“Root morphology of rice through bipartite interaction involving Trichoderma spp. influencing adaptation of plants to abiotic stress and in-silico analysis of root related QTLs” M. Sc. (Ag.) THESIS by SHINDE UMESH DNYANESHWAR DEPARTMENT OF PLANT MOLECULAR BIOLOGY AND BIOTECHNOLOGY COLLEGE OF AGRICULTURE INDIRA GANDHI KRISHI VISHWAVIDYALAYA RAIPUR, (C.G.) 2014 “Root morphology of rice through bipartite interaction involving Trichoderma spp. influencing adaptation of plants to abiotic stress and in-silico analysis of root related QTLs” Thesis Submitted to the Indira Gandhi Krishi Vishwavidyalaya, Raipur by SHINDE UMESH DNYANESHWAR IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science in Agriculture (Plant Molecular Biology and Biotechnology) Roll. No.15583 ID No. 120112023 JULY, 2014 List of Abbreviation % - per cent ˚c - Degree centigrade °C - degree Celsius µl - Microlitre ACC - 1- aminocyclopropane-1-carboxylic acid ADW - Autoclaved Distilled Water AFLP - amplified fragment length polymorphism AM - Association mapping ANOVA - Analysis of variance BAC - Bacterial artificial chromosome BCA - Biocontrol agents Bp - base pair CAS - chromo azurol S solution Cm - Centi meter cM - centi morgan CMA - chloromolybdic acid CTAB - Cetryl trimethyl bromide DNA - Deoxyribonucleicacid dNTPs - deoxynucleotide triphosphates DR - Deep rooting EBA - Extraction buffer A EBB - Extraction buffer B EDTA - ethylenediamine tetra acetic acid et al. - and others gm - Gram GGT - Graphical genotyping H2O - Water HCl - hydrochloric acid HRPS - Higher root pulling strength i.e. - that is IAA - Indole Acetic Acid KCl - potassium chloride LWP - Leaf water potential M - Molar Mg - milligram MgCl2 - magnesium chloride Ml - Milliliter mM - milli molar NaCl - sodium chloride Ng - Nanogram OD - Optical density P - Phosphate PAGE - polyacrylamide gel electrophoresis PCR - polymerase chain reaction PDA - Potato Dextrose Agar PDB - Potato Dextrose Broth PGPR - Plant growth promoting response PRDW - Penetrated root dry weight QTL - Quantitative trait loci RFLP - restriction fragment length polymorphism RL - Root length Rpm - revolutions per minute RPS - Root pulling strength RV - Root volume SL - Shoot length SMA - Single marker analysis SSR - Simple sequence repeats TAE - tris acetic acid EDTA buffer TE - tris EDTA buffer TRN - Total root number TSM - Trichoderma Selective Media CHAPTER –I INTRODUCTION The need for increasing agricultural productivity and quality has led to an excessive use of chemical fertilizers, creating serious environmental pollution. The use of biofertilizers and biopesticides is an alternative for sustaining high production with low ecological impact. Different soil-borne bacteria and fungi are able to colonize plant roots and may have beneficial effects on the plant. Besides the classic mycorrhizal fungi and Rhizobium bacteria, other plant-growth-promoting rhizobacteria (PGPR) and fungi such as Trichoderma spp. and Piriformospora indica can stimulate plant growth by suppressing plant diseases (Van Wees et al., 2008). These micro-organisms can form endophytic associations and interact with other microbes in the rhizosphere, thereby influencing disease protection, plant growth and yield. Every plant part have unique function as they performed in that the plant root have a large range of functions, including acquisition of water and nutrients, as well as structural support. Dissecting the genetic and molecular mechanisms controlling rice root development is critical for the development of new rice ideotypes that are better adapted to adverse conditions and for the production of sustainably achieved rice yield potential. Most knowledge regarding the gene networks involved in root development has been accumulated in the model dicotyledon plant species Arabidopsis thaliana. Rice, the model monocotyledon species, presents several singularities compared to Arabidopsis thaliana, including a root architecture characterized by a fibrous root system comprising five types of embryonic and postembryonic roots. For instance, a deep, thick, and branched root system is correlated with better survival under adverse conditions, such as water or nutrients 1 deficits and this can be beneficial for development of sustainable agriculture. The structure of root system is determined by an endogenous genetic programme as well as by external environmental factors, including biotic and abiotic stresses. The high adoptive plasticity of root development complicates the genetic dissection of gene controlling root structure variation and represents bottleneck for efficient selection of specific root ideotypes. A significant progress in evaluating root morphology has been observed in the last years. Despite, root research as a whole still remains challenging and costly. Image analyses systems provide an opportunity to facilitate analyzing procedure. They offer a rapid assessment of root characteristics like length and surface area, diameter and tips, root branching patterns, etc. Root length and surface area are important indicators for a potential uptake of water and nutrients. Root diameter respective radius is one of the most important input parameters for rhizosphere modeling. Various image analyses techniques are already used for the estimation of root parameters. Early recognition of the importance of roots for drought resistance, and the diversity in rice root architecture, provided a strong foundation for drought research at the International Rice Research Institute (IRRI). IRRI was founded in 1960, and large efforts for research on root growth in response to drought were ongoing by the mid-1970s, with an emphasis on deep root growth, formation of coarse nodal roots, and the root pulling force method. In the 1980s, aeroponic studies on root morphology and anatomy and line-source sprinkler field studies were commonly conducted. The use of crosses to better understand the genetics of root traits started in the 1980s. Further characterization of the genetics behind root traits was conducted in the 1990s, specifically the use of molecular markers to select for root trait QTLs. A shift toward rainfed lowland experiments in addition to upland 2 conditions began in the 1990s, with increased recognition of the different types of drought stress environments and characterization of root water uptake. In the 2000s, drought breeding efforts moved from selection of root traits to direct selection for yield under drought. Today we have identified two major drought-yield QTLs to be related to root traits, and phenotyping for association mapping of genes related to root traits and functions. After direct selection for yield during the past decade that is now approaching impact at the farm level, we are seeing that root traits are indeed involved in improved yield under drought. Early reports indicated that droughttolerant upland varieties typically showed “long and thick” root systems (Chang and Vergara 1975). This root ideotype of long/deep and thick (large diameter nodal) roots remained the target drought/root phenotype for about the next four decades at IRRI. However, it was also recognized that although upland varieties typically showed deeper roots and could avoid drought, they were not as tolerant of stress as lowland varieties. Of all the root techniques used at IRRI during the 1970s, perhaps the most distinct was “root pulling force”, in which individual hills were vertically pulled out of the soil, and the force required to do so was reported to be correlated with root growth. Other root measurements in the field included core sampling coupled with the use of photographs to estimate total root length. Both vertical and lateral root distribution were assessed, and the need for uniformity of field soil was emphasized for root studies. The fungal pathogens play a major role in the development of diseases on many important field and horticultural crops; resulting in severe plant yield losses. Intensified use of fungicides has resulted in accumulation of toxic compounds potentially hazardous to humans and environment and also in the buildup of resistance of the pathogens. In order to tackle these national and global problems, effective 3 alternatives to chemical control are being employed (Rossman et. al., 1999). Biological control is a nature friendly approach that uses specific microorganisms, which interfere with plant pathogens and pests to overcome the problems caused by chemical methods of plant protection. Commercial preparations of plant disease biocontrol agents are based on the practical application of rhizosphere competent species of bacteria or fungi. Fungi in the genus Trichoderma are among the most promising biocontrol agents against plant pathogenic fungi. They show high level of genetic diversity, and can be used to produce a wide range of products of commercial and ecological interest. Trichoderma has gained immense importance since last few decades due to its biological control ability against several plant pathogens. Fungal species belonging to the genus Trichoderma are worldwide in occurrence and easily isolated from soil, decaying wood, and other forms of plant organic matter (Howell, 2003). They are classified as imperfect fungi, in that they have no known sexual stage. Rapid growth rate in culture and the production of numerous spores (conidia) that are varying shades of green characterize fungi in this genus (Howell, 2003). The reverse side of colonies is often uncoloured, buff, yellow, amber, or yellow-green, and many species produce prodigious quantities of thickwalled spores (chlamydospores) in submerged mycelium (Gams, and J. Bisset, 1998). The role of microorganisms in plant growth promotion, nutrient management and disease control is well known. These beneficial microorganisms colonize the rhizosphere/ endorhizosphere of plants and promote growth of the plants through various direct and indirect mechanisms (Saxena et al. 2005). However, of late, the role of microbes in management of biotic and abiotic stresses is gaining importance. The subject of PGPR elicited tolerance to abiotic stresses has been reviewed recently (Venkateswarlu et al. 2008; Yang et al. 2009). The term Induced Systemic Tolerance 4 (IST) has been proposed for PGPR-induced physical and chemical changes that result in enhanced tolerance to abiotic stress. Plant growth can also best imulated by PGPR that produce1-aminocyclopropane-1-carboxylate (ACC) deaminase, which cleaves ACC, the immediate precursor of the plant hormone ethylene, to produce αketobutyrate and ammonia (Todorovic & Glick, 2008). Ethylene is an important signaling molecule in plants under pathogen attack or abiotic stresses and results in plant growth inhibition (Abels et al., 1992). Inoculation of plants with PGPR producing ACC deaminase (ACCD) lowers ethylene levels, which results in longer roots and decreased inhibition of plant growth following environmental or pathogeninduced stress (Glick et al., 1998, 2007; Farwell et al., 2007). Microorganisms could play a significant role in stress management, once their unique properties of tolerance to extremities, their ubiquity, and genetic diversity are understood and methods for their successful deployment in agriculture production are developed. The development of molecular markers for the detection and exploitation of DNA polymorphisms in plant systems is one of the most significant developments in the field of molecular biology and biotechnology. Its high resolution is accounted for by the historical recombination accumulated in natural populations and collections of landraces, breeding materials and varieties. The present investigation was conceived with the following major objectives:1) Analyzing root system morphology in response to candidate Trichoderma isolates. 2) In-silico analysis of root related QTL’s 3) Molecular and biochemical characterization of Trichoderma isolates for ACC deaminase (Tas-acdS) gene 5 CHAPTER- II REVIEW OF LITERATURE 2.1 Rice Microorganisms are used for eliminating problems associated with the use of chemical fertilizers and pesticides; they are now widely applied in nature farming and organic agriculture (Higa, 1991; Parr et al., 1994). Several microbes can capable of mobilizing nutritive elements from non-usable form to usable form through biological processes (Tiem et al., 1979). Either by living freely in the soil or being associated symbiotically with plants (Chandraseker et al., 2005). Rice is an economically important cereal grown in about one-third of the world’s total cereal crop area, providing staple food and 35-60% of the calories consumed by more than 2.7 billion people (Kush, 1997). Rice is life for human beings especially in Asia, where 90 per cent of world’s rice is grown and consumed with 60 percent of population (Khush and Virk, 2000). Rice is grown over an area of 153.76 m. ha with production of 598.85 m.t. in the world (FAO, 2005). In India, rice is cultivated on an area of 43.50 m. ha with production of 91.00 m.t. (DRR, 2007). Rice is grown under diverse growing conditions. Four major ecosystems are generally recognized (Khush, 1984) as follows: (1) irrigated, (2) rainfed lowland, (3) upland, and (4) floodprone. Approximately, 55% of the world rice area planted to rice is irrigated and is the most productive rice growing system, perhaps contributes 75% of the world rice production. Large areas of rice are grown under lowland and upland rainfed conditions. Rice to be grown successfully under a variety of climatic conditions across the globe; breeders maintain rice at high genetic diversity. Second generation sequencing technologies have enabled resequencing of a large number of genomes and have provided the 6 possibility of high-throughput genotyping and large scale genetic variation surveys. Identification of allelic variations underpinning the phenotypic diversity observed in rice will have enormous practical implications in rice breeding. The International Rice Research Institute (IRRI) is a non-profit organization with a mission to conduct scientific research to help rice farmers improve yields in a range of agro ecosystems. For drought-prone environments, IRRI’s research program has included plant breeding efforts to improve yield under drought as well as the physiological investigation of the mechanisms behind drought resistance, such as root traits. Root trait is an important parameter of study of investigation to develop a variety resistance to biotic and abiotic stress which is the requirement of sustainable agriculture to increase yield. It is important to study phenotypic and molecular analysis of rice root system and identify the rice root ideotype having denser, branched, thick, deep root system. 2.2 Genetics of rice root development Plant root have a large range of functions, including acquisition of water and nutrients, as well as structural support. The root grows in length due to the proliferation of self-renewing stem cells in the RAM, which is found just behind the root cap. Cells leaving the RAM are deposited in files (representing the radial cell layers) and go through successive stages of elongation and differentiation. The young root can thus be divided into four longitudinal zones: the cap, the division zone, the elongation zone, and the differentiation zone. The RAM does not produce lateral organs in the same way as the shoot meristem. Instead, lateral roots may arise from the differentiated part of the main root. However, the RAM does continuously supply cells to the root cap, which is worn away by abrasion as the root pushes through the soil. 7 Dissecting the genetic and molecular mechanisms controlling rice root development is critical for the development of new rice ideotypes that are better adapted to adverse conditions and for the production of sustainably achieved rice yield potential. Most knowledge regarding the gene networks involved in root development has been accumulated in the model dicotyledon plant species Arabidopsis thaliana. Rice, the model monocotyledon species, presents several singularities compared to Arabidopsis thaliana, including a root architecture characterized by a fibrous root system comprising five types of embryonic and postembryonic roots. For instance, a deep, thick, and branched root system is correlated with better survival under adverse conditions, such as drought or nutrients deficits. The structure of root system is determined by an endogenous genetic program as well as by external environmental factors, including biotic and abiotic stresses. The high adoptive plasticity of root development complicates the genetic dissection of gene controlling root structure variation and represents bottleneck for efficient selection of specific root ideotypes. Genetic control of root development has been studied mainly through quantitative trait loci analysis, and a wide range of QTLs associated with small-medium effects on root biomass, root length, root number has been identified in rice. Despite the availability of these scientific resources, most of what we know about the genetic architecture of complex traits in rice is based on quantitative trait locus (QTL) linkage mapping using bi-parental populations. While providing valuable insights, the QTL approach is clearly not scalable to investigate the genomic potential and tremendous phenotypic variation. Thus for analysing or determining the genetic basis of complex traits a new tool can be use called association mapping. 8 2.3 Specification of the Root Apical Meristem The origins of the RAM can be traced back to the very first cell division in the plant embryo, when the elongated zygote divides asymmetrically to produce a small apical cell (which gives rise to most of the embryo) and a larger basal cell (which forms the basal part of the embryo and the suspensor). The apical cell undergoes a series of stereotyped divisions to produce the embryo, while the basal cell divides several times in the same plane to produce the suspensor. The embryonic root is derived from the lower tier of embryonic cells in the globular stage embryo and the upper cell of the suspensor, which is called the hypophysis. Axial patterning depends on the expression of a series of genes in zones along the apical–basal axis (Costa S and Dolan L 2000). In the case of root development, the most important genes are those that specify basal parts of the axis (Howell SA (ed.) 1998). For example, the MONOPTEROUS (MP) gene is expressed in the bottom tier of cells of the proembryo, and the mp mutant has no hypocotyl, radicle, or RAM. Similarly, the HOBBIT (HBT) gene is required for the formation of the hypophysis, and hbt mutants do not correctly form a RAM. The product of the MP gene is a transcription factor that binds to auxin-responsive elements. The role of auxin in root development has been revealed by the analysis of genes that act upstream of MP. For example, the GNOM (GN) gene, which is expressed just after fertilization, encodes a protein required for polarized auxin transport. In normal embryos, auxin accumulates at the future basal pole because auxin efflux pumps are localized specifically at the basal ends of each cell (Paquette AJ and Benfey PN 2001). Once the RAM is specified, root growth is dependent on its continuous proliferation. This does not occur in mutants lacking functional ROOT MERISTEMLESS1 (RTM1 or RTM2) genes, while cell 9 proliferation in the shoot meristem is unaffected. Conversely, over proliferation of cells is the defect in mass mutants, which are characterized by fat, barrel like roots with extra cell layers. 2.4 Lateral Root Initiation During embryogenesis, the first root in the embryo axis is called the radicle. When it emerges during germination it becomes the primary root. Lateral roots (sometimes called secondary roots) will then form the primary root. Roots that develop on other parts of a plant, such as the stem, or leaves, are called adventitious roots. Roots are heterotrophic organs, meaning that their nutrition depends significantly on photosynthates produced by leaves. LRP initiation usually starts in the primary root after seed germination. Lateral root cap cells originate from the endodermis, while epidermis, ground tissues, columella, and stele originate from the pericycle (Kawata S. and Shibayama H. 1965). However, in some plants LRP initiation actually starts during the development of the radicle in the embryo axis; cucumber (Cucumis sativum) is an example. Two kinds of lateral roots can originate from primary roots: the large lateral roots and small lateral roots. CRL1 encodes a lateral organ boundary (LOB) family transcription factor, the expression of which is regulated by auxin through an auxin response factor (ARF). Several LOB gene involved in lateral root formation (Okushima Y, Overvoorde PJ, Arima K, Alonso JM, et. al.,). The plant specific LOB/ AS2 family contain 43 members in A. thaliana and 35 members in rice (Shuai B, Reynaga-Pena CG).CRL1/ ARL1 is the master gene for crown root formation. The CRL1 protein is a positive regulator of crown root and lateral root formation, and its expression is regulated by an ARF via auxin pathway. 10 2.5 Root pulling force for estimating plant anchorage Root length and diameter distribution are important characteristics to be considered when describing and comparing root systems. Root pulling force was first used in rice by O'Toole and Soemartono (1981) as an indirect estimate of root related dehydration avoidance capacity. Ekanayake et. al., (1985) found a significant positive correlation across diverse rice genetic materials between root pulling force and dehydration avoidance as expressed in leaf water status maintenance and visual scored of drought resistance under severe drought stress in the field. Long fibrous roots have long been recognized as an important dehydration avoidance mechanism in rice and such roots evidently also ascribe stronger anchorage and greater resistance to pulling force. The method appear s sensible for root depth phenotyping in rice, especially when other direct field methods for root selection are not very forthcoming. The root pulling strength (RPS) measurements showed a significant positive correlation with maximum root length, root thickness, branching number, and root dry weight. Rice genotypes that had a high RPS value were identified as having longer, thicker, and denser root systems. When drought resistance is considered, root function can be phenotype indirectly by assessing plant water status in a drought managed breeding nursery rather than by accessing the root itself. 2.6 Drought and root traits Drought is the most serious abiotic stress that limits crop production under rainfed conditions. In particular, rice (Oryza sativa L.), which is generally grown under flooded conditions, is susceptible to drought stress owing to its shallow root distribution and limited capacity to extract water from deep soil layers (Kondo et. al., 2000 and 2003). The global warming that has occurred in recent years has 11 caused serious drought damage in rice-growing areas that rely on rainwater and that lack access to irrigation. Therefore, the enhancement of drought resistance in rice is becoming an important strategy to stabilize rice production in areas with rainfed agriculture. A deep root system is thought to enable plants to avoid drought stress by absorbing water from deep soil layers (Yoshida and Hasegawa, 1982). Typical upland rice cultivars have deeper rooting than lowland cultivars (O’Toole and Bland, 1987). The deep root system in upland rice may contribute greatly to its drought resistance through enhanced water uptake (Price et. al., 1999). Therefore, introducing the deep rooting characteristic of upland rice into lowland rice cultivars may be one of ways to improve their drought resistance. Deep rooting is a complex trait that combines the effects of the root growth angle and root length in seminal and nodal roots of cereal crops (Araki et. al., 2002). Neither growth angle nor length of roots alone determines the vertical root distribution (Abe and Morita, 1994). Thus, a combination of a near-vertical growth axis and increased root length along that axis is important for deep root development. The different root parameters are involved in development of drought resistance cultivars with the deep root system including lateral roots, sub lateral root that affect the root volume. The more root volume, the higher will be the water holding capacity. 2.7 Analyzing root morphology with Trichoderma seed treatment Only the phenotypic and genotypic observations are not only enough to identify the rice ideotype having deep, branched, thick root system so it is necessary to scan the whole root of individual plants using root scanner machine and then analyzed the image using various root analysis software’s e.g. WinRHIZO. A significant progress in evaluating root morphology has been 12 observed in the Trichoderma treated roots and untreated roots. Despite, root research as a whole still remains challenging and costly. Image analyses systems provide an opportunity to facilitate analyzing procedure. They offer a rapid assessment of root characteristics like length and surface area, diameter and tips, root branching patterns, etc. Root length and surface area are important indicators for a potential uptake of water and nutrients. Root diameter radius is one of the most important input parameters for rhizosphere modeling. The complex and dynamic interactions among microorganisms, roots, soil and water in the rhizosphere induce changes in physicochemical and structural properties of the soil (Haynes and Swift 1990). Microbial polysaccharides can bind soil particles to form microaggregates and macroaggregates. Plant roots and fungal hyphae fit in the pores between microaggregates and thus stabilize macroaggregates that alleviate stress. 2.8 Characterization of ACC deaminase Plant diseases are a major impediment to increasing yields of many crops, and result in large economic losses. An environmentally safe strategy to control diseases is biological control, which is based on natural antagonistic interactions among microorganisms. Successful biocontrol agents (BCAs) colonize roots and suppress pathogens by mechanisms that include niche exclusion and competition, direct antagonism of pathogens by antibiosis, parasitism or predation and by triggering systemic host plant defense responses (Chet&Chernin,2002; Harman et al., 2004). Some BCAs are plant growth-promoting rhizobacteria (PGPR) and fungi that also stimulate plant growth directly by altering plant hormone levels, facilitating iron acquisition through siderophore production, fixing atmospheric nitrogen and/or solubilising minerals (Lugtenberg&Kamilova, 2009). Plant 13 growth can also be stimulated by PGPR that produce1-aminocyclopropane-1carboxylate (ACC) deaminase, which cleaves ACC, the immediate precursor of the plant hormone ethylene, to produce a-ketobutyrate and ammonia (Todorovic & Glick, 2008). Ethylene is an important signalling molecule in plants under pathogen attack or abiotic stresses and results in plant growth inhibition (Abels et al., 1992). Inoculation of plants with PGPR producing ACC deaminase (ACCD) lowers ethylene levels, which results in longer roots and decreased in hibition of plant growth following environmental or pathogen-induced stress (Glicketal., 1998, 2007; Farwell et al., 2007). Interestingly, it has been found that ACCD activity is not unique to bacteria. ACCD activity was detected in Penicillium citrinum (Jia et al., 2000). Two putative acdS genes were recently detected in the genome of Arabidopsis thaliana and evidence was presented supporting the hypothesis that these genes can act as regulators of ACC levels in A. thaliana and also in tomato fruit development (McDonnell et al., 2009; Plett et al., 2009). Certain Trichoderma spp. that has beneficial effects on plant growth and enhanced resistance to both biotic and abiotic stresses (Harman et al., 2004) also possess ACCD putative sequences (http://genome.jgi-psf.org/Trive1/Trive1.home.html). However, the role of ACCD in beneficial fungi has not been investigated in depth. 2.9 Phosphate solubilisation Phosphorus is abundant in soils in both organic and inorganic forms; nevertheless, it is unavailable to plants. Accordingly, soil becomes phosphorus (P)-deficient, making P one of the most important nutrient elements limiting crop productivity. Phosphorus frequently is the least accessible macronuntrient in many ecosystems and its low availability is often limiting to plant growth (Raghothama, 1999). To circumvent the P deficiency, phosphate-solubilizing microorganisms could play 14 an important role in making P available for plants by dissolving insoluble P. Fungi exhibit traits such as mineral solubilization, biological control, and production of secondary metabolites. Altomare et. al., (1999) reported three possible mechanisms by which Trichoderma might convert phosphate to a soluble form (i) acidification, (ii) production of chelating metabolites, and (iii) redox activity, concluding that chelation was the more likely mechanism for P solubilization by Trichoderma. As such, their potential to enhance plant growth when present in association with the roots is clear. The challenge is how to make use of such biological resources to maintain soil health while increasing the crop productivity by providing P to plants through the application of phosphate-solubilizing fungi (Khan et. al., 2009). Khan et. al., (2009) focuses on the mechanisms of phosphate solubilization, development and mode of fungal inoculants application and mechanisms of growth promotion by phosphate-solubilizing fungi for crop productivity under a wide range of agro-ecosystems, and the understanding and management of P nutrition of plants through the application of phosphatesolubilizing fungi. 2.10 Production of different types of Siderophore Siderophores, low molecular weight ligands produced by bacteria and fungi for iron uptake, can be used to increase the potency of antibiotics. In addition to Fe (III), siderophores can form complexes with Ga (III), Cr (III) and V (IV). Siderophores are iron chelating ligands which can be beneficial to plants by increasing the solubility of ferric iron (Fe III), which otherwise is unavailable for plant nutrition (Renshaw et. al.,., 2002). This element is assimilated by root cells in the reduced form (Fe II); however, especially in sufficiently aerated soils, the oxidized state (Fe III) is predominant and needs to be reduced to be taken up by 15 plants. Trichoderma, can reduce Fe III through chelators such as siderophores, and plants can take up chelated iron by reductases on the plasma membrane (Altomare et. al.,., 1999; Jalal et. al.,., 1986 and 1987). Unlike bacterial siderophores, the production of Trichoderma metabolites able to chelate iron is constitutive and does not require Fe deficiency, these molecules bind Fe (III), and also other metals including Pb (II), Cr (III), Al (III) and actinide ions ( Renshaw et. al., 2002). Basically siderophores are considered to be of two different types, viz., secondary hydroxamic acids and catechol type (Neilands, 1981). Using the method of Alexander and Zuberer (1991), Hoyos-Carvajal et al. (2009) described the production of ferric type of siderophores or other chelating compounds in 55 out of 101 Trichoderma strains, based on the production of soluble ferrous iron complexes indicated by colour changes in the media from blue to orange or pink. Only 17 strains were Sid+ positive on 8-hydroxyquinoline media, in which Fe is linked to the lipophylic 8-hydroxyquinoline. Hydroxyquinoline is used as a complexing reagent which reacts with almost every metal in the periodic table to form uncharged chelates. 8-HQ has a hydrogen atom that is replaceable by a metal, and a heterocyclic nitrogen atom, which forms with this, metals a five membered ring (Becher, 1966).The lipophylic chelant HQ can be toxic causing lipid peroxidation and DNA breakage (Leanderson and Tagesson, 1996), possibly explaining the relatively low number of positive tests on HQ media. 2.11 Production of Plant hormones and related compounds Plant immunity and development are interconnected in a network of hormone signalling pathways (Pieterse et. al., 2009). There is a cross-communication between hormones salicylic acid (SA), jasmonic acid (JA) and ethylene (ET), the central players in defence, and the response pathways of other hormones such as 16 abscisic acid, commonly associated with plant development and abiotic stress, IAA, related to plant growth and lateral root development, and gibberellins, which control plant growth by regulating the degradation of growth-repressing DELLA proteins (negative regulators of gibberellin (GA) signaling that act immediately downstream of the GA receptor). In Trichoderma, the ACCD (1- aminocyclopropane1-carboxylic acid deaminase) activity reduces the availability of ACC necessary for ET biosynthesis. Reductions in ET promote plant growth via gibberellins signalling by increasing the degradation of DELLA proteins. Moreover, gibberellins may control the onset of JA- and SA-dependent defence responses of the plant through the regulation of DELLA protein degradation. ( Rosa Hermosa et. al., 2012). In plants IAA plays a key role in root and shoots development. The hormone moves from one part of the plant to another by specific transporter systems that involve auxin importer (AUX1) and efflux (PIN1-7) proteins. IAA is a key regulator of lateral root development and root hair development (Casimiro et. al., 2001). Expression studies of the auxin-inducible marker DR5: uidA suggested that T. virens inoculation increases the auxin response in Arabidopsis seedlings. Several auxin-like secondary metabolites produced by Trichoderma strains were able to induce plant growth and are required for development of lateral roots in Arabidopsis (Contreras et. al., 2009; Vinale et. al., 2008). The observed effect of Trichoderma in promoting lateral root development is similar to that described for auxins in plants (Casimiro et. al.,., 2001). IAA is a molecule that is synthesized by plants and a few microbes (Woodward and Bartel, 2005). IAA is also involved in tomato fruit development, especially during fruit setting and in the final phase of development (Srivastava and Handa, 2005). Indeed, IAA, including microbial, can 17 greatly influence the growth of the root system depending on the amount found in the rhizosphere, through root elongation and the formation of lateral or adventitious roots (Scott, 1972; Patten and Glick, 2002). 2.12 Cell-wall-degrading enzymes chitinases The chitinolytic system of Trichoderma comprises many enzymes and the list of its components is rapidly being updated as new enzymes and genes are reported. Chitinases are divided into 1, 4-β-acetylglucosaminidases (GlcNAcases), endochitinases and exochitinases. Two chitinolytic fungal strains, Trichoderma aureoviride DY-59 and Rhizopus microsporus VS-9, were isolated from soil samples of Korea and Vietnam, respectively. Enzymatic hydrolysis products from crab swollen chitin were N-acetyl-β-D-glucosamine (GlcNAc) by DY-59 chitinase, and GlcNAc andN, N′-diacetylchitobiose (GlcNAc) 2 by VS-9 chitinases. The chitinases degraded the cell wall of Fusarium solani hyphae to produce oligosaccharides, among which GlcNAc, (GlcNAc) 2 , and pentamer (GlcNAc)5 were identified by high-pressure liquid chromatography. DY-59 and VS-9 chitinases inhibited F. solani microconidial germination by more than 70% and 60% at final protein concentrations of 5 and 27 μg mL −1 , respectively, at 30°C for 20 h treatment (Nguyen et. al., 2008). Chitinolytic enzymes have been found in Trichoderma harzianum, Trichoderma aureoviride, Trichoderma autroviride, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma viride, Trichoderma pseudokoningii, Trichoderma longipilis, Trichoderma minutisporum, Trichoderma hamatum and Trichoderma reesei, but the chytinolytic systeme of Trichoderma harzianum is by far the most studied and effective (Bruce et. al.,1995; de la Cruz et. al., 1993; Garcia et. al., 1994; Harman 18 et. al.,1993b; Lorito et. al., 1994a; Turoczi et. al., 1996; Ulhoa and Peberdy, 1991a,1992; Usui et. al., 1990). Many GlcNAcases and their genes-exc1 (=nag1), exc2, tvnag1, and tvnag2 from T. harzianum T25-1, T. atroviride P1 and T. virens Tv29-8 -have been described (Harman et. al.,., 2004, Kim et. al., 2002). The 73-kDa Nag1 represents the main GlcNAcase in T. atroviride. Nag1-disruption strain lacks chitinase activity and the endochitinase chit42 mRNA is absent (Harman et. al.,., 2004).This indicates that nag1 is essential for triggering chitinase gene expression. The pathogen cell wall and chitin induce nag1, but it is only triggered when there is contact with the pathogen (Carsolio et. al., 1999; Mach et. al., 1999) GlcNAcases CHIT73 and CHIT102 were detected in T. harzianum TM and Trichoderma asperellum (Haran et. al., 1996). CHIT102 triggers the expression of other chitinolytic enzymes (Haran et. al., 1996). In addition, strain 2413 produces three extracellular endochitinases whose genes, chit33, chit37 and chit42, have been cloned from this strain. Other genes coding for Chit42 chitinase-ech42, cht42 and ThEn4-have also been cloned from T. atroviride IMI206040 (Carsolio et. al., 1999), Gv2908 (Howell et. al., 2003) and T. atroviride P1 (Howell et. al., 2003), respectively. Chit37 shows 89% similarity to Chit36 from T. harzianum TM at the amino-acid level (Harman et. al., 2004). Chit36 inhibits B. cinerea spore germination and the growth of both Sclerotium rolfsii and Fusarium oxysporum (Viterbo et. al., 2001). Other genes homologous to chit36 have been cloned from T. harzianum TM, T. atroviride P1 and T. asperellum T-203. Endochitinases are regulated by a variety of mechanisms but induction by stress has been reported for chit33, chit36 and chit42. Chitinase gene ech42 was obtained from Trichoderma aureoviride M. The cloning vector pMD18-T and an E. coli DH5 alpha host were used to yield clones 19 as E. coli DH5alpha/ech42. The ech42 gene was integrated into the genomic DNA of pYES2 by insertion into a single site for recombination, yielding the recombinant pYES2/ech42. Chitinase expressed by pYES2/ech42 was induced by galactose (maximal activity 0.50 units ml(-1)) and was produced in fermentation liquid cultured for 36 h (Jinzhu s. et. al., 2005). However, the induction under mycoparasitic conditions is not clear. Ech42 is induced prior to any physical contact with R. solani (Kullnig et. al., 2000). Chit33 is expressed only during the contact phase and not before overgrowing R. solani (Dana et. al., 2001); and chit36Y does not need the direct contact of the pathogen to be expressed. chit33, chit42 and chit36 have been overexpressed in Trichoderma spp. in order to test the role of these chitinases in mycoparasitism, and the 42-kDa chitinase is believed to be a key enzyme (Howell et. al.,., 2003). T. virens transformants overexpressing Chit 42 showed significantly enhanced biocontrol activity compared with the wild-type when assayed against R. solani in cotton seedlings experiments (Howell et. al., 2003). Other Trichoderma spp. transformants overexpressing chit 42 resulted in better antagonism than obtained with the wild-type (Carsolio et. al., 1999; Limon et. al., 2004). In greenhouse biocontrol tests, however, the activity of chit 42 disruptants did not differ from that of the wild-type (Harman et. al., 2004). T. harzianum transformants overexpressing Chit33 chitinase constitutively inhibited the growth of R. solani under both repressing and derepressing conditions; the antagonist tests demonstrated that this chitinase also has an important role in mycoparasitism (Limon et. al.,., 1999). T. harzianum Rifai TM transformants overexpressing Chit36 chitinase inhibited F. oxysporum and S. rolfsii more strongly than the wildtype. Moreover, culture filtrates inhibited the germination of B. cinerea almost 20 completely (Viterbo et. al., 2001). The antagonism of Chit 33 and Chit 42 transformants has been improved by the addition of a cellulose-binding domain to the chitinase genes. As a result, the strains producing the chimeric enzymes increased their specific chitinase activity (Limon et. al., 2004). Trichoderma genes can be expressed functionally in plants to confer beneficial features, mainly in the control of plant diseases (Hermosa et. al., 2005). Co-expression of endo- (ech42) and exo- (nag70) chitinases of T. atroviride in apple has been correlated with increased resistance to V. inaequalis, and a negligible reduction in vigour (Bolar et. al., 2001; Faize et. al., 2003). Carolina Carsolio et. al., 1994 described the cloning and characterisation of an endochitinase gene of T.harzianum (ech42), whose expression is strongly enhanced during mycoparasitism, as well as induced by chitin and light-induced sporulation. 2.13 Quantitative trait loci (QTL) related to root traits Genetic control of root development in rice is complex and the underlying mechanisms (constitutive and adaptive) are poorly understood. Lowland and upland varieties of indica and japonica rice with contrasting root development characteristics have been crossed, mapping populations developed and a number of QTLs in different chromosomes were identified. ‘QTL’ (Quantitative trait loci), a term refers to “a region of the genome that is associated with an effect on a quantitative trait” Conceptually, a QTL can be a single gene or it may be a cluster of linked gene that affect trait. A wide range of QTLs associated with smallmedium effects on root biomass, root length, root number has been identified in rice ( Kamoshita A, Wade J, Ali L, and et. al.,) has been identified in rice. As 21 these studies have used different sets of markers and many of the QTLs identified are long, it is difficult to exploit the varietal difference for improved root traits by marker assisted selection and for identification of concerned alleles. Intensive data mining of literature resulted in the identification of 861 root development QTLs and associated microsatellite markers located on different chromosomes. The QTL and marker data generated and the genome sequence of rice were used for construction of a relational database, Rootbrowse, using MySQL relational database management system and Bio::DB::GFF schema. The data is viewed using GBrowse visualization tool. It graphically displays a section of the genome and all features annotated on it including the QTLs. The QTLs can be displayed along with SSR markers, protein coding genes and/or known root development genes for prediction of probable candidate genes. 22 CHAPTER-Ш MATERIALS AND METHODS The present investigation entitled “Root morphology of rice through bipartite interaction involving Trichoderma spp. influencing adaptation of plants to abiotic stress and in-silico analysis of root related QTLs” was conducted at the Molecular Plant Pathology Laboratory, Department of Plant Molecular Biology and Biotechnology, College of Agriculture, IGKV, Raipur (Chhattisgarh). During the course of study, potato dextrose agar was used for maintaining the culture of different isolates of Trichoderma spp, unless and until stated otherwise. Prior to the use glassware’s were cleaned with labolin, and rinsed with tap water and / or distilled water. Dried glassware’s were sterilized in hot air oven at 80˚C for two hours, while forceps, inoculation needle and other metallic instruments were sterilized by dipping them in alcohol followed by heating over the flame. Until and otherwise stated media was sterilized by autoclaving at 121˚C at 15psi for 30 min. 3.1. Materials During the course of investigation twenty genetically purified isolates of Trichoderma spp. (Table 3.1) kindly provided by Dr. A. S. Kotasthane, Head of Department, Department of Plant Pathology, College of Agriculture, IGKV, Raipur were used. Rice lines IR 64 (Drought susceptible line), Sahbhagi Dhan (Drought resistant line) and RRF 75 (Drought resistant line) was used. Indira barani dhan (Drought resistant line) 23 Table 3.1:- Isolates of Trichoderma spp. used in the study S.No. 1 2 3 4 5 6 7 8 9 10 Isolates/Source IRRI-1 (IARI, NewDelhi) IRRI-2(IARI, NewDelhi) IRRI-3(IARI, NewDelhi) IRRI-4(IARI, NewDelhi) IRRI-5(IARI, NewDelhi) IRRI-6(IARI, NewDelhi) TH-3(IARI, NewDelhi) TV12(IARI, NewDelhi) 94a (IGKV, Raipur) T14(IGKV, Raipur) ID T1 T2 T10 T3 T4 T5 T6 T7 T8 T9 3.2. Methods 3.2.1 Study of Root characteristics:Root systems are responsible for the capture of below-ground resources such as nutrients and water. As such, they are thought to play a central role in the yield establishment of crop plants. The availability of a given resource for the plant can be seen as the integration of soil and roots bio-physical constraints. Therefore, detailed datasets containing root system architecture, root placement and soil resource dynamics are required to improve our understanding of resource capture by plant roots. The roots of Trichoderma treated plants were used for root scanning which gives the detailed information about all root parameters. The root scanning was done by using root scanner Epson Perfection V700/ V750 3.81 version and WinRhizo Reg 2009 (Lobet et. al., 2013) software. The data was recorded automatically in the computer for different root parameters including root length, average root diameter, root volume, number of tips, forks, surface area etc. Following procedure was used for root scanning – 24 3.2.1.1 Acquiring Washed Roots The first step is acquiring washed roots. This can be the most difficult and laborious step in the experiment if plants are grown in a solid medium. The roots were washed with tap water two times to remove soil completely and the roots were preserved in 25% spirit in tarson tubes for root scanning. The procedure was conducted cautiously to prevent supplementary root damage and losses. 3.2.1.2 Preparing Roots for Scanning Roots are floated in water in acrylic trays on the scanner. This allows the roots to be arranged to reduce overlap and crossing of roots. Plastic forceps were used as tools. This is a delicate work; good lighting and steady hands are helpful. 3.2.1.3 Scanning Roots For best results, WinRhizo is used with an approved scanner, which allows the roots to be lit from above and below while being scanned. This is an important feature (called "Dual Scan" in Regent's documentation), which reduces shadows on the root image. Positioning System allows the trays to be consistently placed, thus obviating the need to preview each scan. Optimum scanning resolution depends on the type of samples. Lower resolution can speed up scanning significantly, especially if the samples require the use of large trays. Root length analyses are carried out with grayscale images; saving images in grayscale reduces the image file size substantially. 3.2.1.4. Threshold Parameters Analysis results can be sensitive to the threshold parameters used. WinRhizo can automatically set these, but one can also manually tweak them from time to time. 3.2.1.5 Analyzing Scanned Images To analyze the image, selects the region(s) of interest and it is analyzed. When scanned images are analyzed, the software uses thresholding to determine what is root 25 and what is not root (each pixel is classified as either root or not root based on its grayscale value; this is why shadows in images are problematic). Portions of the image can be excluded from analysis if necessary, and there are basic editing tools if minor image editing is required. 3.2.2 Qualitative estimation of ACC Deaminase activity 1. Trichoderma isolates were grown in 5 ml of synthetic medium (SM; Yedida et al., 1991) incubated at 28oC at120 rpm for 24 hrs. 2. The cells were harvested by centrifugation at 3000 g for 5 min and washed twice with sterile 0.1 M Tris-HCl (pH 7.5) and resuspended in 1 ml of 0.1 M Tris-HCl (pH 7.5) and spot inoculated on petri plates containing synthetic medium (SM; Yedida et al., 1991) modified supplemented with 3 mM ACC as sole nitrogen source. 3. Plates containing only synthetic medium without ACC served as negative control and with (NH4)2 SO4 (0.2% w/v) as positive control. 4. The plates were incubated at 28°C for 72 h. Growth of isolates on ACC supplemented plates was compared to negative and positive controls and was selected based on growth by utilizing ACC as nitrogen source. 3.2.2.1 Quantitative Estimation of ACC Deaminase activity ACC deaminase activity was determined by measuring the production of αketobutyrate and ammonia generated by the cleavage of ACC by ACC deaminase (Honma and Shimomura, 1978; Penrose and Glick, 2003). For determination of ACCD activity in Trichoderma 20µl spore suspension was inoculated in 10ml of synthetic medium (Yedida et al., 1991) and the culture was grown for 48 hrs. The washed mycelia were then transferred to 5ml of SM without ammonium and with 0.326 3 mM ACC. At the end of the induction period, the culture were resuspended in half volume of Tris buffer 0.1 M (pH 8.5) and homogenized. Toluene (25µl) was added to a 200 µl aliquot and vortexed vigorously for 30s. ACC (20 µl of 0.5 M solution) was added, and after an incubation period of 15 min at 30°C, 1 ml of 0.56N HCl was added. The lysates were centrifuged (10000g, 10 min) and 1ml of the supernatant was mixed with 800 µl of 0.56N HCl and 300 µl of 2,4-dinitrophenylhydrazine (0.2g in 100 ml of 2N HCl). The mixture was incubated for 30 min at 30°C, after which 2 ml of 2N NaOH was added. The A 540nm was measured. ACCD activity was evaluated quantitatively by measuring the amount of α-ketobutyrate produced by the deamination of ACC. ACCD activity was expressed in µmol of α-ketobutyrate / mg protein / hr. 3.2.3 Screening isolates of Trichoderma spp. for Chitinase activity: 3.2.3.1 Preparation of colloidal chitin: Colloidal chitin was prepared from commercial chitin (Hi Media) and was used for chitinase detection test. 3.2.3.2 Acid hydrolysis of chitin:To prepare colloidal chitin, 5.0 g of chitin was suspended in 60 ml conc. HCl and was acid hydrolyzed by constant stirring using a magnetic stirrer at 4ºC (refrigerator) overnight. 3.2.3.3. Extraction of colloidal chitin by ethanol neutralization:To the resulting slurry 2000 ml ice cold 95% ethanol was added and was kept at 28±2°C for overnight to neutralize the acid hydrolyzed chitin, which was then centrifuged at 3000 rpm for 20 min at 4ºC. Supernatant was discarded and the pellet was washed with sterile distilled water by centrifugation at 3000 rpm for 5 min at 27 4ºC. The washing of pellets was repeated till the smell of alcohol vanished. Colloidal chitin thus obtained was stored at 4ºC until further use. 3.2.4 Screening of isolates of Trichoderma for chitinase activity: 3.2.4.1 Qualitative estimation: For estimation of chitinase activity a simple technique developed by Agrawal and Kotasthane (2012) was followed. Colloidal chitin and a pH indicator was supplemented to the minimal media (Table 3.2), 20 ml of the molten chitin supplemented media was poured in pre sterilized petri dishes. After solidification, the plates were inoculated with culture plugs containing young actively growing mycelium of Trichoderma isolates (Table 3.1). The plates were then incubated at 28±2°C. Chitinase activity was identified by the formation of purple coloured zone. Observations were recorded for the colour intensity and diameter of the purple coloured zone until 5th day after inoculation. 3.2.4.2 Quantitative estimation: Culture plugs containing young actively growing mycelium of trichoderma isolates were inoculated in colloidal chitin supplemented broth and incubated at 28°C for 5 days at 200 rpm. Culture filtrates were obtained by filtering through whatman filter paper no. 1. The filtrate obtain were analyzed for chitinolytic and N-acetyl-β-Dglucosaminidase activity. Filtered supernatant were stored at -20°C until use. Two different procedures were followed to analyze the culture filtrates for chitinolytic and N-acetyl-β-D-glucosaminidase activity. Procedure I Chitinolytic activity was assayed by measuring the release of reducing saccharides from colloidal chitin. A reduction mixture contain 5ml of culture supernatant, 1.5ml of 1M sodium acetate buffer (SA-buffer) pH 4.6 and 1ml of 28 colloidal chitin was incubated at 40°C for 20 hrs and then centrifuged at 13,000rpm for 5 min after centrifuge, an aliquot of 3ml of the supernatant, 1ml of 1% solution of dinitrosalicylic acid in 0.7M NaOH and 0.4ml of 10M NaOH and heated at 100°C for 5min. Absorbance of the mixture at 582nm was measured after cooling. A calibration curve with N-acetyl-β-D-glucosamine (NAGA) as a standard was used to determine reducing saccharide concentration under the assay conditions described a linear correlation interval of 40-800mg/ml NAGA. Chitinolytic activity was estimated in terms of concentration (mg/ml) of NAGA released. Procedure II N-acetyl-β-D-glucosaminidase (exochitinase) activity was measured and monitored spectrophotomerically as the release of p-nitrophenol (pNP) from pnitrophenyl-N-acetyl-β-D-glucosamide (pNPg). A mixture of 125µl of testing solution (culture filtrate), 1ml of pNPg solution (1mg/ml), and 5ml of 0.1M SA buffer (pH4.6) was heated at 40°C for 20 hrs and then centrifuged at 13,000 rpm for 5min. An aliquot of 1.2ml of 0.125M sodium tetraborate-NaOH buffer (pH-10.7) was added to supernatant (2.4ml) obtained, absorbance at 400nm was measured immediately after mixing and pNp concentration (in terms of volume activity) in the solution was calculated using the pNp molar extinction (18.5mM -1CM-1) with the help of following formula. Vt – Total volume (3600µl) Vs – Sample volume (125µl) 18.5 – Milimolar extinction coefficient of p-nitrophenol under the assay condition (cm2/micromole) 1.0 – Light path length (cm) t – Reaction time (20 hrs=1200 minutes) df – Dilution factor (27.8) 29 3.2.5 Screening of Trichoderma isolates for siderophore production 3.2.5.1 The CAS agar plate test It is the universal test for detection and determination of siderophores. Chrome azurol S solution was prepared and added to melted Potato dextrose Agar medium in the ratio 1:10 (1 part CAS solution and 10 parts PDA). A 5mm mycelial disc of isolates of Trichoderma spp. was cut from the plates of actively growing colony and placed in the centre of each Petri plate. Colonies exhibiting a pink halo after 5 days incubation (28 ±2o C) were considered positive for siderophore production. 3.2.5.2 Hydroxyquinoline mediated siderophore test For selection of fungal isolates with high ability to produce siderophore, isolates were inoculated on PDA supplemented with a strong chelater 8 Hydroxyquinoline (50mg/L) (De Brito Alvarez and Gagne, 1995). The iron availability of this medium is too low and only the isolates with high ability of siderophore production can grow on this medium. Inoculated isolates were incubated at 28±2o C for 48-72hrs. 3.2.5.3 Arnow’s assay Arnow’s assay was used for quantification of catechole type of siderophore production. For qualitative estimation of siderophore quantification, actively growing cultures of Trichoderma spp. with four discs (3 mm diameter) was inoculated to 20 ml PDB (Hi Media) in 50 ml Tarson tubes and incubated for 3 days at 28±2°C. The mycelium growth was removed by centrifugation at 3000 rpm for 5 min. 3 ml of the culture supernatant was then mixed with 0.3 ml 5 N HCl solution, 1.5ml Arnow’s reagent (10g NaNO2, 10g Na2MoO4.2H2O dissolved in 50 ml distilled water) and 30 0.3ml 10 N NaOH. After 5-10 min the presence or absence of pink colour was observed. 3.2.5.4 Tetrazolium test This test is based on the capacity of hydroxamic acid to reduce tetrazolium salt by hydrolysis of hydroxymate groups using a strong alkali. The reduction and release of alkali shows red colour to a pinch of Tetrazolium salt when 1-2 drops of 2N NaOH and 0.1 ml of test sample is added. Instant appearance of a deep red colour indicated the presence of Hydroxamate siderophore. 3.2.5.5 FeCl3 test One ml of the culture supernatant was mixed with freshly prepared 0.5 ml 2% aqueous FeCl3 and observed for presence and absence of deep red colour. 3.2.5.6 Quantitative spectrophotometric assay for siderophore production (liquid assay) The chrome azurol sulfonate (CAS) assay (Schwyn and Neilands, 1987) was used to evaluate the siderophore production. For siderophore quantification, actively growing cultures of Trichoderma spp. with four discs (3 mm diameter) was inoculated to 20 ml PDB (Hi Media) media in tarson tubes and incubated for 3 days at 28±2°C. The mycelium growth was removed by centrifugation at 3000 rpm for 5 min. 0.5 ml of the culture supernatant was then mixed with 0.5 ml CAS solution and 10µl shuttling solution (sulfosalicyclic acid). After 20 min. of incubation, the colour obtained was determined using the spectrophotometer at 630 nm. Only PDB was used as blank while reference solution was prepared by adding CAS dye and shuttle solution to PDB and absorbance was recorded. Values of siderophore released in PDB was expressed in percent siderophore units and calculated using the formula: 31 Where, Ar = OD of reference solution, As = OD of sample 3.2.6 Screening the isolates of Trichoderma spp. for Plant growth promoting traits 3.2.7 Estimation of inorganic phosphate for phosphate solubilisation ability of Trichoderma spp. 3.2.7.1 Qualitative estimation in Agar medium Isolates of Trichoderma were inoculated on Pikovskaya agar medium (Himedia) for evaluating its ability to solubilize supplemented tri-calcium phosphate in vitro. Pre-sterilized molten media was supplemented aseptically with BCP (bromocresol purple 0.1 gL-1) as pH indicator (Vasquez et al., 2000) and poured in petri dishe(s). Plates were inoculated with young actively growing cultures of Trichoderma spp. and incubated at 28±2°C for 3 days. After incubation phosphate solubilising positive isolates turned the media from purple to yellow in the zone of acidification which indicated positive response for phosphate solubilising efficacy of Trichoderma spp. 3.2.7.2 Quantitative estimation in Liquid medium The quantitative procedure described by Nautiyal, (1999) was used to screen phosphate solubilising efficacy of Trichoderma spp. with slight modification. Isolates of Trichoderma spp. were inoculated on Pikovskaya broth medium (Pikovskaya, 1948) to evaluate its ability to solubilize supplemented phosphate in vitro. 30ml of Pikovskaya broth was poured in 100ml conical flasks and sterilized. After sterilization 32 the media was cooled and inoculated with 1cm disc of different Trichoderma isolates. The flasks were incubated at 28±2°C for 3-6 days on orbital shaker at 100rpm. After incubation the whole culture was transferred to 50ml Tarson tube, centrifuged at 5000rpm for 10min. and the supernatant used for quantitative estimation of phosphate solubilization. To 0.5ml of sample supernatant 5ml of chloromolybdic acid (CMA) was added and the volume was made up to 20ml with distilled water. To the above solution 125µl of chlorostannous acid (CSA) was added and final volume was made to 25ml with DW. The tubes were incubated for 15min. at RT for the development of blue color and the absorbance was measured at 610nm. Blank was prepared with DW in place of sample supernatant, reference or control was prepared with un inoculated broth supernatant instead of sample supernatant. The standard solution was prepared with KH2PO 4 (10 mg/ml) in distilled water with the increase in conc. of stock 0µl, 1µl, 2.5µl, 5 µl, 10 µl, 20 µl, 30 µl, 40 µl, 50 µl, 60 µl, 70 µl, 80 µl. 90 µl and the conc. of KH2PO4 (10 mg/ml) was 0µg, 10µg, 25 µg, 50 µg, 100 µg, 200 µg, 300 µg, 400 µg, 500 µg, 600 µg, 700 µg, 800 µg and 900 µg. Measurement of OD was taken at 610nm. 3.2.8 Quantification of Indole acetic acid production by Trichoderma spp. For the production of indolic compounds, an active cultures of Trichoderma spp. with four discs (3 mm diameter) was inoculated to 20 ml DF salts minimal media (Dworkin and Foster, 1958) in 100ml conical flasks and incubated for 3 days at 28±2°C. The medium was supplemented with L-tryptophan at a concentration of 1.02 g/L. After incubation for 72 hours, the mycelium was removed from the culture medium by centrifugation at 5,000 rpm for 5 min. One ml aliquot of the supernatant was mixed vigorously with 4 ml of Salkowski’s reagent (Gordon and Webber, 1951) with blank as DF salts minimal media and allowed to stand at RT for 20 min. before 33 the absorbance at 535 nm was measured in colorimeter. The standard curve was prepared from 2 mg/ml stock IAA and the concentration of IAA in each culture was determined by comparison with standard curve. 3.2.9 Estimation of Hydrogen cynide (Volatile inhibitory compound) The production of HCN compound was estimated by method of Wei et al. (1991). The cultures was grown on PDA plates supplemented with 4.4g/L glycine as a precursor molecule for hydrogen cynide production and the filter paper strips soaked in saturated picric acid solution were exposed to the growing trichoderma isolates. The plates were incubated for 7 days at 28±2°C and observations were recorded as colour of filter paper turning to brown recorded as positive for HCN production. 3.2.10 Media preparation used in the present study A. Table 3.2 Composition of different media used in present investigation Potato dextrose Agar (PDA) Medium. 1 Potato 250g 2 Dextrose 18g 3 Agar 15g 4 Distilled water 1000ml B. Chitin amended medium (pH4.7) 1 Colloidal chitin 4.5 g 2 MgSO4.7H2O 0.3 g 3 (NH4)2SO4 3g 4 KH2 PO4 2g 5 Citric acid monohydrate 1g 6 Tween 80 200µl 7 Bromo cresol purple 0.15 g 34 8 Agar 15 g 9 Distilled water 1000ml D. Pikovskaya agar medium 1 Yeast extract 0.50g 2 Dextrose 10g 3 Calcium phosphate 5g 4 Ammonium sulphate 0.5g 5 Pottasium chloride 0.2g 6 Magnesium sulphate 0.1g 7 Manganese sulphate 0.0001g 8 Ferrous sulphate 0.0001g 9 Agar 15 g 10 Distilled water 1000ml E. Pikovskaya broth medium F. In Pikovskaya broth medium all chemical compositions are same as Pikovskaya Agar medium except absence of agar Synthetic Medium 1 Glucose 15.0 g 2 MgSO4.7H2O 0.2g 3 K2HPO4 0.6 g 4 KCl 0.15 g 5 NH4NO3 1g 1 ml of trace elements (per liter of stock solution) 6 FeSO4·7H2O 0.005 g 7 MnSO4 ·H2O 0.006 g 35 8 ZnSO4 ·H2O 0.004 g 9 CoCl2 0.002 g 10 Distilled Water 1000ml G. DF Salts Minimal Medium (pH 7.2) 1 KH2 PO4 4g 2 Na2HPO4 6g 3 MgSO4.7H2O 0.2g 4 Glucose 2g 5 Gluconic acid (Sodium Gluconate) 2g 6 Citric acid 2g 7 FeSO4.7H2O 1mg 100µl of trace elements 8 H3BO3 10µg 9 MnSO4.H 2O 11.19µg 10 ZnSO4.7H2O 124.6µg 11 CuSO4.5H2O 78.22µg 12 MoO3 10µg 13 (NH4)2SO4 2g 3.2.11 Molecular Characterization of the isolates of Trichoderma 3.2.11.1 Fungal growth conditions and DNA extraction: 1. To obtain the vegetative growth of all the isolates of Trichoderma spp. 3 to 4 mycelial blocks from one week old culture (approx. 3mm × 3mm) were transferred separately in 50 ml potato dextrose broth (HiMedia) medium contained in 100 ml flasks. The flasks were incubated by shaking (100 rpm) at 28±2°C for 7 days. 36 2. Vegetative growth (mycelia) was harvested from the broth by suction filtration through Whatman no. 1 filter paper using a Buchner filtration apparatus connected to a vacuum pump. The mycelia mat was removed from the filter paper; blot dried and was then used for DNA extraction. 3. Mycelia mat was grind to uniform consistency in 1000 µl resuspension buffer using PowerlyzerTM 24. 4. The grinded sample (500 µl) were collected in a 1.5 ml eppendorf tube to which 150µl 5M potassium acetate buffer was added, vortexed briefly. Incubated in water bath at 65°C for 10 min and then centrifuged at 13,000 rpm for 10 min. 5. To the supernatant added 600µl of chloroform : isoamyl alcohol (24:1), inverted the tubes for 5 min. and centrifuged at the 12,000rpm for 10min. Supernatant was taken carefully and transferred to another new eppendorf tubes. 6. Added equal volume of pre-chilled isopropanol and inverted tubes gently, kept the tubes in deep freezer for half hour and then centrifuged again for 12,000 rpm for 10min. Supernatant was discarded and pellet was saved. 7. The pellets was washed with 300µl of 70% ethanol, air dried and resuspended in 50µl of TE buffer and left overnight. 8. 5µl RNase (10 mg/ml) was added to the samples and incubated at 37°C for 1 hour. The samples were precipitated with double volume of pre chilled absolute alcohol and incubated at -20°C deep freezer for 30 min. followed by spinning at 13000rpm for 10 minutes. 9. Supernatant was discarded and the pellet was washed with 70% ethanol and then air dried. The DNA pellet was dissolved in 100 µl of TE buffer and stored at -20°C till further use. 3.2.12 Quantification of genomic DNA:- 37 The DNA samples were quantified using Nanodrop Spectrophotometer (ND 1000). One µl of isolated DNA was placed over lower pedestal of Nanodrop to record absorbance at 260nm and concentration was estimated using TE buffer as blank reference. After quantification, the DNA was diluted with sterile water to get a final concentration 30ng /µl. The absorbance ratio (A260/A280) was recorded for each sample to find out the purity of DNA. The acceptable absorbance ratio (A260/A280) for pure DNA is 1.8. 3.2.13 Polymerase Chain Reaction (PCR) analysis of Isolates of Trichoderma spp. A set of 9 primer pairs (Table 3.3) were used for PCR based DNA fingerprinting for the analysis of 10 isolates of Trichoderma spp. The reaction mixture and the temperature profiles used are summarized in Table 3.4 to Table 3.15 respectively. 5% non-denaturing PAGE was performed to separate the PCR amplified products. 38 Table 3.3 List of DNA primers and their sequence were used in present investigation S. No . 1 2 3 4 5 6 7 8 9 10 Primer Sequence(5’-3’) and Tm value (oC) Primer Length GAGTTCAAGGAGGCCTTCTCCC (68.3) CATCTTTCTGGCCATCATGG (65.4) ATGTGCAAGGCCGGTTTCGC (73.3) TACGAGTCCTTCTGGCCCAT (65.8) GGCAAGGTCGACATCTATGC (64.5) GGCTTGCCATTCAGCTATG (63.3) GAAATTCCATATGACGGTGCATAAAAAACAG (70.8) 22 20 20 20 20 19 31 CGGGATCCCTTGTCGCCTTGCTCT (77.1) 24 ATCGCCAGGGGCGGATGTGC (77.5) ACGATGTGCTCGGCGTAC (65.4) TGCGGCATGGGCGTGTGCCATTGCTGCCTGG (91.7) CCGCTCTTGATCTGCAATTGCAGGCC (78.5) GCTCCTCAGTGCTTCTTCC (61.8) GGGAATGCCGACAAGAAGC (66.9) GAACTGGAGGCTCATCTAC (56.2) GATGATGTTGTCCATGTTG (57.1) TGCGACCCGACCAAGAACTG () CAGATGATGGTGTCGAGGCTG () GCACGCTCTTCATTGACCAG (66) CACAGTCATGCACATCAACCTG (66.6) 20 18 31 26 19 19 19 19 20 21 20 22 Reference CAL-228F CAL-737R ACT-512F ACT-782R AcdS-F AcdS-R nitrilase P1-F nitrilase PfluHisB-R hcnACa hcnACb hcnPM2 hcnPM7-26R chit33-F chit33-R nag1RT-F nag1RT-R Nag-2RT-F Nag-2RT-R Nag-2F Nag-2R Chaverri et al (2003) Carbone and Kohn (1999) Duan et al (2009) Kiziak et al (2005) Ramette et al (2003) Svercel et al (2007) Matarese et al(2010) Seidl et al (2006) Seidl et al (2006) Seidl et al (2006) 39 Expected Product size 500bp 1000bp 1052bp 587bp 571bp 130bp 146bp 1.8kb Table 3.4 Reaction mixtures used for polymerase chain reaction (PCR) with gene specific primers. Sr. No. Component Stock concentration Volume/reaction 1 DNA 40ng/ml 3µl 2 ADW - 10.5 µl 3 10X PCR Buffer 10X 2 µl 4 dNTP 1mM 2 µl 5 Primer F 10µM 1 µl 6 Primer R 10µM 1 µl 7 Taq polymerase 1 U/µl 0.5 µl Table 3.5 Thermal profile for amplification of primers Acc G Steps Activity Temperature (°C) Time (min.) 1 Initial Denaturation 95°C 3 2 Denaturation 95°C 1 3 Annealing 55°C 1 4 Extension 72°C 1 5 Final Extension 72°C 5 6 Storage 4°C ∞ Repeats 1 30 1 Table 3.6 Thermal profile for amplification of primers Actin Steps Activity Temperature (°C) Time (min.) 1 Initial Denaturation 94°C 5 1 2 Denaturation 94°C 1 30 3 Annealing 60°C 1 40 Repeats 4 Extension 72°C 1 5 Final Extension 72°C 7 6 Storage 4°C ∞ 1 Table 3.7 Thermal profile for amplification of primers CAL Steps Activity Temperature (°C) Time (min.) Repeats 1 Initial Denaturation 94°C 5 1 2 Denaturation 94°C 1 35 3 Annealing 58°C 1 4 Extension 72°C 45 sec 5 Final Extension 72°C 7 6 Storage 4°C ∞ 1 Table 3.8 Thermal profile for amplification of primers Chitinase33 Steps Activity Temperature (°C) Time (min.) 1 Initial Denaturation 94°C 3 1 2 Denaturation 94°C 1 25 3 Annealing 60°C 1 4 Extension 72°C 1 5 Final Extension 72°C 7 6 Storage 4°C ∞ 41 Repeats 1 Table 3.9 Thermal profile for amplification of primers HCN AC and HCN PM Steps Activity Temperature (°C) Time (min.) Repeats 1 Initial Denaturation 94°C 02:30 1 2 Denaturation 94°C 30 sec 30 3 Annealing 63°C 30 sec 4 Extension 72°C 1 5 Final Extension 72°C 10 6 Storage 4°C ∞ 1 Table 3.10 Thermal profile for amplification of primers NAG-1 Steps Activity Temperature (°C) Time (min.) Repeats 1 Initial Denaturation 94°C 5 1 2 Denaturation 94°C 1 30 3 Annealing 54°C 1 4 Extension 72°C 1 5 Final Extension 72°C 7 6 Storage 4°C ∞ 1 Table 3.11 Thermal profile for amplification of primers NAG-2 RT Steps Activity Temperature (°C) Time (min.) 1 Initial Denaturation 95°C 5 1 2 Denaturation 95°C 1 30 3 Annealing 63°C 1 42 Repeats 4 Extension 72°C 1 5 Final Extension 72°C 7 6 Storage 4°C ∞ 1 Table 3.12 Thermal profile for amplification of primers Nitrilase Steps Activity Temperature (°C) Time (min.) Repeats 1 Initial Denaturation 94°C 3 1 2 Denaturation 92°C 1 30 3 Annealing 65°C 1 4 Extension 72°C 2 5 Final Extension 72°C 5 6 Storage 4°C ∞ 1 3.2.14 Visualizing PCR products on native (non-denaturing) polyacrylamide gel electrophoresis (PAGE) 1. The Biorad Sequencing gel apparatus was used for PAGE of PCR products. The plates and spacers were cleaned thoroughly with three washes of distilled water, followed by two washes with 75% alcohol and then with 100% alcohol respectively. 2. 1ml bind silane (945µl Absolute ethanol, 45µl Autoclaved distilled water, 5µl Glacial acetic acid, 5µl Bind solution (3-trimethoxysilyl)) solution was applied on unnotched plated, uniformly spread by wiping with a tissue paper, and kept for drying for 10 min. 3. 1 ml of sigma cote (sigma. cat. # SL-2) was applied to the notched plate, uniformly spread with a tissue paper and kept for drying for 10 min. 43 4. Post-drying the gel plates were assembled as per manufacturer’s instructions so that the processed surfaces of both plates face each other. The comb was inserted in upside down orientation and the gel was allowed to polymerize for at least an hour. 5. To 100 ml of the 5% Polyacrylamide gel solution, 650µl of freshly prepared 10% ammonium per sulphate (APS) solution and 65 µl TEMED were added and swirled gently. The solution was gently poured in the gap between the two glass plates by taking care to prevent the formation of air bubbles using syringe. 6. The gel plates were fixed to the electrophoresis mold/gel tank and 1X TBE (running buffer) was added to the buffer chamber of the mold. 7. After one hour, the comb was removed gently without disrupting the gel line and the well was washed with TBE buffer by using a syringe. 8. The comb was inserted again to form the wells by ensuring that the teeth of comb just touched the gel line uniformly. 9. The PCR reaction mixture from PCR was mixed with 3 µl of formamide dye .3µl of each non-denatured sample was loaded and the samples were electrophoresed at a constant 800 V for 30 min. After completion of the run, the plates were allowed to cool to room temperature and then the bands were visualized by silver staining. 3.2.14.1 Silver Staining 1. After electrophoresis, the power supply was disconnected, the comb was removed and the notched plate was separated from the unnotched plate. The gel adheres to the unnotched plate coated with bind silane. 44 2. The plate transferred to a tray containing 1 liter fix/stop solution and kept for 15 min at room temperature in the solution with shaking at 90 rpm. The gel was then given a quick wash with distilled water for 30 s. 3. Then the gel plate was transferred to a tray containing 0.2% silver nitrate solution, and kept for 25 min in dark with slow shaking, followed by a quick wash with distilled water for 30 s. 4. The gel plate was then placed in the tray containing one liter developer solution and kept for 5 to 10 min until bands began to appear. After bands with detectable intensity appeared, the gel was transferred to a tray containing distilled water and rinsed for few minutes. 5. The gel was kept for air-drying and subsequently the bands were captured by scanning and/or photography 3.2.14.2 NATIVE PAGE / NON-DENATURING PAGE CBS Scientific Dual vertical unit is used for preparation of PAGE 1. Clean the glass plates thoroughly with mild detergent and wipe it with alcohol. After complete drying of plates apply gasket around the sides of rectangular back plate starting from one end. Keep the flat side of gasket on bottom side of the plate. 2. Align the notches of the gasket around the rounded corners of the glass plate. Once the gasket is pushed over the bottom edge and corners, work it down the remaining side. 3. Place the gasketed plate on flat surface with the tubing side up and place the spacers on two sides of plate (rounded corners of spacers should face outside bottom of the plate). 45 4. Place the notched plate on top of the bottom assembly and place two clamps on bottom of the plate assembly. 5. Lift the assembly and stand it on the base of the clamps. Push the plates down to level the assembly. Clamp the sides of the plates. 6. Apply PAGE solution to the gel plate sandwitch using notched beaker or syringe. 7. Insert the comb and allow the gel to solidify. 8. After 20-30 minutes disassemble the clamps (only bottom clamps) and gasket. 9. Position the plate sets in the electrophoresis unit with notched plate facing the upper buffer reservoir and clamp on sides. If running one side of dual plate assembly, use unnotched back plate to seal the open side of upper reservoir. 10. Pour freshly prepared buffer in upper and lower chambers. Remove the combs and load the gel samples mixed with dye. 11. Align the power leads, attach safety cover and connect to power supply. Run at 150-200 volts for 20-30 minutes. 12. After the run completes, switch off the power supply and disassemble the glass plates. 13. Remove the side clamps and pull notched plate outside taking into care that the gel sticks to the plane glass plate. 14. Keep the gel for staining in 1X TBE buffer containing 4µl/100ml ethidium bromide (10mg/ml stock). Stain for 5-10 minutes, rinse the gel with distilled water and visualize the bands on UV transilluminator or gel documentation system. 46 3.2.15 BUFFERs, SOLUTIONs AND REAGENTS A. Chrome Azurol assay sulphonate (CAS) solution 1. 1M FeCl3.6H2O(stock solution) Dissolved 2.703g of FeCl3.6H2O in 10ml of distilled water. 2. 1M HCl (stock) Diluted 0.86ml of conc. HCl to 10ml with distilled water 3. Iron (Ш) solution Chemicals FeCl3.6H2O Stock Concentration 1M Working concentration 1mM Volume required per 1000ml 10ul HCl 1M 1mM 100µl Mixed both the components and made up the volume to 10ml with autoclaved distilled water. 4. Chrome Azurol S solution In a beaker 60.5mg of CAS was dissolved in 50ml autoclave distilled water and mixed with 10ml Iron (Ш) solution (1mM FeCl3 .6H2O+10mM HCl) stirred and to it HDTMA solution (72.9mg dissolved in 40ml of autoclave distilled water) was added slowly. This resulted in a formation of a dark blue liquid. B. Arnow’s reagent S. No. Component Amounts(g/L) 1 Sodium nitrite 10g 2 Sodium molybdate 10g 3 distilled water 50ml 47 C. Reagents used for quantitative estimation of inorganic phosphate1. Chloromolybdic acid Dissolved 7.5g ammonium molybdate in 150ml autoclaved distilled water and mixed into 162ml conc. HCl. Made up the final volume to 1000 ml with autoclaved distilled water and stored in amber colour bottle at 4 oC. 2. Chlorostannous acid Dissolved 25g stannous chloride in 100ml conc. HCl and made up the final volume to 1000 ml with autoclaved distilled water and stored in amber colour bottle at 4 oC. D. Reagents required for estimation of chitinase activity: 1. 10 M NaOH:Dissolved 40gm of NaOH pellets in 100ml autoclaved distilled water 2. 0.7 M NaOH:Dilute 7ml of 10 M NaOH to 100 ml with autoclaved distilled water 3. 1 M sodium acetate solution:Dissolved 13.61gm of trihydrated sodium acetate (or 8.204gm of anhydrous sodium acetate) in 100ml of autoclaved distilled water. 4. 1M acetic acid solution:Dilute 6ml of glacial acetic acid to 100 ml with autoclaved distilled water. 5. 1 M sodium acetate-acetic acid buffer (pH-4.6):To prepare 100 ml of SA-AA buffer (pH-4.6) 48 ml of 1 M sodium acetate solution was mixed with 52 ml of 1 M acetic acid solution. 6. 50 mM SA-AA solution:Dilute 5 ml of 1 M SA-AA solution to 100 ml with distilled water. 7. 1% colloidal chitin in 50 mM SA-AA solution:48 Dissolved 1gm of colloidal chitin in 100ml of 50 mM SA-AA solution by continuous stirring in magnetic stirrer. 8. 1% DNSA solution in 0.7M NaOH:Dissolved 1gm of DNSA in 0.7M NaOH solution by continuous stirring in magnetic stirrer. 9. 0.125M sodium tetraborate-NaOH buffer (pH-10.7) Dissolved 4.768gm of sodium tetraborate in 80ml of autoclaved distilled water with few NaOH pellets till the pH reached to 10.7. The final volume was made upto 100ml with autoclaved distilled water. 10. p-nitrophenyl-N-acetyl-β-D-glucosaminide (pNPg) solution (1mg/ml):Dissolved 50mg pNPg in 40 ml autoclaved distilled water by gentle warming and then made upto 50ml by autoclaved distilled water. 11. 0.1M SA_AA solution:Dilute 10ml of 1M SA-AA solution to 100ml with autoclaved distilled water. E. Genomic DNA extraction buffer: 1. 1M Tris-HCl solution (pH 8) 121.1gm Tris-HCl was dissolved in 800 ml distilled water. Volume was made upto 1000 ml with distilled water and was sterilized by autoclaving after adjusting the pH to 8 with HCl. 2. 0.5M EDTA solution (pH 8.0) 186.1 gm EDTA was dissolved in 800ml distilled water. The solution was stirred vigorously on a magnetic stirrer and adjusted to pH to 8.0 by adding NaOH pellets. The final volume was made up to 1000 ml with distilled water followed by sterilizing in autoclaving. 3. Chloroform 49 4. Ethanol (100% & 70%) 5. Isoamyl alcohol. 6. 5M Potassium acetate-Acetic acid buffer. S. No. Chemicals Volume required per 100ml 1 5M Potassium acetate 10 ml 2 Glacial acetic acid 11.5Ml Mixed both the components and adjust the final volume 100ml with distilled water. (5M potassium acetate was prepared by dissolving 49.07 g of potassium acetate in 100ml autoclaved distilled water.) 7. Isopropanol. 8. DNA resuspension buffer(100ml) Tris-HCl(pH 7.5) Stock Concentration 1M Working concentration 10mM Volume required per 1000ml 1ml EDTA(pH 7.5) 0.5M 10mM 2ml SDS 10% 1% 10ml Chemicals 9. TE buffer (1 litre) (pH-8.0). 10 ml 1M Tris HCl and 2 ml 0.5 M EDTA were mixed and final volume was made up to 1000ml with autoclaved distilled water. 10. Sodium acetate (3M pH 5.2) 3M Sodium acetate was prepared by dissolving 24.61g of unhydrous Sodium acetate in 30ml autoclaved distilled water and adjusted pH 5.2 with glacial acetic acid. The final volume was made up to 100ml with autoclaved distilled water. 50 11. 20% SDS:Dissolved 20gm SDS in 100ml autoclaved distilled water.( Do not autoclaved SDS solution) 12. 5M NaCl:Dissolved 73.05gm NaCl in 200ml distilled water and made final volume upto 250ml with distilled water. (Warm water was used). 13. 1% NaCl:Dissolved 1gm of NaCl in 70ml autoclaved distilled water and made final volume upto 100ml. 14. RNase Solution (10mg/ml):Dissolved 10g RNase powder in 1ml of TE buffer by boiling. Allowed to cool at room temperature and final volume upto 250ml with distilled water.( Warm water was used). Stocks and solutions for PAGE and silver staining:1. 10X TBE:S.NO. Components Conc. required Quantity 1 Tris Base 89mM 10.8g 2 Boric acid 89mM 5.5g 3 0.5M EDTA (pH 2mM 4ml 8.0) Mixed all the components and adjusted the volume to 100ml with distilled water. 2. 1X TBE:Diluted 10ml of 10X TBE to 100ml with distilled water. 51 3. Polyacrylamide Stock Solution (40%) Dissolved 38g of Acrylamide and 2g Bis-acrylamide in 100ml of autoclaved distilled water and filtered throughWatman filter paper no.1. Stored in brown bottle in refrigerator. 4. 5% Polyacrylamide gel S. NO. Components Volume per 100 ml 1 40% Polyacrylamide 12.5ml 2 10% APS 700µl 3 TEMED 70µl Mixed all the components and adjusted the final volume to 100ml with 1X TBE solution. 5. Formamide Dye was prepared by mixing following components S. No Stock Final conc. For 10ml 1 Formamide 98% 9.8ml 2 0.5 M EDTA 10mM 200µl 3 Xylene cyanol 0.1% 0.01g 4 Bromophenol blue 0.1% 0.01g 6. Fix/Stop solution was prepared by mixing following components Sr. No. Stock For 1000ml 1 100% ethanol 100ml 2 Glacial acetic acid 5ml 3 Nanopure water 895ml 52 7. Staining Solution was prepared by mixing following components Sr. No. Stock 1 Silver nitrate 2 Nanopure water Final concentration 0.2% For 1000ml 2g 1000ml 8. Developer was prepared by mixing following components and final volume made up to 1000 ml with water Sr. No. Stock Final concentration For 1000ml 1 Sodium hydroxide 3% 30g 2 Formaldehyde 0.5% 5ml 9. Ammonium persulphate (APS) – l0% solution was prepared by mixing following components Sr. No. Component Final concentration 1 Ammonium persulphate 1.0g 2 Distilled water 10ml 10. Bind silane solution Bind Silane: (3- (Trimethoxysilyl) propyl methacrylate methacrylsaure-3 trimethoxysilyl propylester) was prepared by mixing following components. S. No. 1 Stock 100% Ethanol For 1 ml 945µl 2 Bind silane 5µl 3 Glacial acetic acid 5µl 4 Distilled water 45µl 53 CHAPTSER IV RESULT AND DISCUSSION 4.1 Analyzing root system morphology against candidate Trichoderma isolates. Ten isolates of trichoderma were evaluated in the present investigation to study the effect on root morphology of the selected genotype/ rice lines. Differential response of trichoderma isolates was observed against four selected rice genotypes Like crops are affected by abiotic stresses, microbes are also known to be affected by these conditions. However, successful deployment of these organisms in stressed ecosystems depend on their ability to withstand and proliferate under adverse environments such as drought, high temperature, salt stress, mineral deficiency, chemical and heavy metal toxicity which are major problems in rainfed agroecosystems. Microorganisms could play a significant role in stress management, once their unique properties of tolerance to extremities, their ubiquity and genetic diversity are understood and methods for their successful deployment in agriculture production are developed. These organisms also provide excellent models for understanding stress tolerance mechanisms that can be subsequently engineered into crop plants. Plant-associated microorganisms can play an important role in conferring resistance to abiotic stresses. These organisms could include rhizoplane and endophytic bacteria and symbiotic fungi and operate through a variety of mechanisms like triggering osmotic response and induction of novel genes in plants. Increase in root length as compared to control was observed in several different Trichoderma isolate vs. rice genotype treatment combinations. Table 4.1 indicate a maximum increase in the root and shoot length (in cm) as compared 54 to untreated control plants Table 4.1: Efficacy of Trichoderma isolates on different rice varieties for root and shoot length development IR-64 Sahbhagi Dhan RRF-75 IBD-1 Treatment RL SL RL SL RL SL RL SL Control 30.50±3.96 22.08±2.53 34.50±2.87 22.33±3.58 32.67±3.09 24.33±4.84 36.80±1.06 18.60±2.43 IRRI-1 30.33±3.10 17.83±2.20 25.20±0.97 13.80±1.02 34.17±3.63 23.00±1.62 30.50±2.20 18.08±3.61 IRRI-2 33.50±2.45 23.08±1.98 27.83±4.37 19.75±4.11 27.33±2.85 19.83±2.83 33.67±4.00 22.50±2.60 IRRI-3 38.00±0.00 27.00±0.00 28.00±0.00 13.00±0.00 27.67±4.99 23.67±2.62 26.58±4.31 18.08±2.07 IRRI-4 33.60±5.79 19.90±3.82 35.75±1.50 29.08±3.71 35.83±2.36 23.00±2.08 35.50±4.83 28.40±1.93 IRRI-5 33.67±3.62 25.33±3.27 36.42±2.75 24.42±2.52 36.67±2.01 17.33±2.69 30.40±0.85 28.80±2.15 IRRI-6 33.83±1.62 26.67±1.61 26.00±1.67 26.00±2.05 29.00±2.72 35.17±2.61 31.90±2.03 19.50±2.18 TH3 28.00±2.90 19.00±2.44 33.25±3.17 23.00±2.31 27.38±1.28 12.13±0.67 23.83±4.42 14.25±1.03 TV12 33.58±3.098 26.17±2.40 33.20±1.90 26.20±3.50 29.00±1.66 15.00±0.77 37.00±3.05 26.80±1.59 94a 33.50±1.38 25.17±2.41 33.40±2.01 26.40±2.97 32.75±3.37 17.50±2.07 28.92±3.17 18.33±2.56 T14 40.00±1.91 24.00±1.53 34.67±2.56 23.83±1.83 39.33±2.51 22.83±0.91 32.92±1.07 19.83±2.70 Max. 40.00±1.91 26.17±2.40 36.42±2.75 29.08±3.71 39.33±2.51 35.17±2.61 37.00±3.05 28.80±2.15 Min. 28.00±2.90 17.83±2.20 25.20±0.97 13.00±0.00 27.33±2.85 12.13±0.67 23.83±4.42 14.25±1.03 55 Figures in parenthesis indicate the increase in root length over control. As observed that trichoderma seed treatment contributes towards increased root length, (Plate no. 4.1, 4.2, 4.3) we therefore scanned the roots derived from all the treatment combination using root scanner machine Epson Perfection V700/V750, 3.81 Version, WinRhizo Reg 2009 and observations were recorded on several root parameters like total length of root, total surface area, average diameter, root volume tips and forks (Table no. 4.2 to 4.5). It shows maximum total length in IRRI-4 isolate treatment while IRRI-3 shown the maximum surface area. Similarly T14 isolate gives maximum root diameter, root volume has maximum in treatment with TV12 isolate in IR-64 rice line whereas in Sahbhagi dhan T14 and IRRI-4 shown highest total length and surface area respectively while IRRI-6 and TV12 gives most diameter and root volume. RRF-75 rice line when treated with different Trichoderma isolates they shown differences in various parameters over control IRRI-4 shown the maximum total length and surface area and root volume, while IRRI-6 shown the maximum diameter. In Indira barani dhan rice line the most effective isolates are IRRI-4, IRRI3, T14 and IRRI-6 which gives maximum increase in total length, total surface area, root diameter and root volume respectively. We hypothesized that upon trichoderma treatment trichoderma may operate through a variety of mechanisms and induce of novel genes in plants contributing toward enhanced root growth. 56 57 58 59 Table No. 4.2 Total phenotypic data for total length of root, total surface area, average diameter, root volume, tips and forks of IR-64 rice line Treatments Control IRRI-1 IRRI-2 IRRI-3 IRRI-4 IRRI-5 IRRI-6 TH3 TV12 T14 94a Max Min Total Length 379.26 362.11 449.04 452.23 457.98 431.77 450.50 419.70 434.77 426.07 433.39 457.98 362.11 Surface Area 22.48 22.93 23.84 24.11 24.02 23.62 23.74 23.33 23.72 23.47 23.52 24.11 22.48 Average Diameter (mm) 0.18 0.19 0.18 0.19 0.16 0.18 0.18 0.18 0.20 0.21 0.20 0.21 0.16 Root Volume (cm3) 0.03 0.06 0.13 0.18 0.10 0.17 0.15 0.05 0.19 0.14 0.07 0.19 0.03 Tips Forks 2068.00 2585.67 11186.00 9925.00 10543.50 11898.33 9411.33 3665.00 9583.67 6338.33 3738.33 11898.33 2068.00 1547.67 2298.67 9699.67 7802.00 7978.00 8514.33 5261.67 1700.00 5981.00 4355.67 2382.00 9699.67 1547.67 Table No. 4.3 Total phenotypic data for total length of root, total surface area, average diameter, root volume, tips and forks of Sahbhagi dhan Treatments Control IRRI-1 IRRI-2 IRRI-3 IRRI-4 IRRI-5 IRRI-6 TH3 TV12 T14 94a Max. Min. Total Length 423.80 433.74 426.87 439.17 439.28 432.97 428.78 430.92 434.32 440.26 435.57 440.26 423.80 Surface Area 23.12 23.62 23.43 23.74 23.97 23.65 22.92 23.46 23.72 23.73 23.73 23.97 22.92 Average Diameter (mm) 0.19 0.21 0.21 0.18 0.20 0.17 0.23 0.21 0.21 0.19 0.22 0.23 0.17 60 Root Volume (cm3) 0.05 0.07 0.15 0.01 0.13 0.06 0.15 0.12 0.16 0.13 0.11 0.16 0.01 Tips 2725.00 3106.00 5693.00 984.00 7049.67 5150.33 4963.50 5013.00 7295.33 7559.67 4800.33 7559.67 984.00 Forks 1854.67 2313.50 3762.00 286.00 5491.33 2546.00 5903.50 3654.33 4535.00 4440.33 3063.33 5903.50 286.00 Table No. 4.4 Total phenotypic data for total length of root, total surface area, average diameter, root volume, tips and forks of RRF-75 Treatments Control IRRI-1 IRRI-2 IRRI-3 IRRI-4 IRRI-5 IRRI-6 TH3 TV12 T14 94a Max. Min. Total Length 391.70 429.90 427.95 432.27 434.53 400.27 428.94 420.53 402.75 419.12 433.07 434.53 391.70 Surface Area 22.55 23.45 23.32 23.53 23.68 23.27 23.23 23.62 23.39 23.39 23.57 23.68 22.55 Average Diameter (mm) 0.21 0.22 0.25 0.22 0.24 0.20 0.25 0.15 0.19 0.19 0.28 0.25 0.15 Root Volume (cm3) 0.06 0.16 0.23 0.31 0.31 0.05 0.26 0.03 0.05 0.06 0.30 0.31 0.05 Tips Forks 2476.00 1630.00 8274.00 5264.00 8057.67 8514.00 12798.00 10903.00 8524.33 6826.33 2126.00 1278.33 8797.33 6506.00 2853.33 1323.33 3086.00 2035.00 2975.67 1875.67 5418.33 5055.00 12798.00 10903.00 2126.00 1278.33 Table No. 4.5 Total phenotypic data for total length of root, total surface area, average diameter, root volume, tips and forks of Indira Barani Dhan Treatments Control IRRI-1 IRRI-2 IRRI-3 IRRI-4 IRRI-5 IRRI-6 TH3 TV12 T14 94a Max. Min. Total Length 426.17 428.66 437.02 452.59 452.32 439.40 434.45 450.72 436.76 433.45 429.92 452.59 426.17 Surface Area 23.26 23.41 23.52 24.04 23.77 23.81 23.56 23.85 23.70 23.41 23.45 24.04 23.26 Average Diameter (mm) 0.22 0.22 0.25 0.21 0.20 0.16 0.19 0.24 0.21 0.26 0.22 0.26 0.16 61 Root Tips Volume (cm3) 0.04 2995.00 0.09 3581.67 0.22 6702.67 0.08 11998.50 0.19 11036.33 0.08 6609.67 0.40 1893.67 0.31 8627.50 0.19 9767.33 0.15 5389.00 0.13 4462.33 0.40 11998.50 0.04 2995.00 Forks 1112.67 2143.67 4382.00 9294.00 8558.33 3632.33 2317.50 8816.00 7692.33 3824.00 2606.00 9294.00 1112.67 4.1.1 Assessment of root pulling strength of elite rice lines Root length and diameter distribution are important characteristics to be considered when describing and comparing root systems. Root pulling force was first used in rice by O'Toole and Soemartono (1981) as an indirect estimate of root related dehydration avoidance capacity. Long fibrous roots have long been recognized as an important dehydration avoidance mechanism in rice and such roots evidently also ascribe stronger anchorage and greater resistance to pulling force. The method appears sensible for root depth phenotyping in rice, especially when other direct field methods for root selection are not very forthcoming. In the present investigation we evaluated 4 rice line / genotypes for root pulling strength. The observations of root pulling strength were recorded with the puller machine by pulling the complete one hill of rice plant after 50 days and it was observed that Root Pulling Strength (RPS) varied from 52.5±0.50 to 38.5±2.63 for rice line IR-64. In Sahbhagi dhan rice line it was varied from 48.50±0.82 to 38.25±2.39. Rice line RRF-75 shown the root pulling strength between 50±0.82 to 37.25±2.87. Whereas Indirabarani dhan line shown 47±1.58 to 39.5±2.75 (Table 4.6). Root pulling resistance is the vertical force required to pull a plant from the soil and this technique has been widely used to assess the nature of root development in cereal crops (Nass and Zuber, 1971). The method appears sensible for root depth phenotyping in rice, especially when other direct field methods for root selection are not very forthcoming. Several root characteristics in rice are associated with drought tolerance and other biotic-abiotic stresses and avoidance capability of plants. 62 Table No. 4.6 Root Pulling Strength (RPS) Treatment/Varities IR-64 Sahbhagi Dhan RRF-75 Control 39.75±2.21 38.25±2.39 37.25±2.87 IRRI-1 41±3.11 47±2.38 44±2.94 IRRI-2 52.5±0.50 47±1.29 45.25±2.29 IRRI-3 45.5±4.35 46.75±2.87 47.75±1.65 IRRI-4 50±0.82 44.5±3.86 38.5±2.75 IRRI-5 45±1.73 45±3.51 39.5±3.69 IRRI-6 38.5±2.63 41.5±4.03 39±2.38 TH3 42.5±2.63 39.5±2.06 36±1.83 TV12 46±2.94 45.5±0.96 45±2.52 T14 46±2.58 45±2.65 44±3.83 94a 46.5±1.26 48.50±0.82 50±0.82 Max 52.5±0.50 48.50±0.82 50±0.82 Min 38.5±2.63 38.25±2.39 37.25±2.87 IBD-1 39.5±2.75 46±4.08 44.5±1.50 47±1.58 40.5±2.75 44±1.83 41±2.38 41.5±1.26 42±3.74 43.5±2.87 46.75±1.70 47±1.58 39.5±2.75 4.2 Qualitative assay for ACC deaminase activity Ali et. al. (2013) found that isolate SorgP4 utilized ACC as a sole source of nitrogen by the production of ACC deaminase enzyme and it showed the greater amount of ACC deaminase activity (3.71 ± 0.025 μM/mg protein/h of α-ketobutyrate) under non-stress and 1.42 ± 0.039 μM /mg protein/h of α-ketobutyrate under drought stress condition respectively. Similar results were obtained by Grichko & Glick, 2000 where strain produced significant amount of Acc deaminase enzyme (3.8 ±0.7 μM/mg protein/h of α-ketobutyrate). All the 10 isolates were screened for ACC deaminase based on the enrichment method, where ACC was used as the sole nitrogen source. All the isolates were found to be positive as they were able to grow on Petri plates containing Synthetic media utilizing ACC as sole nitrogen source and on plates containing (NH 4 )2 SO4 which served as positive control. The isolates could not grow on plates containing only synthetic media without ACC which served as negative control (Plate no. 4.4) 63 64 4.2.1 Quantitative estimation of ACC deaminase Since all the isolates were able to grow on petri plates containing synthetic media supplemented with ACC, therefore all were selected for quantitative estimation of enzyme activity. The ACC deaminase activity was assayed by quantifying the amount of α-ketobutyrate produced during the deamination of ACC by the enzyme ACC deaminase. Quantification of enzyme activity showed wide variations and differed statistically from one isolate to the other both at 1% and 5% level of significance. All the isolates showed activity in the range of 10.46±3.92 to 2.37±1.37 µmol α ketobutyrate/mg protein/h (Table 4.7, Figure 4.1). The isolates were placed in high, medium and low ACC deaminase activity producing groups. Isolates IRRI-1, IRRI-2, IRRI-3, and TV12 were placed in high enzyme activity group while isolates IRRI-4 in medium enzyme activity group. Similarly, isolates IRRI-6, TH3, T14 and 94a were placed in low enzyme activity group. Isolate TV12 showed the highest amount of ACC deaminase activity (10.46±3.92 µmol α ketobutyrate/mg protein /h) while isolate T14 showed lowest (2.37±1.37 µmol α ketobutyrate/mg protein /h). Table no. 4.7: Screening isolates of Trichoderma spp. for ACC deaminase activity Isolates IRRI-1 IRRI-2 IRRI-3 IRRI-4 IRRI-6 TH3 TV12 T14 94a Conc. 5.75±0.37 5.86±0.20 9.10±1.28 4.25±0.45 2.66±0.13 2.92±0.39 10.46±2.77 2.37±0.97 2.84±0.96 65 µmol α ketobutyrate/mg protein/hr 14 12 10.46 10 9.1 8 6 5.75 5.86 4.25 4 2.66 2.92 2.37 2.8 T14 94a 2 0 IRRI-1 IRRI-2 IRRI-3 IRRI-4 IRRI-6 TH3 TV12 Treatments Fig. No. 4.1 Estimation of ACC deaminase activity by different Isolates of trichoderma 4.3 Screening of Isolates of Trichoderma spp. for chitinase activity Ten isolates of Trichoderma spp. were screened for their ability to hydrolyse chitin and were then grouped according to the diameter (mm) of the purple coloured zone observed. (Plate No. 4.5) Isolates of trichoderma spp. used in the present investigation showed variable responses for chitinase expression (Table 4.8, Table 4.9) for utilization of colloidal chitin supplemented as substrate in the agar medium. Isolates with high chitinase activity are the isolates of choice for their application as biological control agent and were also identified after screening on colloidal chitin supplemented as substrate in the agar medium High chitinase activity observed in #IRRI-1, #IRRI-2, #IRRI-3, #TV12, #T14 and #94a that was, 192.5 mg/ml, 176.25 mg/ml, 177.5 mg/ml, 187.5 mg/ml, 165.0 mg/ml, 141.25 mg/ml respectively. Medium chitinase activity was observed for #IRRI-4, IRRI-6 and TH3 111.25 mg/ml, 75 mg/ml, 68.75 mg/ml respectively. No isolate was observed with low chitinase activity. Trichoderma isolate #94a and IRRI-6 measured (70 mm radial diameter) (Fig.4.2,4.3). Fungal Strains assigned to the genera trichoderma are well known 66 producers of chitinolytic enzymes and are used commercially as sources of these proteins. Additional interest in these enzymes is stimulated by the fact that chitinolytic strains of Trichoderma are among the most effective agents for biological control of plant diseases and can be serious pathogens. (Chet, 1987; Harman, 1990; Harman et al., 1993; Komatsu, 1976; Muthu meenakshi et al., 1994; Samuels, 1996). Trichoderma directly attacks the plant pathogen by excreting lytic enzymes such as chitinases, ß-1,3 glucanases and proteases (Haran et al., 1996). Because the skeleton of filamentous fungi cell walls contains chitin, glucan and proteins, enzymes that hydrolyze these components have to be present in a successful antagonist in order to play a significant role in cell wall lysis of the pathogen (Lorito et al. 1994; Carsolio et al. 1999). Several distinct chitinolytic enzymes have been reported in T. harzianum (De la Cruz et al., 1992; Haran et al. 1996). These include endochitinases, exochitinases and 1,4-ß-N-acetylglucosaminidases, which are induced during growth of T. harzianum in liquid medium containing chitin as carbon source. Table No. 4.8 Screening of Isolates of Trichoderma spp. for chitinase activity Isolates Chitinase activity IRRI-1 192.5±22.50 IRRI-2 176.25±6.25 IRRI-3 177.5±10.001 IRRI-4 111.25±3.75 IRRI-6 75±2.50 TH3 68.75±8.75 TV12 187.5±12.50 T14 165±10.001 94a 141.25±1.25 67 250 200 192.5 176.25 187.5 177.5 165 141.25 µg/ml 150 111.25 100 75 68.75 50 0 IRRI-1 IRRI-2 IRRI-3 IRRI-4 IRRI-6 Isolates TH3 TV12 T14 94a Fig. No. 4.2 Quantitative estimation of Chitinase activity (Procedure I) (µg ml-1) produced by different isolates of Trichoderma spp. in colorimeter (OD-582 nm) Table no. 4.9 : Screening of Isolates of Trichoderma spp. for chitinase activity Isolates Chitinase activity IRRI-1 0.0757±0.00033 IRRI-2 0.0810±0.00028 IRRI-3 0.0820±0.00033 IRRI-4 0.0858±0.00066 IRRI-6 0.0783±0.00609 TH3 0.0772±0.00143 TV12 0.0765±0.00094 T14 0.0400±0.00036 94a 0.0734±0.00005 68 69 0.1000 Chitinase activity in µg/ml 0.0900 0.0800 0.0810 0.0820 0.0858 0.0783 0.0772 0.0765 0.0757 0.0734 0.0700 0.0600 0.0500 0.0400 0.0400 0.0300 0.0200 0.0100 0.0000 IRRI-1 IRRI-2 IRRI-3 IRRI-4 IRRI-6 Isolates TH3 TV12 T14 94a Fig. No. 4.3 Quantitative estimation of Chitinase activity (Procedure II) (µg ml-1 ) produced by different isolates of Trichoderma spp. in colorimeter (OD-400 nm) 4.4 Qualitative and quantitative assay for siderophore production In soil, plant roots normally coexist with bacteria and fungi which may produce siderophores capable of sequestering the available soluble iron and hence interfere with plant growth and function. Siderophores are produced during extreme iron-depleted conditions for the solubilization of extracellular ferric iron by most bacteria and fungi. In the present investigation, ten isolates of Trichoderma were screened by six different siderophore assay viz., CAS assay, CAS agar medium, Hydroxyquinoline test, Tetrazolium test, FeCl3 tests and Arnow’s assay. CAS assay is the universal assay for detection of siderophores. The principle of this assay is based on a color change of CAS from blue to orange resulting from siderophoral removal of Fe from the chrome azurol dye (Guan et al., 2001). All the isolates showed positive reaction on CAS agar plate. The diameter of orange halo due to production of siderophore by 70 the isolates ranged from 21 to 49 mm with maximum halo produced by TV12 (49 mm). The minimum halo was produced by isolate T14 (21 mm) (Table 4.10). For selection of Trichoderma isolates with high ability to produce siderophore, isolates were inoculated on PDA supplemented with a strong chelater 8 Hydroxyquinoline. All the isolates are not able to grow on this medium. Arnow’s assay was performed to detect catechol type of siderophores. Slight colour change in the media was observed by only by three isolates IRRI-2, IRRI-6 and 94a indicating that they produced catechol type of siderophore. All isolates produced deep red colour on addition of Tetrazolium salt and NaOH which used to test presence of hydroxamate type of siderophore, indicating that the isolates have capacity to reduce tetrazolium salt by hydrolysis of hydroxamate group in presence of strong alkali. However, FeCl3 test was negative for all the isolates. Carboxylate type of siderophore was determined by spectrophotometric test and the percentage of siderophore unit ranged from1.83 to 24.58%. Among the ten isolates, isolate 94a produced highest percent (24.58) of siderophore units. Minimum siderophore unit was observed for isolate TH3 (1.83%) (Figure 4.4) 71 Table No. 4.10: Production of various siderophores by Trichoderma isolates S.No Isolates % siderophore units CAS test (diameter of orange colormm) Arnow’s test (development of pink color) FeCl3 test (instant development of deep red color) Tetrazolium test (instant development of deep red color) HQ test 1 IRRI-1 2.28 Negative Slightly positive Negative positive Negative 2 IRRI-2 18.95 3.5 Slightly positive Negative positive Negative 3 IRRI-3 2.42 4.3 Negative Negative positive Negative 4 IRRI-4 2.82 Negative Slightly positive Negative positive Negative 5 IRRI-5 Negative Negative positive Negative 6 IRRI-6 2.59 Negative Slightly positive Negative positive Negative 7 TH3 1.83 Negative Negative Negative positive Negative 8 TV12 6.60 4.9 Negative Negative positive Negative 9 94a 24.58 4.4 Slightly positive Negative positive Negative 10 T14 14.71 2.1 Positive Negative positive Negative 72 % Sidrophore production 30 24.58 25 18.95 20 14.71 15 10 5 6.60 2.28 2.42 2.82 2.59 1.83 0 IRRI-1 IRRI-2 IRRI-3 IRRI-4 IRRI-6 TH3 TV12 T14 Isolates 94a Fig. No. 4.4 Quantitative estimation of % Sidrophore production by different isolates of trichoderma spp. 4.5 Screening isolates of Trichoderma spp. for in vitro phosphate solubilization ability Phosphate solubilization efficacy of isolates of trichoderma spp. was performed on Pikovaskaya broth medium. By preparing standard curve the amount of inorganic phosphate solubilised by different Trichoderma isolates were estimated at wavelength 610nm. Screening of isolates showed variation in their ability to utilized calcium phosphate supplemented in different nutrient constituents. Quantitative estimation of phosphate solubilization, carried out after incubation of 7 days, is presented (Table 4.11, Figure 4.5). Some of the fungal isolates (#T14) showed significantly good response to phosphate solubilization where as some was not good solubilizer of phosphate. Qualitative estimation done on agar medium containing BCP as a colour indicator it changes color purple to yellow (Plate no. 4.5). Phosphorus in the soil is essentially unavailable to the plants and use of plant associated organisms may help in solubilization of mineral Phosphate (P) for easy uptake by the plants. Fungi are reported to solubilize P by production of organic acids and are known to 73 have a higher efficiency of solubilization than bacteria. It was observed that #T14 isolates showed higher ability to solublized the phosphate as they also exhibited good responses to PGPR activity after direct seed treatments. Higher efficacy of Trichoderma isolates to utilized calcium phosphate varied and was enumerated as follows 1) Trichoderma isolate (#T14) exhibited higher phosphate solubilising ability in pikovaskaya broth media used for screening and therefore can be considered as promising inducer of phosphate mobilization. The amount of inorganic phosphate solubilised was 780 µg mL -1. 2) Other Trichoderma isolates i.e #IRRI-1, #IRRI-2, #IRRI-3, #IRRI-6 and also a good phosphate solubilizer that they solubilized 455µg mL-1 , 603 µg mL-1, 485 µg mL-1 , 542 µg mL-1 , respectively. 3) Trichoderma isolate (#TH-3) showed good phosphate solubilising ability (403 µg mL-1) in pikovaskaya broth media as compare to control. Isolate #94a produced (397 µg mL-1) and #Tv12 produced (451µg mL-1) phosphate in media. µg mL-1. Phosphatases play a key role in transforming organic forms of phosphorus into plant available inorganic forms and are found to be active in microorganisms, plants and roots. A significant correlation had been noticed between the depletion of organic P and phosphatase activity in the rhizosphere soil of wheat (Tarafdar and Jungk, 1987). Simultaneous exudation of organic acids and phosphatases could increase both P solubility, by releasing bound organic phosphates and its mineralization by increasing the rate of hydrolytic cleavage (George et al., 2002). Satyavani and Satyaprasad, (2009) demonstrated that two species of Trichoderma viz., T. harzianum and T. aureoviride isolated from rhizosphere of pigeon pea promoted plant growth so 74 to understand the role of Trichoderma in growth promotion, the ability of Trichoderma spp. in solubilizing rock phosphate was tested in vitro. Culture filtrates of both species solubilized rock phosphate in which T.harzianum was more effective than T.aureoviride in solubilizing phosphates and producing fungal biomass. For example, Trichoderma harzianum was shown to solubilize phosphate and micronutrients that could be made available to plant (Altomore et al., 1999). Table 4.11 Screening isolates of Trichoderma spp. in vitro for phosphate solubilizing ability Isolates IRRI-1 Inorganic phosphate solubilized (ug/ml) 455 IRRI-2 603 4.540 IRRI-3 485 4.120 IRRI-4 42 4.060 IRRI-6 542 4.360 TH3 403 5.190 TV12 451 5.160 T14 780 3.940 94a 397 4.900 Control 42 4.700 75 pH of the culture media 4.810 900 780 800 700 603 µg/ml 600 500 455 542 485 403 400 451 397 300 200 100 42 42 0 Isolates Fig. No. 4.5 Quantitative estimation of inorganic phosphate solubilization (µg/ml) by different isolates of Trichoderma spp. in colorimeter (OD-610 nm) 4.6 Quantification of indole acetic acid (auxin) production by Trichoderma spp. Laboratory studies have emphasized on use of (plant growth promoting fungi) PGPF as biocontrol agents (Hossain et al., 2007) and the role of auxin (IAA) production (Contreras-Cornejo et al., 2009) in plant growth promotion. Production of IAA was evaluated for ten different isolates of Trichoderma spp. in DF salts culture medium amended with 1.02 g/L from 5mM stock of L-tryptophan as precursor molecule and without any IAA precursor as control. The mixture of culture supernatant and salkowski’s reagent was incubated at room temperature for 20 min and the absorbance was measured at 535 nm. The concentration of IAA compound was evaluated by comparison with a standard curve prepared using serial dilutions (0 100 µg/ml) prepared from commercially available IAA. Interpolation of the colorimeter readings with standard curve were used to quantify the amount of IAA produced by different isolates of Trichoderma in the media which ranged from 0.36 to 29.09 µg/ml (Table 4.12, Figure 4.6). The highest IAA was produced by Trichoderma isolate #T14 (29.09µg/ml) which is significant high where as isolate #TH3 (0.36µg/ml) was the lowest producer. Fungal isolate #IRRI-1, IRRI-2 and #94a were 76 also identified as promising producers of Indole acetic acid 8.36µg/ml, 18.81µg/ml and 7.72µg/ml respectively. Isolate #IRRI-3, #TH3, and TV12 was produced Indole acetic acid 0.54µg/ml, 0.36µg/ml, 1.09µg/ml respectively which is low than other fungal isolates. Microbial IAA could be involved in the growth stimulation observed in our greenhouse assay. Production of plant growth regulators by the microorganisms is another important mechanism often associated with growth stimulation (Vessey, 2003). The balance between vegetative and reproductive growth is controlled by hormone signaling within the plant and can therefore be highly influenced by it (Taiz and Zeiger, 1991). At relatively high concentrations, natural auxins, such as IAA, stimulate shoot elongation and root induction while reducing root elongation (Tanimoto, 2005). Trichoderma spp. have been also shown to exhibit plant growthpromoting activity on numerous cultivated plants (Kleifeld and Chet, 1992; Ousley et al.,1994; Altomare et al., 1999; Harman, 2000; Yedidia et al.,2001). Gravel et al (2007) in his results, showed that P. putida subgroup B strain 1 and T. atroviride are able to synthesize IAA from different precursors in vitro, which supports the theory that microbial IAA could be involved in the growth stimulation observed in our greenhouse assay. 77 Table 4.12 Efficacy of different Trichoderma spp. for IAA production Isolates pH of the culture media IAA produced (ug/ml) IRRI-1 6.92 8.36 IRRI-2 6.88 18.81 IRRI-3 6.51 0.54 IRRI-4 6.73 6.18 IRRI-6 8.15 3.54 TH3 7.94 0.36 TV12 6.44 1.09 T14 6.41 29.09 94a 6.91 7.72 Trichoderma inoculation affected root system architecture, which was related to increased yield of plants. Reported effects include enhanced root biomass production and increased root hair development (Bjorkman et al., 1998; Harman et al., 2004) help the plants to grown in adverse condition such as drought stress. The root system is important for plant fitness because it provides anchorage, contributes to water-use efficiency and facilitates the acquisition of mineral nutrients from the soil (Lopez-Bucio et al., 2005). Many lines of evidence strongly support a role for auxin in the regulation of root system architecture. The production of plant growth hormones or analogues is another mechanism by which strains of Trichoderma (T14, IRRI-1, IRRI-4) can enhance plant growth. 162 species of fungi have been reported to produce auxins, which are key hormones effecting plant growth and development that can be produced by fungi in both symbiotic and pathogenic interactions with plants (Gravel et al., 2007). 78 IAA production in ug/ml 35 29.09 30 25 18.81 20 15 10 8.36 7.72 6.18 3.54 5 0.36 1.09 IRRI-1 IRRI-2 IRRI-3 IRRI-4 IRRI-6 TH3 Isolates TV12 0.54 0 T14 94a Fig. No. 4.6 Quantitative estimation of IAA (µg ml-1) produced by different isolates of Trichoderma spp. in colorimeter (OD-535 nm) 4.7 Screening of different isolates of Trichoderma spp. for hydrogen cyanide production In the present investigation twenty isolates of Trichoderma spp. were screened for its ability to produce hydrogen cyanide. The production of hydrogen cyanide by trichoderma spp. was screened using glycine as its precursor molecule. The plates were incubated for 7 days at 28±2°C and observations were measured as colour of filter paper turning to brown measured as positive for HCN production. Isolate #IRRI4, #IRRI-6, #IRRI-2, #94a were observed as positive for its ability to produce HCN (Plate 4.6). Microbial cyanogenesis has been demonstrated in many species of fungi (Hutchinson et al., 1973), but only in a few species of bacteria in the genera Chromobacterium and Pseudomonas (Michaels and Corpe, 1965; Patty, 1921). Glycine has usually been the indicated precursor of cyanide in fungi and bacteria (Brysk et al., 1969; Ward et al., 1971; Wissing et al., 1974). 79 80 4.8 PCR amplification of Trichoderma isolates using different types of primers Genomic DNA extracted from different isolates of Trichoderma were subjected to polymerase chain reaction using different types of primers as detailed below. Table No. 4.13: Details of PCR primers used in the present study S. No. Primers Reference Sequence(5’-3’) and Tm value (oC) 1 CAL-228F CAL-737R ACT-512F ACT-782R AcdS-F AcdS-R nitrilase P1-F nitrilase PfluHisB-R hcnACa hcnACb hcnPM2 hcnPM7-26R chit33-F chit33-R nag1RT-F nag1RT-R Nag-2RT-F Nag-2RT-R Nag-2F Nag-2R Chaverri et al (2003) Carbone and Kohn (1999) Duan et al (2009) Kiziak et al (2005) Ramette et al (2003a) Svercel et al (2007) Matarese et al (2010) Seidl et al (2006) Seidl et al 2006 GAGTTCAAGGAGGCCTTCTCCC (68.3) CATCTTTCTGGCCATCATGG (65.4) ATGTGCAAGGCCGGTTTCGC (73.3) TACGAGTCCTTCTGGCCCAT (65.8) GGCAAGGTCGACATCTATGC (64.5) GGCTTGCCATTCAGCTATG (63.3) GAAATTCCATATGACGGTGCATAAAAAACAG(70.8) CGGGATCCCTTGTCGCCTTGCTCT (77.1) ATCGCCAGGGGCGGATGTGC (77.5) ACGATGTGCTCGGCGTAC (65.4) TGCGGCATGGGCGTGTGCCATTGCTGCCTGG (91.7) CCGCTCTTGATCTGCAATTGCAGGCC (78.5) GCTCCTCAGTGCTTCTTCC (61.8) GGGAATGCCGACAAGAAGC (66.9) GAACTGGAGGCTCATCTAC (56.2) GATGATGTTGTCCATGTTG (57.1) TGCGACCCGACCAAGAACTG () CAGATGATGGTGTCGAGGCTG () GCACGCTCTTCATTGACCAG (66) CACAGTCATGCACATCAACCTG (66.6) 2 3 4 5 6 7 8 9 10 Seidl et al 2006 81 Primer Length 22 20 20 20 20 19 31 24 20 18 31 26 19 19 19 19 20 21 20 Expected Product size 500bp 1000bp 1052bp 587bp 571bp 130bp 146bp 1.8kb 22 4.9 Amplification of actin and calmodulin genes in Trichoderma isolates Calmodulin (CaM) (an abbreviation for CALcium-MODULated proteIN) is a calcium-binding messenger protein expressed in all eukaryotic cells. CaM is a multifunctional intermediate messenger protein that transduces calcium signals by binding calcium ions and then modifying its interactions with various target proteins (Stevens 1983, Chin and Means 2000). Actin is a globular multi- functional protein that forms microfilaments. It is found in all eukaryotic cells. Actin participates in many important cellular processes, including muscle contraction, cell motility, cell division and cytokinesis, vesicle and organelle movement, cell signalling, and the establishment and maintenance of cell junctions and cell shape. Primer pairs CAL-228F & CAL-737R and ACT-512F & ACT-782R were used to amplify a portion of the calmodulin (CAL) gene including two introns and a portion of the actin (ACT) gene including one intron. Both the primers amplified specific size fragments (~340bp actin and ~500bp calmodulin) (Plate no.4.7) in all the isolates. Both the genes are of phylogenic and taxonomic importance and used for sequencing and species identification in the way similar to internal transcribed spacers ribosomal DNA (ITS rDNA) and translation elongation factor-1a (EF-1a).These genes serve as house-keeping genes and used during expression analysis such as that of chitinases, cellulases, N-acetyl glucosaminases etc. 4.10 In vitro detection of ACC deaminase producing Trichoderma isolates using gene-specific primers Certain plant growth promoting rhizobacteria (PGPR) contain a vital enzyme, 1aminocyclopropane-1-carboxylic acid (ACC) deaminase (EC 4.1.99.4), which regulates ethylene production by metabolizing ACC (an intermediate precursor of 82 83 ethylene biosynthesis in higher plants) into α- ketobutyrate and ammonia. This pyridoxal phoshphate enzyme was first isolated in 1978 from pseudomonas sp. strain ACP and from the yeast Hansenula satrunus (Honma and Shimonura 1978); since then, it has been detected in fungi and in a number of other bacteria. When ACC deaminase-containing plant growth-promoting bacteria are bound to a plant, they act as a sink for ACC ensuring that plant ethylene levels do not become elevated to the point. ACC deaminase-containing plant growth-promoting bacteria up-regulate genes involved with plant growth and protein production while down-regulating plant genes involved with ethylene stress and defence signaling pathways (Hontzeas et al. 2004). This enzyme facilitates plant growth as a consequence of the fact that it sequesters and cleaves plant produced ACC, thereby lowering the level of ethylene in the plant. In turn, decreased ethylene levels allow the plant to be more resistant to a wide variety of environmental stresses, all of which induce the plant to increase its endogenous level of ethylene; stress ethylene exacerbates the effects of various environmental stresses. Enzymatic activity of ACC deaminase is assayed by monitoring the production of either ammonia or α-ketobutyrate, the products of ACC hydrolysis. ACC deaminase has been found only in microorganisms, and there are no microorganisms that synthesize ethylene via ACC (Fukuda et al. 1993). Interestingly, this enzyme is cytoplasmically localized so that the substrate ACC must be exuded by plant tissues and subsequently taken up by an ACC deaminase-containing microorganism before it is cleaved (Glick et al 1998). Screening of isolates for the presence of acdS gene was done using primer pair acdS. The results of the PCR analysis with primer pair AcdS-F & AcdS-R indicated that a DNA fragment approximately 1500 bp in size was obtained in all Trichoderma 84 85 isolates. Amplification of acdS gene gives the proof for the presence of gene in the form of 1.5 to 1.7 kb gel band. Additional band of 1270 bp was also observed in all the isolates (Plate no.4.8). ACC deaminase producing microbes are known to facilitate the growth of a variety of plants especially under stressful conditions such as flooding, heavy metals, high salt and drought so, the acdS gene coding for enzyme ACC deaminase can be a very useful candidate gene for the development of transgenics for abiotic stress management in plants. 4.11 In vitro detection of Nitrilase producing Trichoderma isolates using genespecific primers Nitrilase enzymes (nitrile aminohydrolase; EC 3.5.5.1) catalyse the hydrolysis of nitriles to carboxylic acids and ammonia, without the formation of "free" amide intermediates. Nitrilases are involved in natural product biosynthesis and post translational modifications in plants, animals, fungi and certain prokaryotes. Nitrilase is also involved in synthesis of IAA (via an alternate pathway) by hydrolysis of indole-3-acetonitrile (Mahadevan, 1963). A large number of various nitrilases have been purified and characterized in bacteria, but only a few in eukaryotic organisms (plants and filamentous fungi) (O’Reilly and Turner 2003; Vejvoda et al, 2010). The forward primer P1 and the reverse primer PfluHisB which were used to amplify a 1052bp fragment containing the nitrilase gene in Pseudomonas fluorescens EBC191 by Kiziak et al, (2005) was used to amplify nitrilase gene in Trichoderma isolates. In the present investigation 1000, 900 and 800bp fragments were obtained in all the isolates whereas additional bands of 400 and 280bp were also obtained in all the isolates except IRRI-3 and T14. Intense bands below 100bp was observed in all the isolates as well (Plate no.4.9) 86 In trichoderma sp. nitrilase serves defend against cyanide produced by R. solani, but this has not yet been proven so far. Its expression may be a general response of Trichoderma towards the presence of any host, but this clearly needs further investigations (Atanasova et al, 2013). 4.12 In vitro detection of hydrogen cyanide producing Trichoderma isolates using gene-specific primers HCN production ability has been found to be associated with effective disease suppression ability in different pathosystems. Prior studies have suggested that HCN may be a distinctive marker for deleterious soil microorganisms (Schippers et al., 1990; Paszkowski & Dwornikiewicz, 2003; Benizri et al., 2005), and, in fact, HCNproducing bacteria have been exploited for weed biocontrol (Kremer & Souissi, 2001; Owen & Zdor, 2001). In fact, it is not uncommon for certain plant-beneficial traits to be also found in deleterious bacteria (Blaha et al., 2006). In the present investigation isolates of trichoderma were amplified with two HCN specific primers of Pseudomonas sp. amplifying partial segments of HCN gene (infact operon) Part (i.e. 587 bp) of the hcnBC genes should be amplified by PCR using primers hcnAC-a & hcnAC-b as described by Ramette et al., 2003a whereas a 571 bp fragment of hcnAB was supposed to be amplified with primers hcnPM2 & hcnPM7-26R (Svercel et al 2007). In the present investigation primer hcnAC-a & hcnAC-b resulted in amplification of >1500bp fragment in isolates IRRI-2, IRRI-3 and Tv12 along with 120bp fragment in all the isolates of Trichoderma (Plate no. 4.10). However with primer hcnPM2 & hcnPM7-26R amplification was not observed in any of the isolates. 87 88 4.13 Amplification of chitinase genes in Trichoderma isolates using gene-specific primers Cell wall degrading enzyme (CWDE) genes from biocontrol fungi belonging to the genus trichoderma have been demonstrated to encode proteins with high antifungal activity against a wide range of plant pathogenic fungi. The characterisation of endochitinase genes of Trichoderma spp., whose expression is strongly enhanced during mycoparasitism, as well as induced by chitin and lightinduced sporulation is performed using different primers. In the present investigation, four different chitinase gene specific primers (Chit33, Nag1, Nag1RT, Nag2RT) were used to analyse amplification of chitinase genes in Trichoderma isolates. Primer Chit33 amplified fragments of 900 and 220 bp in all the isolates with an additional small fragment of approx. 60bp size (Plate no.4.11). Nag-1 primer gave products of different sizes ranging from 150 to 1700bp. Fragment size 1500 bp was observed only in isolates IRRI-2, IRRI-3, Tv12 and T14 whereas fragments of 470, 300 and 220 bp was observed in all the isolates under investigation. Amplification with primer Nag1-RT resulted in expected bands of 145bp in all the isolates (Plate no. 4.12) whereas an expected 150 bp fragment was amplified with primer Nag2-RT only in isolates IRRI-2, IRRI-3, Th3, Tv12 and T14 (Plate no 4.13). 4.14 In-silico analysis of root related QTLs Drought stress is the major constraint to rice (Oryza sativa) production and yield stability in rainfed ecosystems. Identifying genomic regions contributing to drought resistance will help to develop rice cultivars suitable for rainfed regions through molecular marker-assisted breeding. One of the most exciting developments in rice biotechnology is the advent of molecular markers. 89 90 91 Molecular markers help to track the genetic loci controlling drought-resistance traits without having to measure the phenotype, thus reducing the need for extensive field testing over space and time (Nguyen et al. 1997). Once the tightly linked markers have been identified, the QTLs can be selected for in breeding programs. The root trait was an important trait to resist plants in drought stress. It was noticed that the deep, thick, branched root system was good to grown rice plants in adverse stress conditions, so the identification of the genomic region for root traits was an important to develop a variety resistance to drought stress. In the present investigation the in silico analysis of root related QTLs was done for identification of chromosome region responsible for different root parameters including root length (RL), root volume (RV), total root numbers (TRN), penetrated root thickness (PRT), penetrated root dry weight (PRDW), deep rooting (DR) using various bioinformatics tools. Using the online Nipponbare BAC/PAC map (Oryza sativa L.) information, QTL regions were identified. In rice, a dihaploid, RIL population derived from two cultivars provides a useful references population for in silico analysis of QTLs. Table 4.14 Details of in silico analysis of root related QTLs on chromosome number #09 and #02 QTL trait Root Length (RL) Deep Rooting (DR) Penetrate Root Thickness (PRT) Root Length (RL), Root Volume (RV), Total Root Number(TRN) 9 Flanking cM North clone South clone marker RZ20636-55.3 P0711F01 OJ1299_A11 RZ422 RM24393- 58.3-60.8 OJ1081_G10 OJ1123_B08 RM7424 9 ME9_6K985 Ch. # 9 63-69.5 B1045B05 Hemamalini et al (2000) Yusaku Uga et al (2011) OSJNBa0087J09 Zang et al (2001a) S20944S- 57.9-77.8 OJ1288_D09 E0508B05 E30251S 2 92 Referances Hemamalini et al (2000) 93 94 95 96 Through in silico analysis five QTLs were identified on chromosome number #09 and one on chromosome number #02. The three QTLs on chromosome #09 were identified in silico between the flanking markers RZ206 and RZ422 covering a distance 19.3 cM. The region of 36 cM to 55.3 cM on this chromosome govern by Root Length (RL) having flanking markers RZ206 and RZ422 on P0711F01 and OJ1299_A11 BAC/PAC clone respectively. The QTL for penetrate root dry weight was identified by Nguyen et al (2004) and for the same trait the QTL was identified in the Ct9993 rice population by Zhang et al (2001). From this references the in silico analysis was done that showed the region from 40.7 cM to 50.7 cM on chromosome number #02 having flanking markers RM41 and ME2_10 govern by root parameter i.e. penetrate root dry weight. The BAC/PAC clone on which flanking markers present was P0711A01 and P043D11 (Plate 4.14). The next QTL was identified on same chromosome (#09) for the root parameter deep rooting (DR), this QTL region span the 2.5 cM distance with flanking markers was RM24393 and RM7424 present on OJ1081_G10 and OJ1123_B08 respectively. This QTL region cover the distance from 58.3 cM to 60.8 cM which is very short region govern by this trait (Plate 4.15). On the same chromosome, the distances 6.5 cM govern by root trait Penetrate Root Thickness (PRT). The distance from 63.0 cM to 69.5cM with flanking markers E61594S and C670SA on B1342C04 and OSJNBa0046G BAC/PAC clone respectively (Plate 4.16). The first time this QTL region was identified by Zang et al, (2001) derived from CT9993 rice population. The QTL on chromosome #02 was first identified by Hemamalini et al in 2000 associated with number of root traits including Root Length (RL), Root Volume (RV), 97 Total Root Number (TRN) in IR64×Azucena derived population. In silico analysis of chromosome number #02 revealed that the whole QTL region of 57.3 cM to 81.0 cM with flanking markers S209445 and E302515 govern by above root parameters. This major QTL region covered total 23.7 cM distance. The flanking marker for this QTL was present on OJ1288_G09 (S209445) and P0508B05 (E30251S) (Figure 4.17). 98 CHAPTER V SUMMARY, CONCLUSION AND SUGGESTION FOR FUTURE RESEARCH WORK Every plant part have unique function as they performed in that the plant root have a large range of functions, including acquisition of water and nutrients, as well as structural support. Dissecting the genetic and molecular mechanisms controlling rice root development is critical for the development of new rice ideotypes that are better adapted to adverse conditions and for the production of sustainably achieved rice yield potential. Increased incidences of abiotic and biotic stresses impacting productivity in principal crops are being witnessed all over the world. Microorganisms could play a significant role in this respect, if we can exploit their unique properties of tolerance to extremities, their ubiquity, genetic diversity, their interaction with crop plants and develop methods for their successful deployment in agriculture production. The fungus Trichoderma isolates have been identified as being able to act as endophytic plant symbionts. The strains become endophytic in roots, but the greatest changes in gene expression occur in shoots. These changes alter plant physiology and may result in the improvement of abiotic stress resistance, nitrogen fertilizer uptake, resistance to pathogens and photosynthetic efficiency. 5.1 Summary 5.1.1 Analyzing root system morphology against candidate Trichoderma isolates 1. Ten Trichoderma isolates were evaluated in the present investigation to study the effect on root morphology of the selected genotype/ rice lines. It was observed that Trichoderma seed treatment contributes towards increased root length. 99 2. Seed treatment to IR-64 and RRF-75 by trichoderma isolate #T14 shows maximum root length. In the same manner in IRRI-5 shows maximum root length in sahbhagi dhan and TV12 shows in IBD-1 5.1.2 Screening of isolates of Trichoderma spp. for ACC deaminase activity 1. All the isolates showed activity in the range of 10.46±3.92 to 2.37±1.37 µmol α ketobutyrate/mg protein /h. 2. Isolate TV12 showed the highest amount of ACC deaminase activity (10.46±3.92 µmol α ketobutyrate/mg protein /h) while isolate T14 showed lowest (2.37±1.37 µmol α ketobutyrate/mg protein /h). 5.1.3 Screening of isolates of Trichoderma spp. for chitinase and production 1. In this screening of ten trichoderma spp. to detect enzyme activity of chitinase and, the isolates were grouped to high, medium and low according to the radial diameter measured as the ability to produce chitinase and enzyme activity. 2. Out of ten isolates of Trichoderma spp., six isolates (#IRRI-1, #IRRI-2, #IRRI-3, #TV12, #T14 and #94a) showed the ability to produce high chitinase activity and three isolates (#IRRI-4, #IRRI-6 and #TH3) showed the medium chitinase producing ability where as low chitinase producing ability was not shown by any of the isolates. 5.1.4 Screening isolates of Trichoderma spp. for siderophore and HCN production 1. In the present investigation ten different species of Trichoderma were screened for siderophore producing ability to chelate and solubilize iron to make in available form to plants. Out of ten isolates screened three isolates 100 (IRRI-2, T14, 94a) of trichoderma spp. were found to be producing more than 10% siderophore production. 2. Screening of ten isolates of Trichoderma spp. carried for its ability to produce volatile inhibitory compound hydrogen cyanide supplementing glycine as a precursor molecule. Isolate #IRRI-2, #IRRI-4, IRRI-6 and isolate #94a showed positive reaction for cyanide production. 5.1.5 Screening isolates of Trichoderma spp. for Phosphate solubilization and IAA production 1. Trichoderma spp. has been known for plant growth promoting related activity other than as biocontrol agent which enhances the root and shoot growth, seed germination, solubilization and uptake of range of nutrients which ultimately increases the crop productivity. 2. Screening of ten isolates of Trichoderma spp. for Phosphate solubilization ability was carried out in two different types of media containing tricalcium phosphate as a phosphate source. Isolates showed varying results of phosphate solubilization carried out in three different types of media. Among twenty isolates screened, isolate# T14 showed higher phosphate solubilization in all three types of media. 3. In the present experiment, twenty isolates of Trichoderma spp. were evaluated for the ability to produce IAA compounds from L-tryptophan as a precursor molecule and compared with standard graph of IAA. Isolate # T14 showed high IAA producing ability among the ten isolates. 5.1.6 Molecular characterization of ten isolates of Trichoderma spp. The polymerase chain reaction (PCR) technique has created new ways of revealing DNA polymorphism among closely related genotypes with high sensitivity 101 via a fast and easy to perform protocol. PCR based fingerprinting is widely applied for the characterization of Trichoderma strains and species for various purposes. 1. The genetic relatedness among ten isolates of Trichoderma spp. were analyzed by ten gene specific markers. 2. Primer pairs CAL-228F & CAL-737R and ACT-512F & ACT-782R were used to amplify a portion of the calmodulin (CAL) gene including two introns and a portion of the actin (ACT) gene including one intron. Both the primers amplified specific size fragments (~340bp actin and ~500bp calmodulin) in all the isolates 3. PCR analysis for presence of acdS gene with primer pair AcdS-F & AcdS-R indicated that a DNA fragment approximately 1500 bp in size was obtained in all Trichoderma isolates. 4. . In the present investigation for detection of Nitrilase producing gene used primer pair of P1 and PfluHisB gives 1000, 900 and 800bp fragments were obtained in all the isolates whereas additional bands of 400 and 280bp was also obtained in all the isolates except IRRI-3 and T14. Intense bands below 100bp were observed in all the isolates as well. 5. In the present investigation isolates of Trichoderma were amplified with two HCN specific primers of Pseudomonas sp. Primer hcnAC-a & hcnAC-b resulted in amplification of >1500bp fragment in isolates IRRI-2, IRRI-3 and Tv12 along with 120bp fragment in all the isolates of Trichoderma. However with primer hcnPM2 & hcnPM7-26R amplification was not observed in any of the isolates. 102 6. In the present investigation, four different chitinase gene specific primers (Chit33, Nag1, Nag1RT, Nag2RT) were used to analyse amplification of chitinase genes in Trichoderma isolates. 7. Primer Chit33 amplified fragments of 900 and 220 bp in all the isolates with an additional small fragment of approx. 60bp size. Nag-1 primer gave products of different sizes ranging from 150 to 1700bp. Fragment size 1500 bp was observed only in isolates IRRI-2, IRRI-3, Tv12 and T14 whereas fragments of 470, 300 and 220 bp was observed in all the isolates under investigation. Amplification with primer Nag1-RT resulted in expected bands of 145bp in all the isolates whereas an expected 150 bp fragment was amplified with primer Nag2-RT only in isolates IRRI-2, IRRI-3, Th3, Tv12 and T14. 5.1.7 In-silico analysis of root related QTLs 1. Using the online Nipponbare BAC/PAC map (Oryza sativa L.) information, QTL regions were identified in-silico. The region of 36 cM to 55.3 cM on chromosome #09 govern by Root Length (RL) having flanking markers RZ206 and RZ422 on P0711F01 and OJ1299_A11 BAC/PAC clone respectively. 2. In-silico analysis was done that showed the region from 40.7 cM to 50.7 cM on chromosome number #02 having flanking markers RM41 and ME2_10 govern by root parameter i.e penetrate root dry weight. The BAC/PAC clone on which flanking marker anchored was P0711A01 and P043D11. The next QTL was identified on same chromosome (#09) for the root parameter deep rooting (DR), this QTL region span the 2.5 cM distance with flanking markers was RM24393 and RM7424 present on OJ1081_G10 and OJ1123_B08 103 respectively. This QTL region cover the distance from 58.3 cM to 60.8 cM which is very short region govern by this trait. 5.2 Conclusion 1. Treatment showed maximum root length, root thickness, root branching, root number over the control in all the rice lines. 2. In-vitro screening for phosphate solubilizing activity and indol acetic acid (IAA) producing assay showed that the fungal isolate T14 was identified as potentially high responsive in both the screening assay. Iron chelating ability observed maximum in isolate 94a. 3. These isolates were also screen for ACC deaminase activity experiment showed that the isolate IRRI-1 has high activity. 4. PCR amplification with ACC primers showed homogeneity of all Trichoderma isolates indicating that they all are able to produce ACC deaminase. 5. Almost all the isolates showed the presence of endochitinase and nitrilase gene fragments which proves their ability to produce chitinase production. Homogenecity also observed in actin and calmodulin gene amplification. 5.3 Suggestion for future research work 1. Studying the relationship between plant growth regulators produced by different Trichoderma spp. for increased growth response of plant specially roots traits for alleviating stress conditions. 2. Those isolates which possessed high phosphate solubilizing ability, IAA production, tolerance to fungicide and strong antagonism will be further exploited for their above mentioned characteristics. 104 3. There will be the need to study the complex and dynamic interactions among microorganisms, roots, soil and water in the rhizosphere induce changes in physicochemical and structural properties of the soil. 4. QTL can help us to develop insight regarding the rice ideotype which have the long, branched, deep root system. 105 106 REFERENCES Abdurakhmonov, I. & Abdukarimov, A. (2008). Application of association mapping to understanding the genetic diversity of plant germplasm resources. International Journal of Plant Genomics, 2008, 1-18 Abe J, Morita S. (1994). Growth direction of nodal roots in rice: its variation and contribution to root system formation. Plant and Soil 165-170. AdaViterbo, UdiLandau, SofiaKim, LeonidChernin, & IlanChet, (2010) Characterization of ACC deaminase from the biocontrol and plant growthpromoting agent Trichoderma asperellumT203(2010) Journal compilation Federation of European Microbiological Societies 305 42-48 Agrama HA, Eizenga GC (2008). Molecular diversity and genome-wide linkage disequilibrium patterns in a worldwide collection of Oryza sativa and its wild relatives. Euphytica 160, 339-355. Agrama HA and Eizenga GC and Yan W (2007). Association mapping of yield and its components in rice cultivars. Mol. Breed. 19, 341-356. Ahmad, J.S., and R. Baker. (1988). Implications of rhizosphere competence of Trichoderma-harzianum. Can. J. Microbiol. 34:229–234. Alfano, G., Bos, J., Cakir, C., Horst, L., Ivey, M., Madden, L. V., Kamoun, S., and Hoitink, H. 2006. Modulation of gene expression in tomato by Trichoderma hamatum 382. (2006.) Phytopathology 96:S4. Aliferis, K. A. & Jabaji, S. (2010) Metabolite composition and bioactivity of Rhizoctonia solani sclerotial exudates. J. Agric. Food Chem. 58, 7604–7615 (2010). Allen MF, Boosalis MG (1983) Effects of two species of VA mycorrhizal fungi on drought tolerance of winter wheat. New Phytol 93:67–76 107 Altomare, C., W.A. Norvell, Björkman T., and Harman G.E. (1999). Solubilization of phosphates and micronutrients by the plant-growthpromoting and biocontrol fungus Trichoderma harzianum Rifai 1295- 22. Appl. Environ. Microbiol. 65:2926–2933. Andersen J. R. I. Zein, G. Wenzel, et al., (2007) “High levels of linkage disequilibrium and associations with forage quality at a Phenylalanine Ammonia-Lyase locus in European maize (Zea mays L.) inbreds,” Theoretical and Applied Genetics, vol. 114(2):307–319,. Araki H, Morita S, Tatsumi J, Iijima M. (2002). Physio-morphological analysis on axile root growth in upland rice. Plant Production Science 5, 286–293. Aranzana MJ, Kim S, Zhao K, Bakker E, Horton M, Jakob K, Lister C, Molitor J, Shindo C, Tang C, Toomajian C, Traw B, Zheng H, Bergelson J, Dean C, Marjoram P, Nordborg M (2005) Genome-wide association mapping in Arabidopsis identifies previously known flowering time and pathogen resistance genes. PLoS Genet 1:50-60 Atzorn, R., Crozier, A., Wheeler, C.T. and Sandberg, G., (1988), Production of gibberellins and indole-3-acetic acid by Rhizobium phaseoli in relation to nodulation of Phaseolus vulgaris roots. Planta, 175: 532-538. Bae, H. et al. (2009) The beneficial endophyte Trichoderma hamatum isolate DIS 219b promotes growth and delays the onset of the drought response in Theobroma cacao. J. Exp. Bot. 60, 3279–3295. Bae, H., Sicher, R. C., Kim, M. S., Kim, S.-H., Strem, M. D., Melnick, R. L., and Bailey, B. A. (2009). The beneficial endophyte Trichoderma hamatum isolate DIS 219b promotes growth and delays the onset of the drought response in Theobroma cacao. J. Exp. Bot. 60:3279-3295. 108 Balasubramanian N. (2003). Strain improvement of Trichoderma spp. by protoplast fusion for enhanced lytic enzyme and biocontrol potential. Ph.D thesis, University of Madras, Chennai, India. Barassi CA, Ayrault G, Creus CM, Sueldo RJ, Sobero MT (2006) Seed inoulation with Azospirillum mitigates NaCl effects on lettuce. Sci Hortic (Amsterdam) 109:8–14 Barea, J.M., Azco´n, R., Azco´n-Aguilar, C (2004). Mycorrhizal fungi and plant growth promoting rhizobacteria. In: Varma A, Abbott L, Werner D, Hampp R, eds. Plant surface microbiology. Heidelberg, Germany: Springer-Verlag, 351– 371. Benítez, T., Rincón A.M., Limón M.C., and Codón A.C. (2004). Biocontrol mechanisms of Trichoderma strains. Int. Microbiol. 7:249–260. Bissett, J. (1991). A revision of the genus Trichoderma. II. Intrageneric classification. Can. J. Bot. 60:2357-2372. Bissett, J. (1991a.) A revision of the genus Trichoderma. II. Infrageneric classification. Canadian Journal of Botany. 69:2357-2372. Bissett, J. (1991b.) A revision of the genus Trichoderma. III. Section Pachybasium. Canadian Journal of Botany. 69:2373-2417. Bjorkman, T., Blanchard, L.M., Harman, G.E. (1998). Growth enhancement of shrunken-2 sweet corn with Trichoderma harzianum 1295-22: effect of environmental stress. J. Am. Soc. Hortic. Sci. 123: 35–40 Blanchard, L.M., and T. Björkman. (1996) The role of auxin in enhanced root growth of Trichoderma-colonized sweet corn. Hort Science 31:688. Blanco and Bernard T. (1994) Osmoadaptation in rhizobia: ectoineinduced salt tolerance. J Bacteriol 176:5210–5217 109 Bochner BR, Gadzinski P, Panomitros E. (2001) Phenotype microarrays for highthroughput phenotypic testing and assay of gene function. Genome Res 11:1246–1255 Breseghello F. and Sorrells, M.E. (2006) Association mapping of kernel size and milling quality in wheat (Triticum aestivum L.) cultivars. Genetics 172:1165– 1177. Cardon LR and Bell JI (2001) Association study designs for complex diseases. Nat Rev Genet 2:91-99. Cardon LR, Chakravarti A et al. (2001) Finding the missing heritability of complex diseases. Nature 461: 747–753. Casimiro, I., Marchant, A., Bhalerao, R.P., Swarup, R., Graham, N., Inze´, D., Sandberg, G., Casero, P.J., Bennett, M. (2001) Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell. 13: 843–852. Chang TT and Vergara BS (1975) Varietal diversity and morpho-agronomic characteristics of upland rice. In: Major research in upland rice. International Rice Research Institute, Manila, Philippines. Pp. 72-90. Chang WS, van de Mortel M, Nielsen L, de Guzman GN, Li X and Halverson LJ (2007) Alginate production by Pseudomonas putida creates a hydrated microenvironment and contributes to biofilm architecture and stress tolerance under water-limiting conditions. J Bacteriol 189:8290–8299 Contreras, H.A., Macias, L., Cortes, C., Lopez, J. (2009) Trichoderma virens, a plant beneficial fungus, enhances biomass production and promotes lateral root growth throughan auxin-dependent mechanism in Arabidopsis. Plant Physiol. 149:1579–92. Costa S and Dolan L (2000) Development of the root pole and cell patterning in Arabidopsis roots. Current Opinion in Genetics and Development 10: 405– 409. 110 Dennis, C., and Webster, J. (1971). Antagonistic properties of species groups of Trichoderma. III. Hyphal interaction. Transactions of British Mycological Society. 57:363-369. Dewan, M.M., and Sivasithamparam K. (1989). Behavior of a plant growthpromoting sterile fungus on agar and roots of rye-grass and wheat. Mycol. Res. 93:161–166. DonnaM.PenroseandBernardR.Glick Methods for isolating and characterizing ACC deaminase containing plant growth promoting rhizobacteria (2003). PHYSIOLOGIA PLANTARUM 118:10–15. Donnelly P (2008). Progress and challenges in genome-wide association studies in human. Nature, 456: 728-731. DRR, 2007, DRR Perspective Plan: VISION 2025, Directorate of Rice Research, Hyderabad pp. 1-53. Druzhinina IS, Kopchinskiy AG, Kubicek CP (2006a). The first 100 Trichoderma species characterized by molecular data. Mycoscience 47:55–64 Druzhinina IS, Schmoll M, Seiboth B, Kubicek CP (2006b) Global carbon utilization profiles of wild-type, mutant, and transformant strains of Hypocrea jecorina. Appl Environ Microbiol 72:2126–2133 Dworkin, M. and Foster, J., (1958). Experiments with some microorganisms, which utilize ethane and hydrogen. J. Bacteriol., 75: 592–601 Ekanayake, I.J., Garrity D.P., and O'TOOLE J.C.. (1986). Influence of Deep Root Density of Root Pulling Resistance in Rice. Crop Sci. 26(6):1181-1185. Ekanayake,I.J., Garrity D.P., and O'TOOLE J.C.. (1985). Influence of Deep Root Density ofRoot Pulling Resistance in Rice. Crop Sci. 26(6):1181-1186. Elad, Y. and Chet, I. (1996). Effect of Trichoderma harzianum on Botrytis cinerea pathogenicity. Phytopathology.86:1255-1260. 111 Elad, Y., Chet, I. and Y. Henis, (1982). Degradation of plant pathogenic fungi by Trichoderma harzianum. Can J Microbiol. 28: 719–725. Ersoz, E.S., (2006) Candidate Gene-Association Mapping for Dissecting Fungal Disease Resistance in Loblolly Pine. Ph.D. Dissertation in Genetics, University of California, Davis. FAO, (2005), Statistical Databases. Food and Agricultural Organization (FAO) of United Nations, Rome. Flint-Garcia, S., Thornsberry, J. & Bukler, E. (2003). Structure of linkage disequilibrium in plants. Annual Review Plant Biology, Vol. 54, 357-374. Gamalero, G., Erta, G., and Glick, B. R. (2009). The Use of Microorganisms to Facilitate the Growth of Plants in Saline Soils. Springer-Verlag, Heidelberg, Germany. Garris AJ, McCouch SR and Kresovich S (2003) Population structure and its effects on haplotype diversity and linkage disequilibrium surrounding the xa5 locus of rice Oryza sativa L. Genetics 165:759-769. Gebhardt C., Ballvora A., Walkemeier B., Oberhagemann P., and Sch¨uler K. (2004) “Assessing genetic potential in germplasm collections of crop plants by marker-trait association: a case study for potatoes with quantitative variation of resistance to late blight andmaturity type,”Molecular Breeding, vol. 13, no. 1, pp. 93–102. George T, Gregory P, Wood M, Read D, Buresh R (2002). Phosphatase activity and organic acids in the rhizosphere of potential agroforestry species and maize. Soil Biol. Biochem. 34: 1487-1494. Gomez SM, Kumar SS, Jeyaprakash P, Suresh R, Biji KR, Boopathi NM, Price AH et.al (2006) Mapping QTLs linked to physio-morphological and plant production traits under drought stress in rice (Oryza sativa L.) in the target environment. Am J Biochem Biotechnol 2, 161–9. 112 Gomez SM, Kumar SS, Jeyaprakash P, Suresh R, Biji KR, Boopathi NM, Price AH et.al. (2009) Mapping QTLs linked to physio-morphological and plant production traits under drought stress in rice (Oryza sativa L.) in the target environment. Am J Biochem Biotechnol 2, 161–9. Gordon, S.A. and Weber, R.P.(1951). Colorimetric estimation of indole-acetic acid. Plant Physiology. 26: 192-195. Graham, R. D., and Webb, M. J. (1991). Micronutrients and disease resistance and tolerance in plants. In Welch, R. M. (Eds.), Micronutrients in agriculture .In: Madison WI: Soil Science Society of America. pp. 329-370. Gravel, V., Antoun, H., Tweddell, R.J. 2007. Growth stimulation and fruit yield improvement of greenhouse tomato plants by inoculation with Pseudomonas putida or Trichoderma atroviride: Possible role of indole acetic acid (IAA). Soil Biol. Biochem.39: 1968–1977. Gupta, P., Rustgi, S. & Kulwal, P. (2005). Linkage disequilibrium and association studies in higher plants: present status and future prospects. Plant Molecular Biology, Vol. 57, No. 4, 461-485 Hamblin MT, Mitchell SE, White GM, Gallego J, Kukatla R, Wing RA, Paterson AH and Kresovich S (2004) Comparative population genetics of the panicoid grasses: Sequence polymorphism, linkage disequilibrium and selection in a diverse sample of Sorghum bicolor. Genetics 167:471-483. Hamida, M.A. and Elkomy, H.M., (1998), Effect of salinity, gibberellic acid and Azospirillum inoculation on the growth and nitrogen uptake of Zea mays. Biological Plant, 40: 109-166. Haran, S., H. Schickler, A. Oppenheim, and I. Chet. (1996). Differential expression of Trichoderma harzianum chitinases during mycoparasitism. Phytopathology 86:980–985. 113 Harman, G. E. (2000). Myths and dogmas of biocontrol: changes in perceptions derived from research on Trichoderma harzianum T-22. Plant Dis. 84:377393. Harman, G.E., Howell, C.R., Viterbo, A., Chet, I., Lorito, M. (2004). Trichoderma species-opportunistic, avirulent plant symbionts. Nature Reviews. 2:43-56. Hasegawa, S. (1963). Upland rice. pp. 1-124. In:Y.Tagari (Ed.). Crop Science, a treatise. Vol. I.The rice plant. Yokendo, Tokyo. Haynes RJ, Swift RS (1990) Stability of soil aggregates in relation to organic constituents and soil water content. J Soil Sci 41:73–83 Hemamalini, G.S., Sashidhar H.E. and Hittalmani S., (2000). Molecular marker assisted tagging of morphological and physiological traits under two contrasting moisture regimes at peak vegetative stage in rice (Oryza sativa L.). Euphytica, 112: 1-10. Hossain M, Sultana F, Kubota M, Koyama H, Hyakumachi M (2007). The plant growth-promoting fungus Penicillium simplicissimum GP17- 2 induces resistance in Arabidopsis thaliana by activation of multiple defense signals. Plant Cell Physiol. 48: 1724-1736. Howell SA (ed.) (1998) Root development. In: Molecular Genetics of Plant Development, pp. 289–311. Cambridge: Cambridge University Press. Howell, C.R. (2003). Mechanisms employed by Trichoderma species in the biological control of plant diseases: the history and evolution of current concepts. Plant Dis. 87:4-10. Hyakumachi, M. (1994). Plant-growth-promoting fungi from turfgrass rhizosphere with potential for disease suppression. Soil Microorganisms 44:53–68. Hyten DL, Choi I-Y, Song Q, Shoemaker RC, Nelson RL, Costa JM, Specht JE and Cregan PB (2007) Highly variable patterns of linkage disequilibrium in multiple soybean populations. Genetics 175:1937-1944. 114 INTERNATIONALRICE RESEARCH INSTITUTE (IRRI). 1978. Annual Report for 1977. Los Banos, Philippines. INTERNATIONALRICE RESEARCH INSTITUTE (IRRI). 1978. Annual Report for 1977. Los Banos, Philippines. Ivandic, V. W. T. B. Thomas, E. Nevo, Z. Zhang, and B. P. Forster, (2004), “Associations of simple sequence repeats with quantitative trait variation including biotic and abiotic stress tolerance in Hordeum spontaneum,” Plant Breeding, vol. 122, Iwata, H. Y. Uga, Y. Yoshioka, K. Ebana, and T. Hayashi, (2007) “Bayesian association mapping of multiple quantitative trait loci and its application to the analysis of genetic variation among Oryza sativa L. germplasms,” Theoretical and Applied Genetics, vol. 114, no. 8, pp. 1437–1449. Jaeger, De N., Declerck, S. & de la Providencia, I. E. (2010). Mycoparasitism of arbuscular mycorrhizal fungi: a pathway for the entry of saprotrophic fungi into roots. FEMS Microbiol. Ecol. 73, 312–322. Jaklitsch, W. M. (2011). European species of Hypocrea Part II: species with hyaline ascospores. Fungal Divers. 48, 1–247. Jannink J. L. and Walsh B., (2002). “Association mapping in plant populations,” in Quantitative Genetics, Genomics and Plant Breedinging, M. S. Kang, Ed., pp. 59–68, CAB International, Oxford, UK. Kamoshita A, Wade LJ, Ali ML, Pathan MS, Zjang J, Sarkarung S, Nguyen HT. (2002a). Mapping QTL for root morphology of a rice population adapted to rainfed lowland conditions. Theoretical and Applied Genetics 104, 880–893. Kanagaraj P, Prince K. S. J, Annie Sheeba J, Biji K. R, Sheetal Babu Paul, Senthil A and Chandra Babu R. (2010). Microsatellite markers linked to drought resistance in rice (Oryza sativa L.).Current science 98:836-839 115 Kato Y, Abe J, Kamoshita A, Yamagishi J. (2007b). Genotypic variation in root growth angle in rice (Oryza sativa L.) and its association with deep root development in upland fields with different water regimes. Plant and Soil 287, 117–129. Kawata S, Shibayama H. (1965). On lateral root primordial formation in the crown roots of rice plants. Proc Crop Sci Sco Jpn 33:423-31. Khattabi, N., Ezzahiri, B., Louali, L., Oihabi, A. (2004). Antagonistic activity of Trichoderma isolates against Sclerotium rolfsii: screening of efficient isolates from Morocco soils for biological control. Phytopathol Mediterr. 43:332-40. Khush, G. S. and Angeles, E. R. (1997) A new gene for resistance to race 6 of bacterial blight in rice, Oryza sativa L. Rice Genet Newsl 16:92–93 Khush, G. S. and Ogawa, T. (1984). Major gene for resistance to bacterial blight in rice.. International Rice Research Institute, P. O. Box 933, Manila, Philippines. Pages 177-192. Kleifeld, O., Chet, I., (1992). Trichoderma harzianum-interaction with plants and effect on growth responsef. Plant and Soil. 144:267–272. Koike, N., Hyakumachi M., Kageyama K., Tsuyumu S., and Doke N. (2001). Induction of systemic resistance in cucumber against several diseases by plant growth-promoting fungi: Lignification and superoxide generation. Eur. J. Plant Pathol. 107:523–533. Kondo M, Pablico PP, Aragones DV, Agbisit R, Abe J, Morita S, Courtois B. (2003). Genotypic and environmental variations in root morphology in rice genotypes under upland field conditions. Plant and Soil 255, 189–200. Kraakman ATW, Martı´nez F, Mussiraliev B, van Eeuwijk FA, Niks RE (2006) Linkage disequilibrium mapping of morphological, resistance, and other agronomically relevant traits in modern spring barley cultivars. Mol Breed 17:41–58 116 Kubicek CP, Bissett J, Druzhinina I, Kullnig-Gradinger C, Szakacs G (2003) Genetic and metabolic diversity of Trichoderma: a case study on South-East Asian isolates. Fungal Genet Biol 38:310–319 Kubicek CP, Mach RL, Peterbauer CK, Lorito M (2001). Trichoderma: From genes to biocontrol. J. Plant Pathol. 83: 11–23. Kubicek, C. P. & Penttila¨, M. E. (1998). Regulation of production of plant polysaccharide degrading enzymes by Trichoderma. In Trichoderma and Gliocladium, vol. 2, Enzymes, Biological Control and Commercial Applications, London: Taylor & Francis pp. 49–71. Kubicek, C. P., and Harman, G. E. (1998). Trichoderma and Gliocladium. Vol. 1. Taylor & Francis, London. Lo CT, Lin CY (2002). Screening strains of Trichoderma spp. for plant growth enhancement in Taiwan. Plant pathology Bull. 11: 215–220. Lopez-Bucio J, Cruz-Ramirez A, Perez-Torres A, Ramirez-Pimentel JG, SanchezCalderon L and Herrera-Estrella L (2005a) Root architecture. In: Plant architecture and its manipulation. (C. Turnbull, eds.) Blackwell Annual Review Series, Oxford. pp. 181- 206. Lorito, M., Woo, S. L., Harman, G. E. & Monte, E. (2010) Translational research on Trichoderma: from ‘omics to the field. Annu. Rev. Phytopathol. 48, 395–417. M. Malosetti, C. G. Van der Linden, Vosman B. and Van Eeuwijk F. A. (2007). “A mixed-model approach to association mapping using pedigree information with an illustration of resistance to Phytophthora infestans in potato,” Genetics, vol. 175, no. 2, pp. 879–889. Mackay, I. & Powell, W. (2007). Methods for linkage disequilibrium mapping in crops. Trends in Plant Science, Vol. 12, No. 2, 57-63 Mackay, I. & Powell, W. (2007). Methods for linkage disequilibrium mapping in crops. Trends in Plant Science, Vol. 12, No. 2, 57-63 117 Madigen Oren (1999) Thermophilic and halophilic extremophiles. Curr Opin Microbial 2:265–269 Malysheva-Otto, L., Ganal, M. & Röder, M. (2006). Analysis of molecular diversity, population structure and linkage disequilibrium in a worldwide survey of cultivated barley germplasm (Hordeum vulgare L.). BMC Genetics, Vol. 7, No. 6, 1-14 Mather KA, Caicedo AL, Polato NR, Olsen KM, McCouch S, Purugganan MD (2007). The extent of linkage disequilibrium in rice (Oryza sativa L.). Genetics 177, 2223–2232. McCouch SR, Teytelman L, Xu Y, Lobos KB, Clare K, Walton M, Fu B, et al (2002) Development and mapping of 2240 new SSR markers for rice. DNA Res 9, 199–207. Mcspadden, B. B., and Fravel, D. R. (2002). Biological control of plant pathogens: Research, commercialization, and application in the USA. Plant Health Progress. doi:10.1094/PHP-2002-0510-01-RV. Myles, S., Boyko, A., Owens, C., Brown, P., Grassi, F., Aradhya, M., Prins, B., Reynolds, A. Chia, J., Ware, D., Bustamante, C. & Buckler, E. (2011). Genetic structure and domestication history of the grape. Proceedings of the National Academy of Sciences of the United States of America, Vol. 108, No. 9, 35303535 Myles, S., Peiffer, J., Brown, P., Ersoz, E., Zhang, Z., Costich, D. & Buckler, E. (2009). Association mapping: critical considerations shift from genotyping to experimental design. The Plant Cell, Vol. 21, No. 8, 2194-2202. Narciso, J. and Hossain, M. (2002). World Rice Statistics. In. (IRRI) Purvis AC. Role of the alternative oxidase in limiting superoxide production by plant mitochondria. Physiol Plant; 100:165–70. 118 Nass, H.G. and Zuber M.S.. (1971). Correlation ofCorn roots early indevelopment to mature root development. Crop Sci. 11:655-658. Nguyen HT, Babu RC, Blum A (1997). Breeding for drought resistance in rice: physiology and molecular genetics considerations. Crop Sci 37, 1426–34. Nordborg M and Weigel D (2008). Next-generation genetics in plants. Nature, 456: 720-723. O’Toole JC, Bland WL. (1987). Genotypic variation in crop plant root systems. Advances in Agronomy 41, 91–143. Okushima Y, Overvoorde PJ, Arima K, Alonso JM, Chan A, Chang C, et al. (2005). Functional genomic analysis of the AUXIN RESPONSE FACTOR gene family members in Arabidopsis thaliana: unique and overlapping functions of ARF7 and ARF19. Plant cell 17: 444-63. Oraguzie, N., Wilcox, P., Rikkerink, H. & de Silva, H. (2007). Linkage disequilibrium, In: Association mapping in plants, N.C. Oraguzie, E.H.A. Rikkerink, S.E. Gardiner & H.N. de Silve, (Ed.), 11-39, Springer, ISBN-13 9780387358444, New York, USA O'TOOLE, J.C. and Soemartono. (1981). Evaluation of a simple technique for characterizing rice root systems in relation to drought resistance. Suphytica 30:283-290. O'TOOLE, J.C. and Moya T.B. (1978). Genotypic variation in maintenance of leaf water potential inrice. Crop Sci. 18:873-876. Ousley, M.A., Lynch, J.M., Whipps, J.M., (1994). Potential of Trichoderma spp. as consistent plant growth stimultors. Biology and Fertility of Soils. 17:85–90. Palaisa, K., Morgante, M., Tingey, S. & Rafalski, A. (2003). Contrasting effects of selection on sequence diversity and linkage disequilibrium at two phytoene synthase loci. The Plant Cell, Vol. 15, No. 8, 1795-1806 119 Paquette AJ and Benfey PN (2001) Axis formation and polarity in plants. Current Opinion in Genetics and Development 11: 405–409. Parao, F.T., E. Paganiban, JR., and Yoshida S. (1976). Drought resistance ofrice varieties inrelation to their root growth. Philip. J. Crop Sci. l(l):50-55. Persello-Cartieaux, F., Nussaume, L., Robaglia, C. (2003). Tales from the underground: molecular plant–rhizobacteria interactions. Plant, Cell and Environment. 26:189–199. Persoon CH (1794) Disposita methodica fungorum. Römer's Neues Mag Bot 1:81– 128 Pikovskaya, R.I. (1948). Mobilization of phosphorus in soil connectionwith the vital activity of some microbial species. Microbiologiya. 17 :362–370. Price AH, Steele KA, Townend J, Gorham J, Audebert A, Jones M, Courtois B. (1999). Mapping root and shoot traits in rice: experience in UK, IRRI and WARDA. In: Ito O, O’Toole J, Hardy B, eds. Genetic improvement of rice for water-limited environments. Manila: IRRI, 257–273. Pritchard JK and Przeworski M (2001). Linkage disequilibrium in humans: models and data. Am. J. Hum. Genet. 69, 1-14. Ravel C, Praud S, Murigneux A, Linossier L, Dardevet M, Balfourier F, Dufour PH, Brunel D and Charmet G (2006) Identification of Glu-B1-1as a candidate gene for the quantity of high-molecular-weight glutenin in bread wheat (Triticum aestivum L.) by means of an association study, Theor Appl Genet 112:738743. Ravel C., S. Praud, A. Murigneux, et al. (2006). “Identification of Glu-B1-1 as a candidate gene for the quantity of highmolecular- weight glutenin in bread wheat (Triticum aestivum L.) bymeans of an association study,” Theoretical and Applied Genetics, vol. 112, nos. 4, pp. 738–743. 120 Regent Instruments (2000) User Guide, Mac/ WinRHIZO V4.1, Reference, Regent Instruments Inc. Reich DE and Goldstein DB (2001) Detecting association in a case-control study while correcting for population stratification. Genet Epidemiol 20:4-16. Remington D. L., J. M. Thornsberry, Y. Matsuoka, et al. (2001). “Structure of linkage disequilibrium and phenotypic associations in the maize genome,” Proceedings of the National Academy of Sciences of the United States of America, vol. 98, no. 20, pp. 11479–11484. Rifai MA (1969) A revision of the genus Trichoderma. Mycol Pap 116:1–56 Ruiz-Lozano JM and Azcon R (2000) Symbiotixc efficiency and infectivity of an autochthonous arbuscular mycorrhizal Glomus sp. from saline soils and Glomus deserticola under salinity. Mycorrhiza 10:137–143 Samuels GJ (2006) Trichoderma: systematics, the sexual state, and ecology. Phytopathology 96:195–206. Samuels, G. J. (1996). Trichoderma: a review of biology and systematic of the genus. Mycology Research 100:923-935. Samuels, G., Dodd, S.L., Gams, W., Castlebury, L.A., Petrini, O. (2002). Trichoderma species associated with the green mold epidemic of commercially grown Agaricus bisporus. Mycologia. 94:146–70. Sandhya V, Ali SZ, Grover M, Kishore N, Venkateswarlu B (2009a) Pseudomonas sp. strain P45 protects sunflowers seedlings from drought stress through improved soil structure. J Oilseed Res 26:600–601 Satyavani, S., Satyaprasad, K. (2009). In vitro solubilization of rock phosphate by Trichoderma spp. BIOINFOLET-A Quarterly Journal of Life Sciences. Volume : 6, Issue : 2 121 Saxena AK, Lata Shende R, Pandey AK (2005) Culturing of plant growth promoting rhizobacteria. In: Gopi KP, Varma A (eds) Basic research applications of mycorrhizae. I K International Pvt Ltd, New Delhi, pp 453–474 Seidl, V. (et al). (2009) Transcriptomic response of the mycoparasitic fungus Trichoderma atroviride to the presence of a fungal prey. BMC Genomics 10, 567. Semon M, Nielsen R, Jones MP, McCouch SR (2005). The population structure of African cultivated rice Oryza glaberrima (Steud.): Evidence for elevated levels of linkage disequilibrium caused by admixture with O. sativa and ecological adaptation. Genetics 169, 1639–1647. Shaik Zulfikar Ali. Vardharajula Sandhya . Linga Venkateswar Rao (2013) Isolation and characterization of drought tolerant ACC deaminase exopolysaccharide producing fluorescent Pseudomonas sp. and Annals of Microbiology; Pages 1-10 Shoresh, M., Mastouri, F., and Harman, G. (2010). Induced systemic resistance and plant responses to fungal biocontrol agents. Annu. Rev. Phytopathol. 48:21-43. Shuai B, Reynaga-Pena CG, Springer PS. (2002). The lateral organ boundaries gene defines a novel, plant specific gene family. Plant Physiology 129:747-61 Simko, S. Costanzo, Haynes K. G., Christ B. J. and Jones R. W. (2004). “Linkage disequilibrium mapping of a Verticillium dahliae resistance quantitative trait locus in tetraploid potato (Solanum tuberosum) through a candidate gene approach,” Theoretical and Applied Genetics, vol. 108, no. 2, pp. 217–224. Sivasithamparam, K. and Ghisalberti, E. L.(1989). Trichoderma and Gliocladium Vol. 1 In: Kubicek, C. P. & Harman, G. E. (Eds), Taylor and Francis, London,UK, pp.139–191 Slatkin, M. (2008). Linkage disequilibrium: Understanding the evolutionary past and mapping the medical future. Nature Review Genetics, Vol. 9, No. 6, 477-485 122 Srivastava S, Yadav A, Seem K, Mishra S, Chaudhary V, Srivastava CS (2008) Effect of high temperature on Pseudomonas putida NBRI0987 biofilm formation and expression of stress sigma factor RpoS. Curr Microbiol 56(4):453–457 Subramanian KS, Charest C (1998) Arbuscular mycorrhizae and nitrogen assimilation in maize after drought and recovery. Physiol Plant 102:285–296 Taiz, L., Zeiger, E., (1991). Auxins: growth and tropisms. In: Zeiger, E. (Ed.), Plant Physiology. Hardcover. Benjamin/Cunnings, Menlo Park, CA, pp. 398–425. Tanimoto, E., (2005). Regulation of root growth by plant hormones—roles for auxin and gibberellin. Critical Reviews in Plant Sciences. 24:249–265. Tarafdar J, Jungk A (1987). Phosphatase activity in the rhizosphere and its relation to the depletion of soil organic phosphorus. J. Biol. Fert. Soils 3: 199-204. Tian, F., Bradbury, P., Brown, P., Hung, H., Sun, Q., Flint-Garcia, S., Rocheford, T., McMullen, M., Holland, J. & Buckler, E. (2011). Genome-wide association study of leaf architecture in the maize nested association mapping population. Nature Genetics, Vol. 43, No. 2, 159-162 Tommasini L, Schnurbusch T, Fossati D, Mascher F and Keller B (2007) Association mapping of Stagonospora nodorum blotch resistance in modern European winter wheat varieties. Theor Appl Genet 115:697-708. Tulasne LR, Tulasne C (1865) Selecta fungorum carpologia. Jussu, Paris Uga Y, Ebana K, Abe J, Morita S, Okuno K, Yano M. (2011). Variation in root morphology and anatomy among accessions of cultivated rice (Oryza sativa L.) with different genetic backgrounds. Breeding Science 59, 87–93. Vadassery, J., Ritter, C., Venus, Y., Camehl, I., Varma, A. (2008). The role of auxins and cytokinins in the mutualistic interaction between Arabidopsis and Piriformospora indica. Mol. Plant-Microbe Interact. 21:1371–83 Venkateswarlu B, Desai microorganisms for S, Prasad stressed YG (2008) ecosystems: 123 Agriculturally Challenges in important technology development and application’’. In: Khachatourians GG, Arora DK, Rajendran TP, Srivastava AK (eds) Agriculturally important Microorganisms, vol 1. Academic World, Bhopal, pp 225–246 Venkateswarlu B, Shanker AK (2009) Climate change and agriculture: adaptation and mitigation strategies. Indian J Agron 54:226–230 Vessey, J.K., (2003). Plant growth promoting rhizobacteria as biofertilizers. Plant and Soil. 255: 571–586. Vriezen JAC, Bruijn de FJ, Nusslein K (2006) Desiccation responses and survival of Sinorhizobium meliloti USDA 1021 in relation to growth phase, temperature, chloride and sulfate availability. Letters Appl Microbiol 42:17178 Weindling, R. (1932). Trichoderma lignorumas a parasitic of other fungi. Phytopathology. 22:837-845. Weiss KM and Clark AG (2002) Linkage disequilibrium and the mapping of complex human traits. Trends Genet 18:19-24. Wen W, Mei H, Feng F, Yu S, Huang Z, Wu J, Chen L, Xu X, Luo L (2009). Population structure and association mapping on chromosome 7 using a diverse panel of Chinese germplasm of rice (Oryza sativa L.). Theor. Appl. Gene. 119: 459-470. Woodward, A.W., Bartel, B. (2005). Auxin: regulation, action, and interaction. Ann Bot (Lond). 95: 707–735. Wu QS and Xia RX (2005) Effects of AM fungi on drought tolerance of citrus grafting seedling trifoliate orange/cara cara. Ying Yong Shen Tai Xue Bao 16(5):865–869 Wu QS and Xia RX (2006) Arbuscular mycorrhizal fungi influence growth, osmotic adjustment and photosynthesis of citrus under well-watered and water stress conditions. J Plant Physiol 163(4):417–425 124 Xing Y, Frei U, Schejbel B, Asp T and Lübberstedt T (2007) Nucleotide diversity and linkage disequilibrium in 11 expressed resistance candidate genes in Lolium perenne. BMC Plant Biol 7:43. Xu, J.L., Lafitte, H.R., Gao, Y.M., Fu, B.Y., Torres, R., and Li, Z.K., (2006), QTLs for drought escape and tolerance identified in a set of randon introgression lines of rice. Theor. Appl. Genet., vol. 111, pp. 1642-1650. Yadav, R., Courtois, B., Huang, N., and Mclaren, G. (1997), Mapping genes controlling root morphology and root distribution in a doubled- haploid population of rice. Theor.Appl. Genet., vol. 94, pp. 610-632. Yang J, Kloepper JW, Ryu CM (2009) Rhizosphere bacteria help plants tolerate abiotic stress. Trends Plant Sci 14:1–4 Yao J, Wang L, Liu L, Zhao C, Zheng Y (2009). Association mapping of agronomic traits on chromosome 2A of wheat. Gene. 137: 67-75. Yedidia, I., Srivastva, A.K., Kapulnik, Y., Chet, I., (2001). Effect of Trichoderma harzianum on microelement concentrations and increased growth of cucumber plants. Plant and Soil. 235:235-242 Yildirim E, Taylor AG (2005) Effect of biological treatments on growth of bean plans under salt stress. Ann Rep Bean Improv Crop 48:176–177 Yildirim, E., Taylor, A. G., and Spittler, T. D. (2006). Ameliorative effects of biological treatments on growth of squash plants under salt stress. Sci. Hortic. (Amst.) 111:1-6. Yoshida S, Hasegawa S. (1982). The rice root system: its development and function. In: Drought resistance in crops with emphasis on rice. Los Ban˜ os, Philippines: International Rice Research Institute, 97–114. Yu, J. & Buckler, E. (2006). Genetic association mapping and genome organization of maize. Current Opinions in Biotechnology, Vol. 17, No. 2, 155-160 125 Yu, J., and Buckler E.S. (2006). Genetic association mapping and genome organization of maize. Curr. Opin. Biotechnol. 17:155–160. Yue, B., W. Xue, L. Xiong, X. Yu, L. Luo, K. Cui, D. Jin, Y. Xing and Zhang Q. (2006). Genetic basis of drought resistance at reproductive stage in rice: Separation of Drought tolerance from Drought avoidance. Genetics, 172: 1213 – 1228 Zahir, Z.A., Arshad, M., Frankenberger, W.T. (2004). Plant growth promoting rhizobacteria: applications and perspectives in agriculture. Advances in Agronomy. 81:97–168. Zhang J, Zheng HG, Aarti A, Pantuman G, Nguyen TT, Tripathy JN, Sarial AK, Robin S, Badu RC, Nguyen BD, Sarkarung S, Blum A, Nguyen HT (2001) Locating genomic regions associated with components of drought resistance in rice: comparative mapping within and across species. Theor Appl Genet 103:19–29s 126
© Copyright 2024 Paperzz