Proceedings, The 15th Congress of FAVA
FAVA - OIE Joint Symposium on Emerging Diseases
27-30 October
Bangkok, Thailand
Cloning of 3ABC Gene of Thai Foot and Mouth Disease Virus Type O
Isolatein E. coli
K. Marupanthorn1, A. Nunthaprasert1
1
Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand
*Corresponding author
Keywords : 3ABC gene, E. coli, Foot and Mouth disease virus type O, Pigs, Thai
vector, the amplified 3ABC gene fragment was
cloned into pChampionTM pET Directional TOPO®
Expression vector following manufacture instruction
(Invitrogen, USA) and the positive clones were
confirmed by PCR and DNA sequencing. The
second expression vector, the amplified 3ABC gene
fragment was cloned into pENTRTM/TEV/D-TOPO®
directional TOPO® vector following manufacture
instruction (Invitrogen, USA) and the positive clones
were detected by PCR and DNA sequencing. The
pENTR clones from individual bacterial colonies
were then transferred into pDEST17 vector
(Invitrogen, USA) by site-specific recombination
according to the instruction of the manufacturer
(Invitrogen, USA), the positive clones were
analyzed by PCR and DNA sequencing. The
expression of two bacterial expression vectors will
be further study and compare.
Introduction
Foot and mouth disease (FMD) is a highly
contagious and devastating disease that causes
significant financial losses, which requires rapid
diagnosis for disease control measures to be
effective. Among the viral proteins induced by Foot
and mouth disease virus (FMDV) infection, four
proteins (VP1–4) are the major subunit of viral
capsid. Although the other proteins like L, 2A–C
and 3A–D are not part of capsid structure (Nonstructural proteins; NSPs), they also induce antibody
responses in infected animals (4, 5).
Many diagnostic tests have been developed to
distinguish infected animals from those that have
been vaccinated against of FMD virus, all based on
the detection of antibodies to the NSPs especially in
3ABC gene (1). Recently, there have been many
FMD type O outbreaks reported in Thailand (3). In
this study, we cloned 3ABC gene of FMDV type O
from a Thai isolate into E. coli. The sequence data of
the 3ABC gene and their expression will be further
investigation. These recombinant proteins maybe
useful for the exploration of the possibility to
develop the low cost and specific ELISA test kit for
detection of antibody to FMDV infected pigs in
Thailand.
Results and Discussion
The vesicular fluid samples were detected with
FMDV Type O by multiplex PCR at the molecular
weight of 1301 bp. (Fig. 1). The PCR products of
3ABC gene of FMDV type O from those samples
were successfully amplified at the molecular weight
of 1303 bp (Fig. 2). Then, these gene products from
PCR analysis at the molecular weight of 1303 bp
were successfully transferred into the pET
160/GW/D-TOPO®
vector
(Fig.
3),
the
pENTRTM/TEV/D-TOPO®
directional
TOPO®
vector (Fig. 4) and the pDEST 17 vector (Fig. 5),
respectively. The sequences data will be confirmed
and analyzed. The expression, purification and
reactivity with monoclonal antibody or sera from
FMDV infected pigs of 3ABC recombinant proteins
will be further characterization.
Materials and Methods
Viral RNA was isolated using Viral RNA extraction
kit from vesicular fluid samples following
manufacturer instructions (Qiagen, Germany). The
viral RNA was transcribed to cDNA using
Omniscript RT kit (Qiagen, Germany). The
confirmation of vesicular fluid from FMDV type O
infected pigs was performed by using multiplex PCR
with three specific PCR primer sets that based on the
sequences from highly conserved region within VP1
and VP3 of FMD viral genome (2) (Table 1). The
condition of multiplex PCR was 40 cycles of 60 s
90°C, 60 s 50°C and 90 s 72°C. Then, the complete
gene encoding for the 3ABC protein was amplified
using PCR. Primers targeting a 1303-bp fragment of
the 3ABC gene were designed and located at
positions 5371-5390 and 6655-6674 of the published
sequence of FMDV strain Tibet/CHA/99
(AJ539138; Genbank) (Table 2). The condition of
PCR was 40 cycles of 60 s 94°C, 60 s 55°C and 90 s
72°C. These 3ABC genes were further cloned into
two kinds of bacterial expression vectors,
pChampionTM pET Directional TOPO® Expression
vector and pDEST 17 vector. The first expression
References
1 Clavijo et al., 2004. J. Virol. Methods 120: 217227.
2 Knowles and Samuel, 1998. RT-PCR and
Sequencing Protocols for the Molecular
Epidemiology of Exotic
Virus Diseases of Animals. Pirbright : Institute
for Animal Health 37.
3 Linchongsubongkoch, 2003. Proc. 11th
ISWAVLD and OIE seminar on biotechnology:
9-15.
4 Lubroth et al., 1995. Res. Vet. Sci. 59: 70-78.
5 Rodriguez et al., 1994. Arch. Virol. 136: 123131.
P101
Proceedings, The 15th Congress of FAVA
FAVA - OIE Joint Symposium on Emerging Diseases
27-30 October
Bangkok, Thailand
Table 1 The primers use in multiplex PCR for
FMDV type detection (F: Forward primer, R:
Reward primer)
Primer
designation
Primer sequence (5’- 3’)
O-1C124-F
ACCAACCTCCTTGATGTGGCT
1301
A-1C562-F
TACCAAATTACACACGGGAA
863-866
Asia1-1C505-F
TACACTGCTTCTGACGTGGC
908-914
NK 61-R
GACATGTCCTCCTGCATCTG
M
3ABC-F
CACCCAATTCCTTCCCAAAAG
GCT
3ABC-R
GTGGTGTGG TTCGGGGTCAA
Fig. 3 PCR analyzing positive clones of 3ABC gene
in pChampionTM pET Directional TOPO®
Expression vector . Lanes, M: marker 1 kbp ladder
(Promega, USA), 2, 4, 6, 8 and 10: positive
transformants of 3ABC gene (1303 bp), 1, 3, 5, 7
and 9: negative transformants of 3ABC gene.
Product
length (bp)
1303
M 1
M 1 2 3 4 5 6 7 8 9 10
1400 bp
1400 bp
1200 bp
1303 bp
1301 bp
1000 bp
1000 bp
Fig. 4 PCR analyzing positive clones of 3ABC gene
in pENTRTM/TEV/D-TOPO® directional TOPO®
vector . Lanes : M : Lanes, M: marker 100 bp plus
ladder (Fermentas, Canada), 1 - 10: positive
transformants of 3ABC gene (1303 bp)
Fig. 1 PCR analyzing of FMD field isolate virus
type O gene from vesicular fluid. Lanes, M: marker
100 bp plus ladder. (Fermentas, Canada), 1: positive
sample from vesicular fluid
M
1
M 1 2 3 4 5 6
1400 bp
7 8 9 10
1303 bp
1200 bp
1400 bp
1200 bp
3 4 5 6 7 8 9 10 M
1300 bp
1000 bp
Table 2 The primers use for FMDV type O 3ABC
gene amplification by PCR
Primer sequence (5’- 3’)
2
1303 bp
Product
length(bp)
Primer
designation
1
1303 bp
1000 bp
1000 bp
Fig. 2 PCR analyzing of complete gene encoding for
the 3ABC protein from vesicular fluid. Lanes, M:
marker 100 bp plus ladder (Fermentas, Canada), 1:
3ABC gene from vesicular fluid
Fig. 5 PCR analyzing positive clones of 3ABC gene
in pDEST17 vector . Lanes, M: marker 100 bp plus
ladder (Fermentas, Canada), 1-1: positive
transformants of 3ABC gene (1303 bp)
P102