0013-7227/02/$15.00/0
Printed in U.S.A.
The Journal of Clinical Endocrinology & Metabolism 87(4):1845–1855
Copyright © 2002 by The Endocrine Society
Vascular Proliferation and Vascular Endothelial Growth
Factor Expression in the Rhesus Macaque Endometrium
NIHAR R. NAYAK
AND
ROBERT M. BRENNER
Division of Reproductive Sciences, Oregon Regional Primate Research Center, Beaverton, Oregon 97006
The relationship between vascular endothelial growth factor
(VEGF) expression and the pattern of vascular proliferation
in the rhesus macaque endometrium has not been studied. In
this report, we used in situ hybridization to evaluate VEGF,
VEGF receptor type 1 and VEGF receptor type 2 mRNA expression during hormonally regulated menstrual cycles in
ovariectomized macaques. Proliferating endothelial cells
were identified by a double immunocytochemistry procedure
that detected Ki-67 antigen and von Willebrand factor in the
same endothelial cells. One and 2 d after progesterone withdrawal (premenstrual), VEGF mRNA was up-regulated in the
glands and stroma of the superficial endometrial zones, a finding that supports our previous suggestion that VEGF may play
a role in the menstrual induction cascade. During the postmenstrual repair phase, the healing surface epithelium
showed a further, dramatic increase in expression of VEGF
I
N ADULT FEMALE primates, the endometrium undergoes shedding of the upper zones and cyclical repair and
regeneration during the normal menstrual cycle. A key feature of this remarkable tissue remodeling is the growth of the
vasculature (1– 4). Although the sole ovarian steroid hormones required to induce these changes are E2 and progesterone (P) (5), several local factors are presumed to play
significant roles in mediating these important events. Despite
the importance of understanding the mechanisms of endometrial bleeding and repair and the varied pathological implications of abnormal bleeding, the regulatory mechanisms
and local factors involved in menstruation, healing, and regeneration of the primate endometrium are not fully
understood.
Of the various angiogenic factors described so far, vascular
endothelial growth factor (VEGF) is a prime regulator of both
physiological and pathological angiogenesis. Targeted disruption of even a single VEGF allele resulted in abnormal
blood vessel formation and embryonic death in mice (6, 7).
Also, treatment with neutralizing VEGF antibodies (8, 9) or
a soluble truncated form of VEGF receptor type 1 (10) in
primates has been shown to inhibit follicular development
and also suppress luteal function by inhibiting angiogenesis
in the corpus luteum. VEGF is expressed in a wide variety of
cells and tissues, including rodent and primate endometrium
(3, 11, 12). An interesting feature of VEGF structure is that
Abbreviations: Flt-1, VEGF receptor type 1 (fms-like tyrosine kinase
receptor); HD, hormone deprived; ICC, immunocytochemistry; ISH, in
situ hybridization; KDR/Flk-1, VEGF receptor type 2 (kinase insert
domain-containing receptor); P, progesterone; PVP, polyvinylpyrrolidone; VEGF, vascular endothelial growth factor; vWF, von Willebrand
factor.
mRNA, accompanied by strong increases in signals for VEGF
receptor types 1 and 2 in multiple profiles of small blood vessels immediately below the surface epithelium. This finding
implicates VEGF in the early angiogenic processes associated
with endometrial healing and regeneration. Vascular endothelial proliferation persisted throughout the cycle in the upper endometrial zones and showed a dramatic estrogendependent peak during the midproliferative phase. This
proliferative peak coincided with a peak in VEGF expression
in the endometrial stroma. Endothelial proliferation was also
significantly correlated with the degree of stromal VEGF expression during the proliferative and secretory stages of the
cycle. These results implicate VEGF of stromal origin in endometrial vascular proliferation. (J Clin Endocrinol Metab 87:
1845–1855, 2002)
multiple species of VEGF mRNA are generated by alternative splicing from a single VEGF gene containing eight exons,
separated by seven introns. These mRNAs result in the generation of four different molecular species, having, respectively, 121,165, 189, and 206 amino acids following signal
sequence cleavage (11). A fifth splice variant having 145
amino acids has been reported in the endometrium (13).
Human endometrium predominantly expresses 121 and 165
isoforms. Although VEGF mRNA expression in the endometrium changes during different stages of the cycle, there
is no qualitative shift in the expression of different splice
variants throughout the cycle (13–15). VEGF activity is
mainly mediated by two high-affinity tyrosine kinase receptors, VEGF receptor type 1 (fms-like tyrosine kinase receptor;
Flt-1) and VEGF receptor type 2 (kinase insert domaincontaining receptor; KDR/Flk-1) (11, 12).
Reports on ovarian steroid hormone regulation of VEGF
expression in the endometrium are inconsistent, mainly because of the use of immunocytochemistry (ICC) possibly
giving artifacts (16). Several ICC and in situ hybridization
(ISH) studies reported an increase in glandular VEGF expression during the secretory (13, 15–17) and menstrual
phases (13, 16), but other ICC studies found no difference in
glandular VEGF expression across the cycle (18, 19). Stromal
VEGF expression is generally reported to be low across the
menstrual cycle (15–18), whereas Li et al. (19) have demonstrated strong stromal expression during the proliferative
stage. Further, using ICC, Greb et al. (20) have reported that
VEGF expression is highest in the glandular epithelium of
leuprolide acetate (GnRH agonist) treated, hypoestrogenic
cynomolgus macaques and that P treatment of such animals
induced intense VEGF expression in the stroma. In contrast
1845
1846
J Clin Endocrinol Metab, April 2002, 87(4):1845–1855
to these in vivo results, treatment of isolated human endometrial stromal cells in cell culture with E2, progestins, or
both has been shown to consistently increase VEGF mRNA
and protein expression (14, 17). These studies depict a confusing picture of how hormones regulate VEGF in the
endometrium.
Several in vivo and in vitro studies indicate that VEGF is a
major regulator of endothelial cell proliferation (11). However, Gargett et al. (21) found no correlation between VEGF
production and endothelial cell proliferation in the human
endometrium. Also, there is considerable variability among
reports on the pattern of human endometrial vascular proliferation, with some studies indicating several peaks of proliferation (22, 23) and others indicating none (24). It has been
suggested that these differences among reports on VEGF
expression and vascular proliferation may be owing to variations in hormone levels at the time of endometrial sampling
or to variations in the region biopsied (25). The major limitation of many of the previous studies on VEGF expression
and vascular proliferation in the human endometrium is that
the biopsies were not removed at closely spaced intervals
from the time of menstruation through the early proliferative
phase, when the endometrium undergoes extensive reparative and regenerative processes.
To address these concerns, we used ovariectomized artificially cycling macaques and withdrew P at the end of cycle
to provide a starting point for synchronization of endometrial samples. We obtained full-thickness endometrial specimens in which we examined mRNA expression of VEGF
and its receptors and correlated these data with endothelial
cell proliferation on a zonal basis. We have previously reported that KDR is dramatically up-regulated in the stromal
cells of the superficial zones only during the premenstrual
stage regardless of whether E2 is maintained (26). In this
study, we evaluated expression of both KDR and Flt-1
mRNA in the endometrial vasculature throughout the cycle
including postmenstrual repair and the remainder of the
artificial proliferative phase, with and without E2 treatment,
and during the artificial secretory phase.
Materials and Methods
Experimental animals
All animal care during these studies was provided by the Division of
Animal Resources of the Oregon Regional Primate Research Center, in
accordance with the NIH guidelines for use of nonhuman primates and
as approved by the Primate Center Institutional Animal Care and Use
Committee. Adult female rhesus macaques (Macaca mulatta) were ovariectomized and treated sequentially with E2 and P to create artificial
menstrual cycles as described previously. Briefly, all macaques received
sc implants of 3-cm Silastic capsules packed with crystalline E2 (Sigma,
St. Louis, MO) to stimulate development of an artificial proliferative
phase endometrium. After 14 d, a 6-cm Silastic capsule packed with
crystalline P (Sigma) was implanted sc, and both implants remained in
place for 14 d to stimulate an artificial secretory phase endometrium.
Then the P implant was removed to induce menstruation. In one set of
P-withdrawn animals (n ⫽ 19) the E2 implant was left in place (to mimic
the natural cycle), and in another set (n ⫽ 16), the E2 implant was also
withdrawn (to assess the role of E2). Animals from whom both P and
E2 were removed are referred to further in the text as hormone-deprived
(HD) animals.
A third set of animals (n ⫽ 6) had their P implants removed and E2
maintained, but their uteri were not removed. After 14 d of E2, a P
implant was reintroduced to induce a secretory phase, and uteri were
Nayak and Brenner • VEGF and Endometrial Vascular Proliferation
removed after 7 and 14 d of E2⫹ P treatment. These samples represented
the mid- and late secretory phases of the cycle.
The various samples are referred to in the text and graphs as follows:
1) premenstrual phase: 1–2 d of P withdrawal (n ⫽ 4); 2) menstrual
phase: 3– 4 d of P withdrawal (n ⫽ 4); 3) early proliferative phase/
postmenstrual repair phase: 5– 6 d of P withdrawal (n ⫽ 4); 4) midproliferative phase: 8 –10 d of P withdrawal (n ⫽ 4); 6) late proliferative
phase: 14 d of P withdrawal (n ⫽ 3); 7) midsecretory phase: 7– 8 d of E2⫹
P treatment (n ⫽ 3); 8) late secretory phase: 14 d of E2⫹P treatment (n ⫽
3); 9) HD 1–2 d: 1–2 d after both E2 and P withdrawal (n ⫽ 3); 10) HD
3– 4 d: 3– 4 d of both E2 and P withdrawal (n ⫽ 3); 11) HD 5– 6 d: 5– 6
d of both E2 and P withdrawal (n ⫽ 4); 12) HD 8 –10 d: 8 –10 d of both
E2 and P withdrawal (n ⫽ 4); and 13) HD 14 d:14 d of both E2 and P
withdrawal (n ⫽ 2).
Endometrial tissue samples were collected by hysterectomy as described previously (26, 27). Briefly, the uterus was quartered along the
longitudinal axis and full-thickness uterine cross-sections (2 mm thick)
were prepared from each quarter for ICC and ISH. Tissues for ICC were
microwave stabilized for 7 sec in 0.5 ml HBSS (Life Technologies, Inc.,
Grand Island, NY), then chilled on ice in 10% sucrose dissolved in 0.1
m PBS, mounted in Tissue Tek II OCT (Miles Inc., Elkhart, IN) and frozen
in liquid propane. The samples for ISH were frozen without microwave
treatment. Some of the endometrial tissue samples collected for previous
studies (26, 27) were also used in this study to increase the sample size.
In each case, serum was harvested at the time of tissue collection, and
concentrations of serum E2 and P were determined by RIA as previously
validated (28). The serum levels of E2 and P were within the normal
physiological range for rhesus monkeys and identical to those previously reported by our laboratory (26).
ICC
Proliferating endothelial cells were detected by a double ICC procedure with a mouse monoclonal antibody to Ki-67 for proliferating cells
and a rabbit polyclonal antibody to von Willebrand factor (vWF) to
detect vascular endothelium. ICC was performed as described previously (26, 27, 29) with modifications. Briefly, fresh tissues were microwaved for 7 sec before being embedded in OCT, frozen in liquid propane, and cryosectioned at 7 ␮m. Cryosections were mounted on Super
Frost Plus slides (Fisher Scientific, Pittsburgh, PA), fixed in 0.2% picric
acid-2% paraformaldehyde in phosphate buffer saline at pH 7.3 for 10
min at room temperature, immersed twice for 2 min each in 85% ethanol
⫹ 1.5% polyvinylpyrrolidone (PVP) at 4C, rinsed in PBS, immersed twice
7 min each in 0.37% glycine in PBS ⫹ PVP, and then immersed in 0.1%
gelatin in PBS ⫹ PVP at 4 C. To inhibit endogenous peroxidase activity,
the sections were incubated with a solution containing glucose oxidase
(1 U/ml), NaAzide (1 mm), and glucose (10 mm) in PBS for 45 min.
Sections were then incubated with blocking serum for 20 min and then
with the mouse monoclonal primary antibody for Ki-67 (1:300, BioGenex
Laboratories, Inc. San Ramon, CA) overnight at 4 C. After rinsing and
immersion in blocking serum again, sections were incubated with a
biotinylated second antibody (antimouse) for 30 min at room temperature. Brown staining of nuclei that were immunopositive for Ki-67 was
achieved with the ABC kit (Vector Laboratories, Inc. Burlingame, CA),
which included 0.025% 3,3⬘ diaminobenzidine/4HCl (Dojindos DAB;
Wako Chemicals, Richmond, VA) in Tris buffer and 0.03% H2O2 (Fisher
Scientific), as described previously (26, 27). All slides were then washed
several times with 0.1% gelatin in PBS, incubated with blocking serum
for 20 min, and then with the rabbit polyclonal primary antibody for
vWF (1:4000, DAKO Corp., Carpinteria, CA) overnight at 4 C. Sections
were then rinsed and reincubated with blocking serum and then with
the biotinylated second antibody (antirabbit) for 30 min at room
temperature.
Blue-gray cytoplasmic staining of endothelial cells (vWF) was
achieved with a Vector SG substrate kit for peroxidase (Vector Laboratories, Inc.) by following the manufacturer’s instructions. The slides
were rinsed several times in deionized water and lightly counterstained
with hematoxylin to facilitate identification of cell types.
To validate that the Ki-67 counts were representative of the endothelial cells undergoing DNA synthesis, we also administered an iv
infusion of Br-dU (10 ml, 10 mg/ml) at three time points, starting 24, 16,
and 2 h before tissue collection, to two animals each during the early
proliferative stage, midproliferative stage, HD 5– 6 d, and HD 8 –10 d,
Nayak and Brenner • VEGF and Endometrial Vascular Proliferation
and one animal during the late proliferative stage. Labeled endothelial
cells were detected with a mouse monoclonal antibody to Br-dU (1:50,
ICN Biomedicals, Inc., Costa Mesa, CA) and the same rabbit polyclonal
antibody to vWF. Tissue processing and ICC were performed in exactly
the same manner as described for Ki-67 immunostaining except slides
used for Br-dU ICC were treated with 2N HCl at 25 C for 30 min as
required to detect DNA labeled with Br-dU. These preparations were
compared with the Ki-67 immunostaining to validate that the Ki-67
counts represented endothelial cells undergoing DNA synthesis. Total
number of endothelial cells and the number of Ki-67 or Br-dU-positive
endothelial cells (proliferating) were counted in the microvessels of the
upper and lower zones of each endometrial tissue section, and the
percentage of proliferating endothelial cells was calculated.
RT-PCR
We used RT-PCR for preparation of VEGF cDNA specific to rhesus
macaques by following the same procedure as described previously for
KDR and Flt-1 (26). Briefly, 5 ␮g total RNA prepared from rhesus
macaque endometrium was reverse transcribed with an oligo(dT)
primer and SuperScript II MMLV reverse transcriptase (Life Science
Technologies, Rockville, MD). The reverse transcriptase product was
then amplified with the 5⬘ and 3⬘ primers in a standard PCR reaction for
35 cycles at 92 C for 30 sec, 50 C for 30 sec, and 72 C for 1 min. Amplified
bands of the right size were gel isolated and subcloned into pGEM-T
(Promega Corp., Madison, WI). At least two clones with the right-sized
inserts were miniprepped (Perfect Preps; Eppendorf-5 Prime, Inc., Boulder, CO) and were sequenced on an ABI 373 XL sequencer. Primers for
the VEGF cDNA were selected on the basis of the homologous human
VEGF (37– 416 bp, accession # ⫻62568) sequences, which spans exons
1–5 and therefore would detect all known alternatively spliced variants
of VEGF gene. The forward and reverse primers used to amplify VEGF
cDNA were GGTGCATTGGAGCCTTGCCTTGCT and TCTTTGGTCTGCATTCACATTTGT, respectively. The partial cDNA sequence for rhesus macaque VEGF has been submitted to GenBank with accession
number AF 339737.
J Clin Endocrinol Metab, April 2002, 87(4):1845–1855 1847
Statistical analysis
All data were tested by one-way ANOVA, and significance between
groups was assessed with Fisher’s protected least significant difference
test (31). Results with a P value of less than 0.05 were considered
significant. Correlations were performed using the StatView software
(SAS Institute, Inc., Cary, NC), and coefficients of simple determination
(R2) were calculated.
Results
VEGF expression during the cycle
Figures 1-3 show the relative abundance of VEGF mRNA
expression as determined by silver grain counts over the
endometrial luminal (surface) epithelium, glands, and
stroma. These data show a peak in VEGF expression in the
surface epithelium during the early proliferative phase (Fig.
1), in the stroma during the midproliferative phase (Fig. 2),
and in the glands during the late secretory phase (Fig. 3).
Regardless of hormone treatment, both RNAase- and sensetreated control sections showed signal equivalent to background on glass slides away from the section (data not
shown). There was a gradient in VEGF expression from highest at the surface to minimal in the lower zones (Fig. 4, A and
B), and marked changes were evident only in the superficial
zone glands and stroma (Figs. 2 and 3). The lower zones
(basalis) showed no significant differences in VEGF expres-
ISH
ISH of frozen sections was conducted with 35S-UTP-labeled (NEN
Life Science Products, Boston, MA) sense and antisense riboprobes from
VEGF cDNA as described previously for KDR and Flt-1 (26). Briefly, 10
␮m frozen sections of endometrium mounted on Super Frost Plus slides
(Fisher Scientific) were fixed in 4% paraformaldehyde in PBS for 15 min
at 4 C. The tissue sections were rinsed in 2⫻ SSC, acetylated with 0.25%
acetic anhydride in 0.1 m triethanolamine (pH 8.0) for 10 min, rinsed in
2⫻ SSC, dehydrated through an ascending series of alcohols and air
dried. At this point at least one slide per tissue group was treated with
RNAase A (20 mg/ml, 0.5 m NaCl, 0.01 m Tris, 1 mm EDTA; pH 8.0) as
a negative control. Sections were then incubated at 55 C overnight in 10
mm DTT, 0.3 m NaCl, 20 mm Tris (pH 8.0), 5 mm EDTA, 1⫻ Denhardt’s
solution, 10% dextran sulfate, and 50% formamide containing the appropriate concentration of the sense and antisense probe (5 million
cpm/ml). After hybridization all slides were treated with RNAase A at
37 C for 30 min to inactivate nonhybridized probe, and the slides were
rinsed in a descending series of SSC (2⫻ SSC, 1⫻ SSC, 0.5⫻ SSC) and
then incubated in 0.1⫻ SSC at 65C (high stringency) for 30 min. Sections
were dehydrated in an ascending series of alcohol dilutions, vacuum
dried, coated with NTB2 autoradiographic emulsion (Eastman Kodak
Co., Rochester, NY), stored at 4 C for 10 d, developed in d-19 (Eastman
Kodak Co.), lightly counterstained with hematoxylin, dehydrated in an
ascending series of alcohol dilutions, cleared with xylene, and coverslipped with Permount (Fisher Scientific). Sense- and RNAase-treated
controls had no specific signals.
Silver grains over endothelial, stromal, surface, and glandular epithelial cells in different zones of endometrium were counted separately
as described previously with modifications (30). The counts were made
with MetaMorph (Universal Imaging Corp., Downingtown, PA) on images captured by a CoolSNAP color CCD digital camera (Roper Scientific, Inc., Tucson, AZ). The abundance of silver grains over the stroma,
surface, and glandular epithelium was expressed as the number of
grains per cell. The abundance of silver grains over endothelial cells was
expressed as the number of grains per unit area of vascular endothelium.
FIG. 1. VEGF mRNA expression in the endometrial surface (luminal)
epithelium: quantitative analysis of ISH preparations by grain
counts. In this bar diagram and in subsequent diagrams different bars
(mean ⫾ SE) represent percentage of maximum signal in different
hormonal states of endometrium. Premen, Premenstrual; EarlyPro,
early proliferative; MidPro, midproliferative; LatePro, late proliferative; MidSecr, midsecretory; LateSecr, late secretory; HD 1–2, HD
3– 4, HD 5– 6, HD 8 –10, and HD 14 represent respective days after
hormone deprivation (withdrawal of both E2 and P). VEGF mRNA
expression is increased after 5– 6 d of P withdrawal (EarlyPro and HD
5– 6) regardless of whether E2 is maintained. Bars with different
letter annotations are statistically different (P ⬍ 0.05).
1848
J Clin Endocrinol Metab, April 2002, 87(4):1845–1855
FIG. 2. VEGF mRNA expression in the superficial zone (upper third)
endometrial stroma: quantitative analysis of ISH preparations. Note
the peak of VEGF mRNA expression during the midproliferative
phase. Bars with different letter annotations are statistically different (P ⬍ 0.05).
sion at any of the time points that were sampled (data not
shown). No VEGF signal was evident over the vascular endothelium (Fig. 4C).
Immediately after P withdrawal, stromal VEGF expression, which was very low in the late secretory phase, was
dramatically increased in the upper superficial zones, and
VEGF expression in the glands remained high (Fig. 2 and 4).
After menstrual sloughing of the upper zones, the newly
formed surface epithelium showed a dramatic increase in
VEGF mRNA expression during the early proliferative stage
(Fig. 1, 5A). Of great interest, in the HD groups, exactly the
same pattern of up-regulation and localization of VEGF
mRNA in the glands, stroma, and luminal epithelium (Figs.
1–3, 5B) was found when both hormones were withdrawn
through HD 5– 6 d as observed from the late secretory phase
through early proliferative phase (5– 6 d after only P was
withdrawn). Subsequently, VEGF expression was increased
in the stroma during the proliferative stage with highest
expression after 8 –10 d of P withdrawal (midproliferative
stage) (Figs. 2, 5C). However, in the HD 8 –10 d group, stromal VEGF mRNA expression was significantly down-regulated (Figs. 2 and 5D). Overall, VEGF mRNA levels were also
very low in glands and surface epithelium after 8 –10 d of HD
(Figs. 1, 3, and 5D). These data indicate that although E2 is
not essential to the up-regulation of VEGF mRNA that occurs
immediately after P withdrawal during the very early proliferative phase, E2 is necessary for the increase in VEGF
mRNA that occurs later during the midproliferative phase.
Nayak and Brenner • VEGF and Endometrial Vascular Proliferation
FIG. 3. VEGF mRNA expression in the superficial zone (upper third)
glands: quantitative analysis of ISH preparations. Note the peak of
VEGF mRNA expression during the late secretory phase. Bars with
different letter annotations are statistically different (P ⬍ 0.05).
Expression of KDR and Flt-1 during the cycle
Throughout the cycle KDR and Flt-1 expression was confined to the endometrial vascular endothelium. However,
during the premenstrual stage and during HD 1–2, expression of KDR mRNA was very strongly up-regulated in the
endometrial stromal cells of the upper zone as previously
reported (26). No significant changes in KDR or Flt-1 mRNA
expression were observed in the lower zone endometrial
vessels throughout the induced menstrual cycle (data not
shown). Figures 6 and 7 depict the relative abundance of
KDR and Flt-1 mRNA expression only in the uppermost
endometrial zone vasculature under different hormonal conditions. There was a dramatic increase in Flt-1 and KDR
mRNA expression in multiple profiles of small blood vessels
just below the newly formed surface epithelium during the
early proliferative phase (after 5– 6 d of P withdrawal) as well
as in the HD 5– 6 d group (Fig. 8). Grain counts performed
on the early proliferative phase samples showed that the
signals in the upper zone vessels were significantly higher
than those in the lower zones (KDR: upper, 78.25 ⫾ 10.61,
lower, 47.25 ⫾ 6.83; Flt-1: upper, 70.50 ⫾ 10.37, lower, 27.50 ⫾
4.01; P ⬍ 0.05). By the midproliferative (d 8 –10) and late
proliferative phases (d 14), the signals in the upper zone had
somewhat diminished (Figs. 6 and 7). However, in the HD
8 –10 and HD 14 d groups, the signals had declined severely
and were significantly different from all other days (Figs. 6
and 7). These data indicate that E2 is not essential for the
increase in expression of Flt-1 and KDR that occurs in the
Nayak and Brenner • VEGF and Endometrial Vascular Proliferation
FIG. 4. Cellular localization of VEGF mRNA by ISH in the rhesus
macaque endometrium. The two columns represent late secretory and
premenstrual (1 d after P withdrawal) phases of the artificial menstrual cycle. In this and succeeding plates, the white line is drawn to
demarcate separation of the endometrium from the myometrium. Le,
Luminal (surface) epithelium; Gl, gland; S, stroma; arrows, blood
vessels. A and B are shown as darkfield images (original magnification, ⫻25). C and D are shown as bright-field images (original magnification, ⫻312). VEGF expression is strongly up-regulated in the
upper zone endometrial stroma after 1 d of P withdrawal (B).
superficial zones during the early healing and proliferative
phases of the cycle. However, E2 plays a role in sustaining
a baseline level of expression of Flt-1 and KDR in vessels from
d 8 through the remainder of the cycle.
VEGF expression in superficial zone endometrial stroma
correlates with vascular proliferation
Figure 9 presents representative photomicrographs showing detection of proliferating endothelial cells through ICC
colocalization of Ki-67 or Br-dU with vWF during the midproliferative stage in presence of E2. Ki-67- and Br-dUpositive endothelial cells were significantly correlated (R2 ⫽
0.92, P ⬍ 0.001), and both were found primarily in the superficial zones of endometrium (Fig. 9, A and B). Endothelial
cells in the lower zone vessels during the midproliferative
stage (Fig. 9, C and D), and also at all other times sampled,
were mostly negative for both Ki-67 and Br-dU.
The percent of Ki-67-positive endothelial cells during different hormonal states is presented in Fig. 10. Compared with
J Clin Endocrinol Metab, April 2002, 87(4):1845–1855 1849
FIG. 5. Effects of E2 on VEGF mRNA expression by ISH in the rhesus
macaque endometrium. The upper row (A and B) of this plate represents postmenstrual repair phase of the endometrium with (A, early
proliferative) or without (B, 6 d of HD) E2 treatments after 6 d of P
withdrawal. The lower row (C and D) represents endometrial sections
with (C, midproliferative) or without (D, 8 d of HD) E2 treatments
after 8 d of P withdrawal. The black line (C) is drawn to demarcate
separation of the luminal epithelium from the stroma. Original magnification, ⫻25.
all other stages of the cycle, there was a dramatic increase
(about 6-fold) in endothelial cell proliferation (Ki-67 labeling)
in the midproliferative stage (8 –10 d of P withdrawal). This
dramatic increase of proliferation did not occur in the HD
8 –10 d endometrial samples and was therefore E2 dependent. In absence of E2, overall endothelial cell proliferation
was significantly decreased and was nondetectable by HD
14 d.
The dramatic, E2-dependent midproliferative peak in endothelial proliferation (Fig. 10) coincided with the E2dependent peak in stromal VEGF expression (Fig. 2). Moreover, throughout the proliferative and secretory stages of the
cycle, the percentage of endothelial cell proliferation was
highly correlated with the degree of VEGF mRNA expression
in the superficial zone stroma (R2 ⫽ 0.734, P ⬍ 0.001). However, no significant correlation of vascular proliferation was
1850
J Clin Endocrinol Metab, April 2002, 87(4):1845–1855
Nayak and Brenner • VEGF and Endometrial Vascular Proliferation
FIG. 6. Quantification of KDR mRNA expression in the superficial
zone vessels. KDR expression is significantly (P ⬍ 0.05) increased
during the early proliferative stage and the equivalent days of HD
(5– 6 d). However, KDR mRNA expression is significantly reduced
after 8 d of HD in absence of E2. Bars with different letter annotations
are statistically different (P ⬍ 0.05).
FIG. 7. Quantification of Flt-1 mRNA expression in the superficial
zone vessels. As in Fig. 6, the pattern of Flt-1 mRNA expression is
identical to that of KDR expression in the upper zone endometrial
vessels. Bars with different letter annotations are statistically different (P ⬍ 0.05).
found either with VEGF expression in glands (R2 ⫽ 0.002, P ⬍
0.879) and surface epithelium (R2 ⫽ 0.012, P ⬍ 0.669) or with
KDR (R2 ⫽ 0.002, P ⬍ 0.870) and Flt-1 (R2 ⫽ 0.006, P ⬍ 0.775)
expression in the endothelium.
no expression in the vascular endothelium. These findings
are very similar to the ICC and ISH results reported by some
others in the human (13, 15, 17) and cynomolgus macaque
(20) endometrium. However, several other studies have
demonstrated localization of VEGF protein in the endometrial vascular endothelium (14, 16, 19). This immunoreactivity does not necessarily correspond to VEGF production in
endothelial cells because the antibodies used in the later
studies could also detect VEGF bound to its receptors in
endothelial cells (14).
Discussion
This is the first paper to report that the elevations in stromal VEGF that occur immediately after P withdrawal in the
nonhuman primate are independent of E2 action because
these increases occur similarly in the presence and absence
of E2. Further, the elevations that occur during the period of
postmenstrual repair in luminal VEGF together with KDR
and FLT-1 in subjacent blood vessels are also E2 independent. These events are most likely regulated by other factors,
to be discussed below. However, E2 is essential for vascular
proliferation in the proliferative phase because the midproliferative peak of vascular proliferation does not occur in the
absence of E2, and the baseline level of vascular proliferation
throughout the remainder of the proliferative phase is
greatly suppressed in the absence of E2. In addition, the
baseline level of KDR and FLT-1 expression in the vascular
endothelium depends on E2 because the expression of these
receptors is significantly reduced during d 8 –14 in the HD
groups that lack E2. These observations are discussed more
fully below.
Cellular localization of VEGF mRNA
Our ISH results show that VEGF mRNA expression was
confined to the luminal epithelium, glands, and stroma, with
Hormonal regulation of VEGF and its receptors
Recently, it has been demonstrated that E2 directly regulates VEGF gene transcription in endometrial cells through
a variant estrogen response element located 1.5 kb upstream
from the transcriptional start site (32). Several studies also
indicate that estrogen regulates VEGF mRNA expression in
human endometrial adenocarcinoma cells (13), stromal cells
(14, 17), and the rat uterus in vivo (33, 34). These are likely to
be primary estrogen receptor-mediated effects because the
induction peaks within 2 h (33, 34) and is blocked by pure
antiestrogens (35). This regulation by E2 is consistent with
our findings of E2-dependent increase in VEGF expression
during the midproliferative stage of the cycle and complete
suppression of VEGF expression in absence of E2 in equivalent HD samples. However, after P withdrawal, during the
premenstrual, menstrual, and postmenstrual repair stages of
the cycle, the increases in VEGF expression were identical,
whether E2 was present, indicating that E2 has no regulatory
Nayak and Brenner • VEGF and Endometrial Vascular Proliferation
J Clin Endocrinol Metab, April 2002, 87(4):1845–1855 1851
FIG. 8. KDR (A, B, E, F, I, J) and Flt-1 (C, D, G, H, K, L) mRNA expression by ISH during the postmenstrual repair phase in the rhesus macaque
endometrium. The upper row (A–D) of this plate shows darkfield images (original magnification, ⫻25), and the middle (E–H) and the lower
(I–L) rows show bright-field images (original magnification, ⫻312) of the upper and the lower zones of the endometrium, respectively. Both KDR
and Flt-1 expression are much higher in the blood vessels (arrows) immediately below the surface epithelium than the vessels in the lower zones.
role during this period. Furthermore, as the proliferative
phase progressed, there was significant reduction in stromal
VEGF mRNA expression from the midproliferative (d 8) to
the later proliferative stage (d 14) of the cycle, even though
E2 levels were held constant throughout this period. These
results suggest that other factors participate in regulation of
VEGF expression in vivo in the rhesus macaque endometrium.
Although a P response element has not yet been identified
in the VEGF gene, several reports indicate that progestins
alone or in combination with estrogens can stimulate VEGF
expression in human endometrial stromal cells in vitro (14,
17) and in the rodent uterus (33). However, our results are
consistent with the in vivo studies in human endometrium
(13) and show that after 14 d of P treatment, VEGF expression
was significantly down-regulated in the stroma but up-regulated in the glands. Our data strongly suggest that these
effects represent an indirect effect of P on VEGF expression
in vivo because they were not evident in the midsecretory
stage (7– 8 d after P treatment) but only in the late secretory
phase (14 d of P treatment). The long delay in this effect of
P suggests an indirect action of P and implicates other factors
in the increased glandular VEGF expression we observed.
Very little information is available concerning the hormonal regulation of VEGF receptors. A recent ICC study
1852
J Clin Endocrinol Metab, April 2002, 87(4):1845–1855
Nayak and Brenner • VEGF and Endometrial Vascular Proliferation
FIG. 10. Percentage of Ki-67-immunopositive proliferating endothelial cells in the upper zones of rhesus macaque endometrium. A rapid
burst of E2-dependent endothelial cell proliferation is seen during the
midproliferative phase. Bars with different letter annotations are
statistically different (P ⬍ 0.05).
FIG. 9. Representative sections showing detection of proliferating
endothelial cells by immunocytochemical colocalization of Ki-67 (A
and C) or Br-dU (B and D) with vWF after 8 d of P withdrawal
(midproliferative). The vWF immunostaining was used to define endothelial cells, and Ki-67 or Br-dU was used to identify proliferating
endothelial cells. The upper and the lower rows represent the upper
(A and B) and lower (C and D) zones of the endometrium, respectively.
Most of the endothelial cells (arrowheads) in the superficial zone
endometrium are immunopositive for Ki-67 (A) and Br-dU (B). Endothelial cells in the lower zone vessels are mostly negative for both
Ki-67 (C) and Br-dU (D). Original magnification, ⫻500.
indicates variations of staining intensity and number of
stained capillaries immunostained for Flt-1 and KDR during
different stages of the menstrual cycle in women (36). However, except for the postmenstrual repair phase, we did not
find any dramatic changes in Flt-1 or KDR mRNA expression
throughout most of the menstrual cycle in the rhesus macaque. The postmenstrual increase in Flt-1 and KDR mRNA
expression in the vessels immediately below the surface epithelium was also not regulated by E2 because a similar
pattern of expression was observed in the HD macaques
sampled at the same time. However, both Flt-1 and KDR
expression was significantly down-regulated after 8 d of HD,
suggesting a role for E2 in maintenance of VEGF receptors in
the vascular endothelium. Given the fact that VEGF can
regulate its own receptor expression (37–39) and that stromal
VEGF expression was significantly decreased in the HD
groups from d 8 –14 in the absence of E2 (Fig. 2), it is possible
that E2 maintains Flt-1 and KDR in the vascular endothelium
through stimulation of VEGF production. Alternatively,
ER␤, which has recently been found in the vascular endothelium of both the rhesus macaque (40) and human endometrium (40, 41), may mediate the effects of E2 on these
receptors more directly.
Role of VEGF during menstruation
Previously we have reported that KDR expression is dramatically up-regulated in the stromal cells of the superficial
endometrial zones during the premenstrual phase in both
human and macaque endometrium, and we suggested that
this receptor played a role in the menstrual induction cascade
(26). Here we report that during this same phase, VEGF
expression is also maintained at very high levels in the glands
and is dramatically increased in the stroma of the same upper
zones of the rhesus macaque endometrium. Our findings
differ from several reports (13, 16, 42) that state that VEGF
expression is increased only in glands during the menstrual
phase in the human endometrium. However, the endometrium collected by Pipelle biopsy during menstruation from
women may consist of only the deeper zones because these
are the only cells that persist after the upper zones have
sloughed away. Our premenstrual samples, taken 1–2 d after
P withdrawal, reveal the VEGF expression patterns in the
upper cells before menstrual sloughing begins. A hypoxic
injury might be the stimulus for this increase because many
in vitro studies indicate that hypoxia can up-regulate VEGF
expression in endometrial stromal (42, 43) and gland cells
(42). As originally described by Markee (44), after P withdrawal, vasoconstriction of the spiral arteries that primarily
vascularize the upper zones of endometrium could lead to
localized ischemic hypoxia and subsequent up-regulation of
VEGF in the upper zones. Matrix metalloproteinases are
presumed to be responsible for tissue destruction, and many
of these are expressed specifically by the stromal cells (26, 27)
in the same upper zones that express VEGF and KDR (26).
The coordinated expression of VEGF, KDR, and MMPs in the
Nayak and Brenner • VEGF and Endometrial Vascular Proliferation
premenstrual stage endometrium are consistent with our
earlier suggestion that there is a VEGF-KDR link in the menstrual induction cascade (26).
Role of VEGF in postmenstrual repair of endometrium
A very recent study (45) demonstrates that local administration of a neutralizing VEGF antibody inhibits wound
angiogenesis and granulation tissue formation. Also, several
studies (46 – 49) suggest a temporal and spatial correlation
between the expression of VEGF and its receptors in cutaneous wound healing. For example, there is pronounced
expression of VEGF in proliferating keratinocytes of the
newly formed epithelium and heightened expression of Flt-1
and KDR in the capillary vessels in close vicinity to the
epithelium during wound healing. Consistent with these
observations, our results indicate a dramatic up-regulation of
VEGF mRNA in the newly formed surface epithelium and an
increase in Flt-1 and KDR mRNA expression in multiple
profiles of small blood vessels just below the surface epithelium during the postmenstrual, endometrial repair phase,
implicating a role of VEGF in postmenstrual healing and
repair of endometrium. Several proinflammatory cytokines
and growth factors have been shown to enhance VEGF expression in vitro, including TNF, TGF, keratinocyte growth
factor, and epidermal growth factor (48, 50, 51). Because all
these factors are expressed in the endometrium and are
present at the wound site during the early phase of cutaneous
wound healing, they might be involved in the autocrine and
paracrine regulation of VEGF induction in the endometrium
during the postmenstrual repair phase.
Role of VEGF in endometrial vascular proliferation
In this study, we have used a double immunohistochemical procedure to identify proliferating endothelial cells and
validated this method using Br-dU incorporation. Identification of proliferating cells by immunohistochemical detection of Ki-67-positive cells always overestimates the number
of proliferating cells because it is not an exclusive S-phase
marker, unlike Br-dU incorporation. However, we did not
observe any significant differences in the percent of Ki-67
and Br-dU-positive endothelial cells when the Br-dU treatment was started 1 d before tissue collection. The Ki-67 data
therefore are equivalent to the sum of all cells that were
making DNA during the 24 h before tissue sampling.
Goodger (Macpherson) and Rogers (24) have reported no
peaks of vascular proliferation in the human endometrium
during the menstrual cycle. However, consistent with a previous study in the human (23), our findings in the rhesus
macaque endometrium clearly show that most vascular proliferation occurs during the midproliferative stage of the
cycle. The second wave of vascular proliferation reported by
Ferenczy et al. (23) during the midluteal phase of the cycle
was not evident in the rhesus macaque. However, we found
a steady level of expression of the Ki-67 antigen in endothelial cells during this period, and a steady rate of growth may
be sufficient to explain the steady increase in vascularity that
occurs during the luteal phase. The burst of vascular proliferation in the midproliferative phase may provide extensive
J Clin Endocrinol Metab, April 2002, 87(4):1845–1855 1853
vascular support for the intensive regenerative processes
that occur at that time. In spite of differences in reports on
the pattern of vascular proliferation during the cycle, all
studies (23, 24) including ours are in agreement that most of
the vascular proliferation occurs in the upper zones of the
primate endometrium.
This is the first study to examine the relationship between
VEGF expression and vascular endothelial cell proliferation
in the rhesus macaque endometrium. We found that the
midproliferative peak in stromal VEGF expression coincided
with the peak in endothelial proliferation and that VEGF
expression in the stroma, but not in the glands or surface
epithelium, was significantly correlated with vascular proliferation. In polarized human endometrial epithelial cells, it
has been shown that VEGF is preferentially secreted into the
lumen of endometrial glands (52). It is therefore unlikely that
the VEGF produced in glands has a role in endometrial
vascular proliferation. However, a recent study in the human
endometrium (21) shows lack of correlation between glandular or stromal VEGF production with vascular endothelial
proliferation. Nevertheless, the same study shows increases
in stromal VEGF immunostaining and percentage of proliferating vessels during the early proliferative stage (21). The
differences in the stage of the cycle (early vs. midproliferative
in our study) could be owing to different methods used to
define the stage of the cycle. In that study endometrial biopsy
samples were categorized based on menstrual histories and
Noyes’s criteria. Our data are from hormonally controlled
rhesus macaques in which the samples of each stage of the
cycle were synchronized by P withdrawal.
In summary, we have evaluated the relationships among
endothelial proliferation, ovarian steroid hormones, VEGF,
and VEGF receptors in the rhesus macaque endometrium
during hormonally regulated, artificial menstrual cycles. The
premenstrual surge in stromal VEGF mRNA supports our
view that VEGF could play a role in the menstrual cascade.
The postmenstrual expression of VEGF located in the surface
epithelium and its receptors localized in capillaries immediately below the luminal epithelium implicates VEGF and
its receptors in the early angiogenic processes associated
with endometrial healing and regeneration. Because postmenstrual repair and expression of VEGF and its receptors
occurred similarly in the presence and absence of E2, local
factors such as hypoxia and/or cytokines associated with
wound healing must play the key roles in up-regulation of
VEGF and its receptors during postmenstrual repair. However, E2 is essential to increase the expression of VEGF,
maintain its receptors, and increase the endothelial cell proliferation during the later stages of proliferative phase. During the luteal phase, P supports increases in glandular VEGF,
but this is more likely to play a role in the vascular remodeling that occurs during implantation and early pregnancy.
The significant correlation between VEGF expression in the
stroma and vascular proliferation suggests a role of VEGF on
endometrial vascular proliferation. However, further experimental studies with VEGF antibodies and/or VEGF receptor
inhibitors are needed to examine the contribution of VEGF
in the natural menstrual bleeding, postmenstrual repair, and regenerative processes that occur in the primate endometrium.
1854
J Clin Endocrinol Metab, April 2002, 87(4):1845–1855
Nayak and Brenner • VEGF and Endometrial Vascular Proliferation
Acknowledgments
We thank Kunie Mah and Jing Nie for technical assistance and Angela
Adler for word processing.
Received September 19, 2001. Accepted January 5, 2002.
Address all correspondence and requests for reprints to: Nihar R.
Nayak, Ph.D., Department of Gynecology and Obstetrics, Stanford University School of Medicine, 300 Pasteur Drive, HH-333, Stanford, California 94307-5317. E-mail: [email protected].
This work was supported by the Lalor Foundation (to N.R.N.), Mellon
Foundation (to N.R.N.), and NIH (HD19182 to R.M.B.).
22.
23.
24.
25.
26.
References
1. Reynolds LP, Killilea SD, Redmer DA 1992 Angiogenesis in the female
reproductive system. FASEB J 6:886 – 892
2. Rogers PAW, Gargett CE 1999 Endometrial angiogenesis. Angiogenesis 2:
287–294
3. Smith SK 1998 Angiogenesis, vascular endothelial growth factor and the
endometrium. Hum Reprod Update 4:509 –519
4. Gordon JD, Shifren JL, Foulk RA, Taylor RN, Jaffe RB 1995 Angiogenesis in
the human female reproductive tract. Obstet Gynecol Surv 50:688 – 697
5. Brenner RM, Slayden OD 1994 Cyclic changes in the primate oviduct and
endometrium. In: Knobil E, Neill JD, eds. The physiology of reproduction. New
York: Raven Press; 541–569
6. Carmeliet P, Ferreira V, Breier G, Pollefeyt S, Kieckens L, Gertsenstein M,
Fahrig M, Vandenhoeck A, Harpal K, Eberhardt C, Declercq C, Pawling J,
Moons L, Collen D, Risau W, Nagy A 1996 Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 380:
435– 439
7. Ferrara N, Carver-Moore K, Chen H, Dowd M, Lu L, O’Shea KS, PowellBraxton L, Hillan KJ, Moore MW 1996 Heterozygous embryonic lethality
induced by targeted inactivation of the VEGF gene. Nature 380:439 – 442
8. Fraser HM, Dickson SE, Lunn SF, Wulff C, Morris KD, Carroll VA, Bicknell
R 2000 Suppression of luteal angiogenesis in the primate after neutralization
of vascular endothelial growth factor. Endocrinology 141:995–1000
9. Zimmermann RC, Xiao E, Husami N, Sauer MV, Lobo R, Kitajewski J, Ferin
M 2001 Short-term administration of antivascular endothelial growth factor
antibody in the late follicular phase delays follicular development in the rhesus
monkey. J Clin Endocrinol Metab 86:768 –772
10. Wulff C, Wiegand SJ, Saunders PT, Scobie GA, Fraser HM 2001 Angiogenesis
during follicular development in the primate and its inhibition by treatment
with truncated flt-1-fc (vascular endothelial growth factor trapA40). Endocrinology 142:3244 –3254
11. Ferrara N 2000 Vascular endothelial growth factor and the regulation of angiogenesis. Recent Prog Horm Res 55:15–36
12. Klagsbrun M, D’Amore PA 1996 Vascular endothelial growth factor and its
receptors. Cytokine Growth Factor Rev 7:259 –270
13. Charnock-Jones DS, Sharkey AM, Rajput-Williams J, Burch D, Schofield JP,
Fountain SA, Boocock CA, Smith SK 1993 Identification and localization of
alternately spliced mRNAs for vascular endothelial growth factor in human
uterus and estrogen regulation in endometrial carcinoma cell lines. Biol Reprod
48:1120 –1128
14. Bausero P, Cavaillé F, Méduri G, Freitas S, Perrot-Applanat M 1998 Paracrine
action of vascular endothelial growth factor in the human endometrium:
production and target sites, and hormonal regulation. Angiogenesis 2:167–182
15. Torry DS, Holt VJ, Keenan JA, Harris G, Caudle MR, Torry RJ 1996 Vascular
endothelial growth factor expression in cycling human endometrium. Fertil
Steril 66:72– 80
16. Zhang L, Scott PAE, Turley H, Leek R, Lewis CE, Gatter KC, Harris AL,
Mackenzie IZ, Rees MC, Bicknell R 1998 Validation of anti-vascular endothelial growth factor (anti-VEGF) antibodies for immunohistochemical localization of VEGF in tissue sections: expression of VEGF in the human endometrium. J Pathol 185:402– 408
17. Shifren JL, Tseng JF, Zaloudek CJ, Ryan IP, Meng YG, Ferrara N, Jaffe RB,
Taylor RN 1996 Ovarian steroid regulation of vascular endothelial growth
factor in the human endometrium: implications for angiogenesis during the
menstrual cycle and in the pathogenesis of endometriosis. J Clin Endocrinol
Metab 81:3112–3118
18. Lau TM, Affandi B, Rogers PA 1999 The effects of levonorgestrel implants on
vascular endothelial growth factor expression in the endometrium. Mol Hum
Reprod 5:57– 63
19. Li XF, Gregory J, Ahmed A 1994 Immunolocalisation of vascular endothelial
growth factor in human endometrium. Growth Factors 11:277–282
20. Greb RR, Heikinheimo O, Williams RF, Hodgen GD, Goodman AL 1997
Vascular endothelial growth factor in primate endometrium is regulated by
oestrogen-receptor and progesterone-receptor ligands in vivo. Hum Reprod
12:1280 –1292
21. Gargett CE, Lederman FL, Lau TM, Taylor NH, Rogers PA 1999 Lack of
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
correlation between vascular endothelial growth factor production and endothelial cell proliferation in the human endometrium. Hum Reprod 14:2080 –
2088
Rogers PAW, Abberton KM, Susil B 1992 Endothelial cell migratory signal
produced by human endometrium during the menstrual cycle. Hum Reprod
7:1061–1066
Ferenczy A, Bertrand G, Gelfand MM 1979 Proliferation kinetics of human
endometrium during the normal menstrual cycle. Am J Obstet Gynecol 133:
859 – 867
Goodger (Macpherson) AM, Rogers PAW 1995 Endometrial endothelial cell
proliferation during the menstrual cycle. Hum Reprod 9:399 – 405
Rogers PA, Lederman F, Taylor N 1998 Endometrial microvascular growth in
normal and dysfunctional states. Hum Reprod Update 4:503–508
Nayak NR, Critchley HO, Slayden OD, Menrad A, Chwalisz K, Baird DT,
Brenner RM 2000 Progesterone withdrawal up-regulates vascular endothelial
growth factor receptor type-2 in the superficial zone stroma of the human and
macaque endometrium: potential relevance to menstruation. J Clin Endocrinol
Metab 85:3442–3452
Rudolph-Owen LA, Slayden OD, Matrisian LM, Brenner RM 1998 Matrix
metalloproteinase expression in Macaca mulatta endometrium: evidence for
zone-specific regulatory tissue gradients. Biol Reprod 59:1349 –1359
West NB, Hess DL, Brenner RM 1986 Differential suppression of progesterone
receptors by progesterone in the reproductive tract of primate macaques. J
Steroid Biochem 25:497–503
Slayden OD, Rubin JS, Lacey DL, Brenner RM 1999 Effects of keratinocyte
growth factor on the endometrium of rhesus macaques during the lutealfollicular transition. J Clin Endocrin Metab 85:275–285
Slayden O, Nayak N, Burton K, Chwalisz K, Cameron ST, Critchley HO,
Baird DT, Brenner RM 2001 Progesterone antagonists increase androgen
receptor expression in the rhesus macaque and human endometrium. J Clin
Endocrinol Metab 86:2668 –2679
Petersen RG 1985 Design and analysis of experiments. 6th ed. New York:
Marcel Dekker
Mueller MD, Vigne JL, Minchenko A, Lebovic DI, Leitman DC, Taylor RN
2000 Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors alpha and beta. Proc Natl Acad Sci USA 97:10972–
10977
Cullinan-Bove K, Koos RD 1993 Vascular endothelial growth factor/vascular
permeability factor expression in the rat uterus: rapid stimulation by estrogen
correlates with estrogen-induced increases in uterine capillary permeability
and growth. Endocrinology 133:829 – 837
Hyder SM, Stancel GM, Chiappetta C, Murthy L, Boettger-Tong HL, Makela
S 1996 Uterine expression of vascular endothelial growth factor is increased
by estradiol and tamoxifen. Cancer Res 56:3954 –3960
Hyder SM, Chiappetta C, Murthy L, Stancel GM 1997 Selective inhibition of
estrogen-regulated gene expression in vivo by the pure antiestrogen ICI
182,780. Cancer Res 57:2547–2549
Meduri G, Bausero P, Perrot-Applanat M 2000 Expression of vascular endothelial growth factor receptors in the human endometrium: modulation during
the menstrual cycle. Biol Reprod 62:439 – 447
Flamme I, Reutern MV, Drexler HCA, Syed-Ali S, Risau W 1995 Overexpression of Vascular endothelial growth factor in the avian embryo induces
hypervascularization and increased vascular permeability without alterations
of embryonic pattern formation. Dev Biol 171:399 – 414
Kremer C, Breier G, Risau W, Plate KH 1997 Up-regulation of flk-1/vascular
endothelial growth factor receptor 2 by its ligand in a cerebral slice culture
system. Cancer Res 57:3852–3859
Wang D, Donner DB, Warren RS 2000 Homeostatic modulation of cell surface
KDR and Flt1 expression and expression of the vascular endothelial cell growth
factor (VEGF) receptor mRNAs by VEGF. J Biol Chem 275:15905–15911
Critchley HO, Brenner RM, Henderson TA, Williams K, Nayak NR, Slayden
OD, Millar MR, Saunders PT 2001 Estrogen receptor beta, but not estrogen
receptor alpha, is present in the vascular endothelium of the human and
nonhuman primate endometrium. J Clin Endocrinol Metab 86:1370 –1378
Lecce G, Meduri G, Ancelin M, Bergeron C, Perrot-Applanat M 2001 Presence
of estrogen receptor beta in the human endometrium through the cycle: expression in glandular, stromal, and vascular cells. J Clin Endocrinol Metab
86:1379 –1386
Sharkey AM, Day K, McPherson A, Malik S, Licence D, Smith SK, Charnock-Jones DS 2000 Vascular endothelial growth factor expression in human
endometrium is regulated by hypoxia. J Clin Endocrinol Metab 85:402– 409
Popovici RM, Irwin JC, Giaccia AJ, Giudice LC 1999 Hypoxia and cAMP
stimulate vascular endothelial growth factor (VEGF) in human endometrial
stromal cells: potential relevance to menstruation and endometrial regeneration. J Clin Endocrinol Metab 84:2245–2248
Markee JE 1940 Menstruation in intraocular endometrial transplants in the
rhesus monkey. Contrib Embryol 28:219 –308
Howdieshell TR, Callaway D, Webb WL, Gaines MD, Procter Jr CD, Sathyanarayana, Pollock JS, Brock TL, McNeil PL 2001 Antibody neutralization of
vascular endothelial growth factor inhibits wound granulation tissue formation. J Surg Res 96:173–182
Brown LF, Yeo KT, Berse B, Yeo TK, Senger DR, Dvorak HF, van de Water
Nayak and Brenner • VEGF and Endometrial Vascular Proliferation
L 1992 Expression of vascular permeability factor (vascular endothelial growth
factor) by epidermal keratinocytes during wound healing. J Exp Med 176:
1375–1379
47. Peters KG, De Vries C, Williams LT 1993 Vascular endothelial growth factor
receptor expression during embryogenesis and tissue repair suggests a role in
endothelial differentiation and blood vessel growth. Proc Natl Acad Sci USA
90:8915– 8919
48. Frank S, Hübner G, Breier G, Longaker MT, Greenhalgh DG, Werner S 1995
Regulation of vascular endothelial growth factor expression in cultured keratinocytes. Implications for normal and impaired wound healing. J Biol Chem
270:12607–12613
J Clin Endocrinol Metab, April 2002, 87(4):1845–1855 1855
49. Lauer G, Sollberg S, Cole M, Flamme I, Sturzebecher J, Mann K, Krieg T,
Eming SA 2000 Expression and proteolysis of vascular endothelial growth
factor is increased in chronic wounds. J Invest Dermatol 115:12–18
50. Brown LF, Detmar M, Claffey K, Nagy JA, Feng D, Dvorak AM, Dvorak HF
1997 Vascular permeability factor/vascular endothelial growth factor: a multifunctional angiogenic cytokine. EXS 79:233–269
51. Steenfos HH 1994 Growth factors and wound healing. Scand J Plast Reconstr
Surg Hand Surg 28:95–105
52. Hornung D, Lebovic DI, Shifren JL, Vigne J-L, Taylor RN 1998 Vectorial
secretion of vascular endothelial growth factor by polarized human endometrial epithelial cells. Fertil Steril 69:909 –915