
2013;187:865–878. doi: 10.1164/rccm.201209-1687OC.
Haslip et al Ucp2 in Mitophagy and Endothelium 13
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
55. Marsboom G, Toth PT, Ryan JJ, Hong Z, Wu X, Fang YH, Thenappan
T, Piao L, Zhang HJ, Pogoriler J, Chen Y, Morrow E, Weir EK, Rehman
J, Archer SL. Dynamin-related protein 1-mediated mitochondrial mitotic
fission permits hyperproliferation of vascular smooth muscle cells and
offers a novel therapeutic target in pulmonary hypertension. Circ Res.
2012;110:1484–1497. doi: 10.1161/CIRCRESAHA.111.263848.
56. Xu W, Erzurum SC. Endothelial cell energy metabolism, proliferation, and
apoptosis in pulmonary hypertension. Compr Physiol. 2011;1:357–372.
doi: 10.1002/cphy.c090005.
57.Warburg O. On respiratory impairment in cancer cells. Science.
1956;124:269–270.
58. Condello M, Caraglia M, Castellano M, Arancia G, Meschini S. Structural
and functional alterations of cellular components as revealed by electron microscopy. Microsc Res Tech. 2013;76:1057–1069. doi: 10.1002/
jemt.22266.
59. Kimura S, Noda T, Yoshimori T. Dissection of the autophagosome maturation process by a novel reporter protein, tandem fluorescent-tagged LC3.
Autophagy. 2007;3:452–460.
60.Waldeck-Weiermair M, Jean-Quartier C, Rost R, Khan MJ, Vishnu N,
Bondarenko AI, Imamura H, Malli R, Graier WF. Leucine zipper EF
hand-containing transmembrane protein 1 (Letm1) and uncoupling proteins 2 and 3 (UCP2/3) contribute to two distinct mitochondrial Ca2+
uptake pathways. J Biol Chem. 2011;286:28444–28455. doi: 10.1074/jbc.
M111.244517.
61. Levine B, Klionsky DJ. Development by self-digestion: molecular mechanisms and biological functions of autophagy. Dev Cell. 2004;6:463–477.
62. Mizushima N, Yamamoto A, Hatano M, Kobayashi Y, Kabeya Y, Suzuki
K, Tokuhisa T, Ohsumi Y, Yoshimori T. Dissection of autophagosome
formation using Apg5-deficient mouse embryonic stem cells. J Cell Biol.
2001;152:657–668.
63. Shi M, Zhang T, Sun L, Luo Y, Liu DH, Xie ST, Song XY, Wang GF,
Chen XL, Zhou BC, Zhang YZ. Calpain, Atg5 and Bak play important
roles in the crosstalk between apoptosis and autophagy induced by influx
of extracellular calcium. Apoptosis. 2013;18:435–451. doi: 10.1007/
s10495-012-0786-2.
64. Duval C, Nègre-Salvayre A, Dogilo A, Salvayre R, Pénicaud L, Casteilla
L. Increased reactive oxygen species production with antisense oligonucleotides directed against uncoupling protein 2 in murine endothelial cells.
Biochem Cell Biol. 2002;80:757–764.
65. Mannam P, Shinn AS, Srivastava A, et al. MKK3 regulates mitochondrial
biogenesis and mitophagy in sepsis-induced lung injury. Am J Physiol Lung
Cell Mol Physiol. 2014;306:L604–L619. doi: 10.1152/ajplung.00272.2013.
66.Chanakira A, Dutta R, Charboneau R, Barke R, Santilli SM, Roy S.
Hypoxia differentially regulates arterial and venous smooth muscle cell
proliferation via PDGFR-β and VEGFR-2 expression. Am J Physiol Heart
Circ Physiol. 2012;302:H1173–H1184. doi: 10.1152/ajpheart.00411.2011.
67.Fijalkowska I, Xu W, Comhair SA, Janocha AJ, Mavrakis LA,
Krishnamachary B, Zhen L, Mao T, Richter A, Erzurum SC, Tuder RM.
Hypoxia inducible-factor1alpha regulates the metabolic shift of pulmonary hypertensive endothelial cells. Am J Pathol. 2010;176:1130–1138.
doi: 10.2353/ajpath.2010.090832.
68. Sutendra G, Dromparis P, Bonnet S, Haromy A, McMurtry MS, Bleackley
RC, Michelakis ED. Pyruvate dehydrogenase inhibition by the inflammatory cytokine TNFα contributes to the pathogenesis of pulmonary arterial hypertension. J Mol Med (Berl). 2011;89:771–783. doi: 10.1007/
s00109-011-0762-2.
Significance
Our studies link endothelial cell uncoupling protein 2 to mitophagy/autophagy and mitochondrial biogenesis. In addition, we identified endothelial cell mitophagy as a critical, initiating event in the development of pulmonary hypertension. Moreover, we found that PTEN-induced
putative kinase 1 silencing reversed uncoupling protein 2 deficiency–induced pulmonary hypertension. Our studies also show that endothelial
cells from human pulmonary hypertension lungs exhibit changes in uncoupling protein 2-PTEN-induced putative kinase 1-mitochondrial
biogenesis that parallel our mouse studies, thus expanding the clinical relevance of these molecules as potential biomarkers and therapeutic
targets in pulmonary hypertension.
Downloaded from http://atvb.ahajournals.org/ by guest on June 15, 2017
Endothelial Uncoupling Protein 2 Regulates Mitophagy and Pulmonary Hypertension
During Intermittent Hypoxia
Maria Haslip, Iva Dostanic, Yan Huang, Yi Zhang, Kerry S. Russell, Michael J. Jurczak,
Praveen Mannam, Frank Giordano, Serpil C. Erzurum and Patty J. Lee
Arterioscler Thromb Vasc Biol. published online March 26, 2015;
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2015 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/early/2015/03/25/ATVBAHA.114.304865
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2015/03/26/ATVBAHA.114.304865.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Supplemental material
Ucp2
18S
Flox
VE-KO
CD45+
Flox
VE-KO
CD45- CD31
Flox
VE-KO
CD45- CD31+
Supplemental figure I. RT-PCR data for Ucp2 and 18S genes expression in cells isolated from VE-Ucp2KO and Flox mice.
Single cell suspensions were prepared from whole lungs and separated on autoMACS PRO after consecutive
incubations with CD45 and CD31 beads. Endothelial cells were selected as CD45 negative and CD31 positive fraction
(CD45-CD31+). Data demonstrate the absence of Ucp2 expression in the endothelial fraction.
A
B
C
D
Supplemental figure II. Apoptosis in endothelium assessed by TUNEL staining in lung sections from Flox and VE-KO mice
at baseline and after 5 weeks of IH. Original magnification of all photomicrographs: ×40. Blue – DAPI, Green – TUNEL
staining, Red – von Willebrand factor, an endothelial marker. A. Flox mice at room air. B. Flox mice after 5 weeks of IH. C.
VE-KO mice at room air. D. VE-KO mice after 5 weeks of IH. Arrows indicate merging of green and red fluorescence,
indicating apoptotic endothelium.
A
B
Supplemental figure III. Apoptosis in endothelium assessed by TUNEL staining in lung sections from Flox and VE-KO
mice after 1 week of IH. Original magnification of all photomicrographs: ×40. Blue – DAPI, Green – TUNEL staining,
Red – von Willebrand factor, an endothelial marker. A. Flox mice. B. VE-KO mice. Arrows indicate merging of green
and red fluorescence, indicating apoptotic endothelium.
A
B
*
*
*
*
*
PInk1
Parkin
Hsp60
Hsp60
WT
KO
ROOM AIR
WT
KO
INTERMITTENT HYPOXIA
WT
KO
ROOM AIR
*
C
*
WT
KO
INTERMITTENT HYPOXIA
*
LC3BI
LC3BII
WT
KO
ROOM AIR
WT
KO
INTERMITTENT HYPOXIA
Supplemental figure IV.Immunoblots of lung lysates for proteins associated with mitophagy/autophagy from WT and Ucp2 KO mice. A. Pink1
protein in the mitochondrial fraction of total lung lysates. B. Parkin protein in the mitochondrial fraction of total lung lysates. C. LC3BII/LC3BI
ratio in total lung lysates. *p<0.05
*
Supplemental figure V. Q-PCR data for RNA isolated from MLEC passage 3 to passage 8. Cellular senescence markers
p16 and p19 were evaluated. Data is presented as 2-ΔΔCt relative to 18S RNA at passage 3. n=4, *p<0.05
pAKT
AKT
Ucp2
Β actin
Control
15’-45’
5’-20’
6h
pAKT/AKT
Ucp2/B actin
*
0.3
0.25
3
0.2
2
0.15
1.5
0.1
1
0.05
0.5
0
control
15'-45'
5'-20'
*
2.5
6h
*
*
0
control
15'-45'
5'-20'
6h
Supplemental figure VI. A time course for chemical intermittent hypoxia in mouse lung endothelial cells and Ucp2 and
pAKT/AKT protein expressions analysed. Cells were incubated with CoCl2 containing media for 15 min followed
reoxygenation in normal media for 45 min (15’-45’) for 6 cycles or 5 min CoCl2 followed by 20 min reoxygenation (5’-20’)
for 6 cycles or 6 h of continuous CoCl2-containing media. *p<0.05 relative to control
pAKT
AKT
Ucp2
Β actin
Room Air
IH
pAKT Ser 473 in WT mice
1.2
*
Ucp2
2
Relative density to AKT
*
1.5
1
0.5
0
1
0.8
0.6
0.4
0.2
0
RA
IH
RA
IH
Supplemental figure VII. Protein expression in total mouse lung at room air and after 5 weeks of intermittent hypoxia
(IH). The time point for chemical IH in vitro was selected based on similarities of Ucp2 and AKT expression in cells and
lungs. *p<0.05
Ucp2 mRNA in MLEC
1.6
1.6
1.4
1.4
1.2
1.2
1
1
2-ddCt
2-ddCt
Pink mRNA in MLEC
0.8
0.8
0.6
0.6
0.4
0.4
0.2
0.2
0
0
sc siRNA
PINK siRNA
sc siRNA
Ucp2 siRNA
Supplemental figure VIII. mRNA silencing efficiency after simultaneous transfection with Ucp2 and Pink1
siRNAs. For control a double dose of scrambled siRNA (sc siRNA) was transfected. Experiments were run in
triplicate. Data is presented as 2-ΔΔCt for each mRNA relative to 18S and sc siRNA. Error bars represent modified
standard deviations for 2-ΔΔCt per Applied Biosystems guide.
Maria Haslip1, Iva Dostanic1, Yan Huang2, Yi Zhang1, Kerry S. Russell2, Michael J. Jurczak3,
Praveen Mannam1, Frank Giordano2, Lawrence Young2, Serpil C. Erzurum4 and Patty J. Lee1*.
Yale University School of Medicine, 1Section of Pulmonary, Critical Care and Sleep Medicine,
2
Section of Cardiovascular Disease, 3Section of Endocrinology and Metabolism, Yale University
School of Medicine, New Haven, CT, 4Lerner Research Institute and Respiratory Institute,
Cleveland Clinic, Cleveland, Ohio.
Materials and Methods.
Materials.
CoCl2 was purchased from Sigma Aldrich (St. Louis, MO), CCCP (carbonyl cyanide m-chloro
phenyl hydrazone) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA),
MitoTracker Green FM (M7514), MitoSox Red (M36008) and MitoTracker® Red CMXRos
(M7512), DMEM/F15, OptiMEM media, Penicillin/Steptomycin and TripLE cell dissociation
reagent were purchased from Life Technologies (USA). BAPTA-AM was purchased from Abcam
(Cambridge, USA). FuGene6 was purchased from Promega (Madison, WI). FITC AnnexinV
Apoptosis Detection kit (#556547) was from BD Pharmingen (San Diego, CA). In Situ Cell
Death Detection kit was from Roche Diagnostics (Indianapolis,USA). EDTA-free protease
inhibitor tablets were from Roche Diagnostics (Mannheim, Germany). BCA protein assay, RIPA
lysis buffer and Super Signal Femto Chemiluminescence detection kit were from Thermo
Scientific (Rockford, IL). Precast protein Tris-HCl gels, Trans Blot Turbo Transfer system and
PVDF containing Trans Blot Turbo Transfer kit were purchase from BioRad Laboratories
(Hercules, CA). EBM-2 bullet kit for human endothelial cells was purchased from Lonza
(Cologne, Germany), fibronectin was from Calbiochem (San Diego, CA). Nucleofector
transfection kit for primary endothelial cells was purchased from Lonza (Cologne, Germany). All
restriction endonucleases were purchased from New England Biolabs, Ipswich, MA, USA.
Antibodies used in this study were purchased from Santa Cruz Biotechnology (Santa Cruz, CA):
β actin (sc-47718), HSP60 N-20 (sc-1052), PGC1α (sc-sc-13067); Cell Signaling Technology
(Beverly, MA); LC3B (#2775); Parkin (#4211); Pink1 (AM6406a and Atg5 (AP1812a) were from
Abgent (San Diego, CA). Antibodies for FACS were purchased from ED Biosciences. von
Willebrand Factor (vWF) antibodies were purchased from DAKO (Carpinteria,CA,USA).
Secondary antibodies for immiunofluorescence (donkey anti-rabbit Alexa Fluor 555) were
purchased from Life Technologies (USA).
Pink1 (sc-44599) and Ucp2 (sc-42683) siRNA were purchased from Santa Cruz Biotechnology
(Santa Cruz, CA). scrambled (sc) siRNA was from .TransIT-TKO transfection reagent (#MIR
2150) was purchased from Mirus Bio LLC (Madison, WI). ptfLC3 plasmid (#21074) was
purchased from Addgene (Cambridge, MA). MT-mKeima-Red (AM-V0251) was from Medical
and Biological Laboratories International (Way Woburn, MA). pcDNA6.2-GW/EGFP-miR
plasmid for lentivirus construction was from Invitrogen, Grand Island, NY, USA.
Animals.
Ucp2 KO mice were obtained from Dr. Tamas Horvath (Yale University, New Haven, CT, USA).
Wild type littermates were used as control mice. Animal experiments performed in this study
were approved by the Institutional Animal Care and Use Committee of Yale University.
Ucp2 Flox mice were provided by Dr. Bradford Lowell (Harvard Medical School, MA, USA).
Endothelial Ucp2 knockout mice (Ucp2 VE-KO) were created by crossing Ucp2 Flox (Ucp2 Flox)
(1) mice with mice containing VE-cadherin gene driving Cre recombinase (Jackson
Laboratories, Maine).
Intermittent Hypoxia.
10 week old Flox and VE-KO mice were placed into a plexiglass chamber connected to
OxyCycler Models A420OC and AT42CO (BioSpherix, NY, USA). Intermittent Hypoxia (IH) was
run for 1 or 5 weeks according to previously published with slight modifications: O2 nadir=5%, 6
min cycles, 10h/day (2). Age matched VE-KO and Flox mice were kept in room air as controls.
Both groups of mice were fed a standard rodent chow and had free access to water. During the
IH exposure, systemic blood pressure was measured weekly in the IH and room air control
groups using CODA2 (Kent Scientific Corp.) mouse tail cuff system as previously described (3,
4). After 1 or 5 weeks mice were subjected to right ventricular systolic pressure (RVSP)
measurements, and euthanized. Hearts were harvested, the right ventricle was dissected from
left ventricle and septum. Subsequently, both parts were weighed and RV/(LV+S) ratio was
calculated. Lung sections were preserved for protein and RNA analyses.
Verification of endothelial Ucp2 knockdown in VE-KO Ucp2 mice.
Endothelial (CD31+, CD45−) and cells were isolated using Miltenyi Biotec magnetic columns or
Dynabead Tosyl–activated Dynabeads and the autoMACS pro system using manufacturersupplied antibodies, according to the manufacturers’ instructions. Lungs were harvested from
mice, sliced to small pieces in PBS buffer on ice, and filtered through 70-µm nylon meshes to
make a single cell suspensates. Cell labeling with magnetic antibodies and cell separation were
performed according to the manufacturers’ instructions. Total lung cell suspensates were first
depleted of CD45+ cells and then positively selected for CD31+ cells. Each cells’ subfraction was
dissolved in TRIZOL buffer and RNA was isolated. qPCR with Ucp2 specific primers (5) and
18S primers (6) for as a reference gene was performed for each group of cells, such as CD45+,
CD45−/CD31+, and CD45−/CD31+.
RVSP measurements.
Mice were anesthesized with ketamine (100 mg/kg body weight) and xylazine (5 mg/kg) by
intraperitoneal injection. Mice were then intubated, placed on positive pressure ventilation and
light anesthesia maintained by inhaled isofluorane. A 1.9 French transducer tipped catheter
(Millar Inc., Houston, TX) was inserted into right jugular vein and then advanced into the right
ventricle for measurement of RVSP, positive and negative dp/dt. Data were recorded on a
PowerLab instrument (ADInstruments) and analyzed using Chart 5 Pro software
(ADInstruments).
Cell culture.
Mouse Lung Endothelial Cells (MLEC) were isolated from C57Bl6 mice as we previously
reported (7). Cells were maintained at 37°C/5% CO2 in F15/DMEM containing 100 IU/ml
penicillin, 100 µg/ml streptomycin and 20% FBS. Chemical hypoxia “CoCl2 IH” was used to
simulate IH in vitro (8). Cellular intermittent hypoxia model consisted of 6 cycles of 5 min
hypoxia with 500μM CoCl2 followed by 20 min reoxygenation with regular cell media. After the
6th reoxygenation cells were harvested on ice. Room air control cells were subjected to similar
media changes, but without CoCl2.
For calcium chelator experiments cells were incubated with 1uM BAPTA-AM.
Pulmonary artery endothelial cells (PAEC) from four PH patients and four healthy donors were
obtained from Dr. Serpil Erzurum (9, 10). Cells were grown in endothelial basal medium on
1mg/ml fibronectin-coated tissue culture dishes according to manufacturer’s instructions. Cells
were harvested and lysates were used for protein immunolottings.
Ucp2 and Pink1 siRNA transfection.
MLEC were plated into 6 well plates overnight to reach 60% confluence. The next morning cells
were transfected using TransIT-TKO siRNA transfection reagent according to manufacturer
protocol. Briefly, 250 mL of OptiMEM media was combined with 80pg of siRNA and 8 μL of
TransIT-TKO reagent in sterile 1.5 mL tube, and incubated for 25 min. After the incubation, the
mix was added to each well containing MLEC with 1.5 mL cellular media. Optimal transfection
time was detected 48 hours later.
Apoptosis assessment.
Apoptosis assessments in MLEC were performed with FACS Calibur machine using FITC
Annexin V Apoptosis Detection kit. Briefly, cells were harvested and labeled with FITC annexin
V and propidium iodide antibodies for 15 min at room temperature. FACS analysis was
performed using FL-1 and FL-2 channels on Calibur FACS machine (BioRad Laboratories, CA).
Final data are presented as a % of Annexin V positive cells.
Apoptosis assessments in mouse lung were performed using in situ cell death detection kit
according to manufacturer’s instructions with slight modifications. Briefly, paraffin-fixed lung
sectiones were dewaxed and hydrated, and target retrieval was performed by microwaving
samples in Citrate retrieval buffer (DAKO, Carpinteria, Ca, USA) on high power (750W) for 1
min. Slides were cooled down for 20 min and immersed in serum-free blocking solution (DAKO,
Carpinteria, Ca, USA) for 30 min. Anti-vWF specific antibodies were diluted in the same bloking
solution 1:500 and the mix was applied on slides, and incubated overnight in humidifying
conditions at 4 C. Next day slides were washed twice with 1xPBS and TUNEL mix was applied
for 1h at 37C in humidifying conditions. Secondary antibodies (Alexa Fluor 555) were diluted
1:300 in PBS and added to slides for another 1h of incubation at room temperature. Slides were
washed twice with PBS, mounted with DAPI containing mounting media(Vector Laboratories,
Inc, Burlingame, CA, USA) and observed under fluorescent microscope Eclipse Ti fluorescent
microscope using a ×40 lens.
Mitochondrial mass, mitochondrial ROS and mitochondrial potential assessment in MLEC.
Mitochondrial mass was detected with MitoTracker Green FM kit using FACS Calibur machine
at channel FL-1 according to manufacturer protocol.
Mitochondrial potential was assessed with MitoTracker® Red CMXRos kit using FACS Calibur
machine at channel FL-4 according to manufacturer protocol. Final data are presented as a
percent of WT MLEC mitochondrial potential readings.
Mitochondrial ROS were detected with MitoSox Red kit using FACS Calibur machine at
channel FL-3 according to manufacturer protocol. Data are presented as a ratio to MLEC
transfected with sc siRNA at room air.
Mitochondrial mass and mitochondrial potential assessment in endothelial cells isolated from
fresh mouse lungs.
Lungs were perfused with PBS through right ventricle, removed from mice and preserved in cold
RPMI media. Two large lobes from the right lung were chopped with a sterile razor in RPMI
media on ice and single cell suspension was prepared. The suspension was filtered through
100μM filter and 70 μM filters, and centrifuged at 300g for 10 min at 4C. Cells were washed
once with 3ml of PBS with 1% BSA and counted on Beckman Coultier Cell Counter. One million
cells were incubated in RPMI media with CD45-PE antibodies (1:1000 dilution), CD31-APC (1:
500 dilution), MitoTracker Green and MitoTracker® Red CMXRos dyes (1:2000 dilution) for 30
min at 37C. After the incubation cells were washed once with 3ml of PBS with 1% BSA,
resuspended in 500 μL of PBS with 1% BSA, and pallied for FACS separation on Calibur FACS
machine. MitoTracker Green was detected at FL-1 channel, CD45-PE labeled cells were
detected at FL-2 channel, MitoTracker® Red CMXRos was detected at FL-3, and CD31-APC
labeled cells were at FL-4 channel. Unlabeled and single dye labeled cells from Flox lung were
used to set up necessary compensations for all the channels. Mitochondrial mass and
mitochondrial potential were detected on CD45 negative / CD31 positive cells.Data is presented
as a percent of Flox cells.
Mitochondrial isolation.
Frozen small lung lobe was homogenized in 500 uL ice-cold homogenization buffer containing
100 mM sucrose, 180 mM KCl, 10 mM EDTA, 5 mM MgCl2, 50 mM Tris/HCl, pH 7.4, and
protease inhibitor cocktail. The homogenate was centrifuged at 1000 g for 5 min at 4 °C. The
supernatant was saved and centrifuged at 11000 g for 15 min at 4 °C. The pellet containing
mitochondrial was dissolved in 60-80 uL RIPA buffer containing protease inhibitor cocktail.
Measurement of Autophagic Flux
Autophagic flux was assessed by transfection with ptfLC3 plasmid (11). MLEC were transfected
with ptfLC3 plasmid as well as Ucp2 and/or Pink1 siRNA using FuGene6 transfection reagent
and subjected to chemical hypoxia 48 hours later. Cells were imaged with a Nikon Eclipse Ti
fluorescent microscope using a ×40 lens. The numbers of GFP and RFP positive cells were
counted for each experimental condition.
Measurement of mitophagy flux.
Mitophagy was evaluated by transfection with MT-mKeima-Red plasmid (12, 13). MLEC were
simultaneously transfected with MT-mKeima-Red plasmid, Ucp2 and /or Pink1 siRNA using
program T-023 on Amaxa Nucleofector system (Lonza, Cologne, Germany) with Basic
Endothelial Cells Nucleofector® Kit. 48 hours later cells were subjected to chemical hypoxia,
media was replaced by phenol-free DMEM and fluorescence was read at 444nm
excitation/612nm emission and 544nm excitation/612nm emission using XS Gemini. A
544nm/444nm wavelength ratio was used to evaluate mitophagy flux.
Construction of lentiviral vectors
Lentivirus miRNA vectors with a ubiquitin promoter have been described previously (14). To
silence mouse Pink1 expression in vivo, target site 1283–1303 (GenBank accession
AB053476.1) was used to design Pink1 miRNA. This target sequence is 5’GTGCGGTAATTGACTACAGCA-3’. Invitrogen’s RNAi Designer acted as an online tool to
design pre-miRNA sequences. Two oligos, 5’TGCTGTGCTGTAGTCAATTACCGCACGTTTTGGCCACTGACTGACGTGCGGTATGACTACA
GCA -3’ and 5’CCTGTGCTGTAGTCATACCGCACGTCAGTCAGTGGCCAAAACGTGCGGTAATTGACTACA
GCAC-3’ were annealed and ligated into pcDNA6.2-GW/EGFP-miR to generate Pink1 miRNA
according to the manufacturer’s instructions. The lentiviral construct of EGFP-Pink1 miRNA was
constructed by first amplifying the fragments from pcDNA6.2-GW/EGFP-Pink1 miRNA with
primers: sense: 5'-AGGCGCGCCTGGCTAACTAGAGAAC-3' and antisense: 5'GGAATTCTATCTCGAGTGCGGC-3'. The EGFP-Pink1 miRNA was recovered from the PCR
fragment by AscI and EcoRI digestion and then inserted into the AscI and EcoRI sites of FUW
to generate lenti-Pink1 miRNA. Lenti- NC have been described previously (14). The endothelialspecific Pink1 miRNA lentiviral construct has been described previously (15).
Intranasal administration of Pink1 miRNA lentivirus.
Intranasal administration of either the lenti-Pink1 miRNA or lenti-control was performed on 10
weeks old Ucp2 KO mice and WT littermate mice using 1x108 TU/mouse as previously
described (14). Mice received intranasal treatment 1 week before IH experiment.
Western blotting.
Lung protein analyses were performed according to Zhang et al. (14). Whole lung tissues and
cell pellets were homogenized in RIPA lysis buffer containing protease inhibitors. The protein
concentrations of the lysates were determined by BCA Protein Assay. Samples were
electrophoresed in a 4-20% ready-made Tris-HCl gel and transferred onto a PVDF membrane
using Trans Blot Turbo transfer system. Membranes then were incubated overnight at 4C with
primary antibodies. HRP-conjugated secondary antibodies incubation followed by the detection
of signal with a Super Signal Femto chemiluminescence detection kit was used.
Statistics.
Data were represented as mean ± SD. Comparison of two groups was by 2-tailed Student’s ttest. Multiple group comparisons were performed using ANOVA F-test with Tukey’s post hoc
test of means. Mean values were considered different at p<0.05.
References
1.
Kong D, Vong L, Parton LE, Ye C, Tong Q, Hu X, Choi B, Bruning JC, Lowell BB.
Glucose stimulation of hypothalamic mch neurons involves k(atp) channels, is modulated by
ucp2, and regulates peripheral glucose homeostasis. Cell Metab;12:545-552.
2.
Campen MJ, Shimoda LA, O'Donnell CP. Acute and chronic cardiovascular effects of
intermittent hypoxia in c57bl/6j mice. J Appl Physiol (1985) 2005;99:2028-2035.
3.
Sutendra G, Bonnet S, Rochefort G, Haromy A, Folmes KD, Lopaschuk GD, Dyck JR,
Michelakis ED. Fatty acid oxidation and malonyl-coa decarboxylase in the vascular remodeling
of pulmonary hypertension. Sci Transl Med;2:44ra58.
4.
Sutendra G, Dromparis P, Bonnet S, Haromy A, McMurtry MS, Bleackley RC, Michelakis
ED. Pyruvate dehydrogenase inhibition by the inflammatory cytokine tnfalpha contributes to the
pathogenesis of pulmonary arterial hypertension. J Mol Med (Berl);89:771-783.
5.
Joseph JW, Koshkin V, Zhang CY, Wang J, Lowell BB, Chan CB, Wheeler MB.
Uncoupling protein 2 knockout mice have enhanced insulin secretory capacity after a high-fat
diet. Diabetes 2002;51:3211-3219.
6.
Sheydina A, Volkova M, Jiang L, Juhasz O, Zhang J, Tae HJ, Perino MG, Wang M, Zhu
Y, Lakatta EG, et al. Linkage of cardiac gene expression profiles and ets2 with lifespan
variability in rats. Aging Cell;11:350-359.
7.
Zhang X, Shan P, Jiang G, Cohn L, Lee PJ. Toll-like receptor 4 deficiency causes
pulmonary emphysema. J Clin Invest 2006;116:3050-3059.
8.
Kim KS, Rajagopal V, Gonsalves C, Johnson C, Kalra VK. A novel role of hypoxiainducible factor in cobalt chloride- and hypoxia-mediated expression of il-8 chemokine in human
endothelial cells. J Immunol 2006;177:7211-7224.
9.
Xu W, Koeck T, Lara AR, Neumann D, DiFilippo FP, Koo M, Janocha AJ, Masri FA,
Arroliga AC, Jennings C, et al. Alterations of cellular bioenergetics in pulmonary artery
endothelial cells. Proc Natl Acad Sci U S A 2007;104:1342-1347.
10.
Comhair SA, Xu W, Mavrakis L, Aldred MA, Asosingh K, Erzurum SC. Human primary
lung endothelial cells in culture. Am J Respir Cell Mol Biol;46:723-730.
11.
Kimura S, Noda T, Yoshimori T. Dissection of the autophagosome maturation process
by a novel reporter protein, tandem fluorescent-tagged lc3. Autophagy 2007;3:452-460.
12.
Kogure T, Karasawa S, Araki T, Saito K, Kinjo M, Miyawaki A. A fluorescent variant of a
protein from the stony coral montipora facilitates dual-color single-laser fluorescence crosscorrelation spectroscopy. Nat Biotechnol 2006;24:577-581.
13.
Katayama H, Kogure T, Mizushima N, Yoshimori T, Miyawaki A. A sensitive and
quantitative technique for detecting autophagic events based on lysosomal delivery. Chem
Biol;18:1042-1052.
14.
Zhang Y, Jiang G, Sauler M, Lee PJ. Lung endothelial ho-1 targeting in vivo using
lentiviral mirna regulates apoptosis and autophagy during oxidant injury. FASEB J 2013.
15.
Zhang Y, Sauler M, Shinn AS, Gong H, Haslip M, Shan P, Mannam P, Lee PJ.
Endothelial pink1 mediates the protective effects of nlrp3 deficiency during lethal oxidant injury.
J Immunol;192:5296-5304.