Sodium-Dependent Phosphate Cotransporters and
Phosphate-Induced Calcification of Vascular
Smooth Muscle Cells
Redundant Roles for PiT-1 and PiT-2
Matthew H. Crouthamel,* Wei Ling Lau,* Elizabeth M. Leaf, Nicholas W. Chavkin,
Mary C. Wallingford, Danielle F. Peterson, Xianwu Li, Yonggang Liu, Michael T. Chin,
Moshe Levi, Cecilia M. Giachelli
Downloaded from http://atvb.ahajournals.org/ by guest on June 14, 2017
Objective—Elevated serum phosphate has emerged as a major risk factor for vascular calcification. The sodium-dependent
phosphate cotransporter, PiT-1, was previously shown to be required for phosphate-induced osteogenic differentiation
and calcification of cultured human vascular smooth muscle cells (VSMCs), but its importance in vascular calcification
in vivo and the potential role of its homologue, PiT-2, have not been determined. We investigated the in vivo requirement
for PiT-1 in vascular calcification using a mouse model of chronic kidney disease and the potential compensatory role of
PiT-2 using in vitro knockdown and overexpression strategies.
Approach and Results—Mice with targeted deletion of PiT-1 in VSMCs were generated (PiT-1∆sm). PiT-1 mRNA levels
were undetectable, whereas PiT-2 mRNA levels were increased 2-fold in the vascular aortic media of PiT-1∆sm compared
with PiT-1flox/flox control. When arterial medial calcification was induced in PiT-1∆sm and PiT-1flox/flox by chronic kidney
disease followed by dietary phosphate loading, the degree of aortic calcification was not different between genotypes,
suggesting compensation by PiT-2. Consistent with this possibility, VSMCs isolated from PiT-1∆sm mice had no PiT-1
mRNA expression, increased PiT-2 mRNA levels, and no difference in sodium-dependent phosphate uptake or phosphateinduced matrix calcification compared with PiT-1flox/flox VSMCs. Knockdown of PiT-2 decreased phosphate uptake and
phosphate-induced calcification of PiT-1∆sm VSMCs. Furthermore, overexpression of PiT-2 restored these parameters in
human PiT-1–deficient VSMCs.
Conclusions—PiT-2 can mediate phosphate uptake and calcification of VSMCs in the absence of PiT-1. Mechanistically,
PiT-1 and PiT-2 seem to serve redundant roles in phosphate-induced calcification of VSMCs. (Arterioscler Thromb Vasc
Biol. 2013;33:2625-2632.)
Key Words: phosphate ◼ PiT-1 ◼ PiT-2 ◼ vascular calcification ◼ vascular smooth muscle cell
C
ardiovascular mortality remains the leading cause of
death in patients with chronic kidney disease (CKD).1
The extent of arterial calcification independently predicts
cardiovascular disease and mortality in patients with CKD,2
and this ectopic calcification occurs decades earlier in patients
with CKD than in the general population.3 The calcium phosphate mineral deposits occur in the form of hydroxyapatite
or whitlockite4 and can contribute to disease progression in
2 main locations within arterial vessels: the intimal layer and
the medial layer. Calcification associated with the intimal
layer is a reflection of atherosclerotic burden and may result
in arterial occlusion. Arterial medial calcification (AMC) contributes to vascular stiffening without occlusion and can lead
to hypertension and heart failure. Studies have shown that
AMC is a dominant form of vascular calcification (VC) in
dialysis patients.4–6
During the past decade, elevated serum phosphorus has
emerged as a key risk factor for VC in patients with CKD,
as well as the general population.7–9 High extracellular phosphate has been widely established to induce vascular smooth
muscle cell (VSMC) matrix calcification in vitro.10–12 Indeed,
elevated phosphate has been linked to several highly regulated processes in the vessel wall that promote AMC. These
include VSMC osteogenic differentiation, VSMC apoptosis,
and matrix degradation (reviewed in Lau et al13 and Shanahan
et al14). The phenotype change is particularly striking, whereby
the VSMCs cease to express smooth muscle markers (smooth
muscle-α actin, SM22) and instead express bone-forming
Received on: March 14, 2013; final version accepted on: August 4, 2013.
From the Departments of Bioengineering (M.H.C., E.M.L., N.W.C., M.C.W., D.F.P., X.L., C.M.G.), Nephrology (W.L.L.), and Cardiology (Y.L.,
M.T.C.), University of Washington, Seattle; and Department of Medicine, University of Colorado, Denver (M.L.).
The online-only Data Supplement is available with this article at http://atvb.ahajournals.org/lookup/suppl/doi:10.1161/ATVBAHA.113.302249/-/DC1.
*These authors are joint first authors.
Correspondence to Cecilia M. Giachelli, PhD, Department of Bioengineering, University of Washington, 3720 15th Ave NE, Foege N333C, Box 355061,
Seattle, WA 98195. E-mail [email protected]
© 2013 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
2625
DOI: 10.1161/ATVBAHA.113.302249
2626 Arterioscler Thromb Vasc Biol November 2013
Nonstandard Abbreviations and Acronyms
AMC
CKD
PiT-1
PiT-2
shRNA
VC
VSMC
arterial medial calcification
chronic kidney disease
type III sodium-dependent phosphate cotransporter 1 (SLC20A1)
type III sodium-dependent phosphate cotransporter 2 (SLC20A2)
short hairpin RNA interference
vascular calcification
vascular smooth muscle cell
Downloaded from http://atvb.ahajournals.org/ by guest on June 14, 2017
genes (core-binding factor α-1 Runx2/Cbfa1, osterix, alkaline
phosphatase, and osteopontin).10,15
Active transport of phosphate into cells is primarily mediated by 3 classes of sodium-dependent phosphate (NaPi)
cotransporters. Type I (SLC17 family) cotransporters are
involved in organic anion transport, including phosphate.16
The type II (SLC34 family) cotransporters, predominantly
expressed in kidney and intestinal epithelium, are important for whole-body phosphate homeostasis.17,18 The type III
(SLC20 family) cotransporters, PiT-1 and PiT-2, are more
generally expressed19 and have been identified as the predominant phosphate transporters in rat20 and human21 VSMCs.
PiT-1 and PiT-2 are 62% identical at the amino acid level
and both contain 12 transmembrane spanning domains with
a single large intracellular domain. They exhibit a high affinity for phosphate and have a preference to transport H2PO4−
more than HPO42−, with a 2:1 ratio of sodium:phosphate in
both acidic and alkaline pH.19 The Michaelis–Menten affinity constant (Km) for sodium-dependent phosphate uptake for
PiT-1 and PiT-2 is similar and ranges from 25 to 300 μmol/L
phosphate depending on the species.19,20,22–24
We have shown previously that PiT-1 was required for
phosphate-induced osteogenic differentiation and calcification of human VSMCs in vitro.21 When PiT-1 was knocked
down in human aortic VSMCs using short hairpin RNA interference (shRNA), phosphate-induced mineralization was suppressed, and VSMC phenotype was preserved. Subsequent
overexpression of mouse PiT-1 restored phosphate transport,
VSMC osteogenic phenotype change, and calcification.21
Given the compelling in vitro evidence, we hypothesized
that PiT-1 would be required for VC in vivo. To test this,
a well-characterized mouse model of phosphate-driven uremic AMC was used.25–27 Calcification-prone DBA/2J mice,28
when subjected to partial renal ablation, develop robust
AMC on dietary phosphate loading without atherosclerosis
or inflammation.25–27 As global deletion of PiT-1 is lethal
during mouse embryogenesis,24,29 we generated VSMCspecific knockout of PiT-1 using a SM22 promoter–driven
Cre/loxP system. This resulting PiT-1flox/flox;Sm22-Cre+/0 dual
transgenic mouse line (abbreviated as PiT-1∆sm) lacked PiT-1
expression in VSMCs. Unexpectedly, sodium-dependent
phosphate uptake and matrix mineralization in isolated
VSMCs, as well as high-phosphate feeding–induced uremic
AMC, did not differ between PiT-1∆sm and PiT-1flox/flox control mice, prompting us to examine potential compensatory
mechanisms. Our data indicate that PiT-2 compensates for
PiT-1 in phosphate uptake and matrix mineralization in vitro
and are the first to suggest redundant roles for PiT-1 and
PiT-2 in phosphate-driven AMC.
Materials and Methods
Materials and Methods are available in the online-only Supplement.
Results
PiT-1 and PiT-2 Are the Only NaPi
Cotransporters Expressed by Mouse VSMCs
Reverse transcription polymerase chain reaction (PCR) was
used to determine the expression profile of NaPi cotransporters in cultured C57/Bl6 wild-type VSMCs. Using this technique, no specific bands were obtained using primers for type
I transporters (SLC17A1, A4 and A7) or type II transporters
(SLC34A1, A2 and A3), whereas both type III transporters
were detected (Figure I in the online-only Data Supplement).
VSMC-Specific Knockdown of PiT-1
In contrast to the global PiT-1 knockout that resulted in
embryonic lethality because of anemia,24,29 mice with smooth
muscle–specific PiT-1 deletion were born at the expected
Mendelian ratios and showed no gross abnormalities in
health, weight, or lifespan (data not shown). Likewise, histological analyses of aortas from these mice were normal
(data not shown). As shown in Figure II in the online-only
Data Supplement, PCR amplification of genomic DNA isolated from VSMCs from PiT-1∆sm mice showed a 500-bp band
(compared with 950 bp band in the PiT-1flox/flox cells) consistent
with deletion of exons 3 and 4. Western blotting confirmed
the depletion of PiT-1 protein in whole aortic tissue in PiT1∆sm mice (Figure 1A and 1B), and immunochemistry showed
selective PiT-1 depletion in VSMCs but not endothelial cells
(Figure 1C). Consistent with the immunostaining data, PiT-1
mRNA was undetectable in the aortic media isolated from
healthy PiT-1∆sm mice (Figure III in the online-only Data
Supplement). Because a trend for decreased expression of
PiT-1 mRNA in cardiac tissue from PiT-1∆sm compared with
PiT-1flox/flox was observed, and because SM22α is transiently
expressed in the heart during mouse embryogenesis,30 there
was a possibility that SM22α promoter–driven PiT-1 deletion
could have affected cardiogenesis. However, resting echocardiography under minimal sedation on healthy PiT-1∆sm
mice showed no difference in ejection fraction, left ventricular wall thickness, and left ventricular end-diastolic volume,
compared with wild-type controls (Table II in the online-only
Data Supplement).
Deletion of PiT-1 From VSMCs Had
No Effect on AMC Induced by Uremia
and High-Phosphate Feeding
We previously developed and characterized a CKD mouse
model of AMC using calcification-prone DBA/2J mice fed
a high-phosphate diet.25–27 In this model, robust AMC in the
absence of inflammation or atherosclerosis develops in CKD
mice in response to high-phosphate feeding but does not
occur in CKD mice fed a normal phosphate diet. Thus, this
model is well suited to investigating the role of phosphatedependent mechanisms in AMC. To determine whether the
Crouthamel et al PiT-1 and PiT-2 in Vascular Calcification 2627
Figure 1. Type III sodium-dependent phosphate
cotransporter 1 (PiT-1) protein depletion in PiT-1∆sm
aortic medial smooth muscle cells. A, Representative Western blot showing whole aorta extract
from PiT-1flox/flox (fl/fl) and PiT-1∆sm (∆SM) mice using
an anti-PiT-1 antibody (top, arrow). Amido blackstained loading control (bottom). B, Densitometric
analysis of PiT-1 protein levels in pooled aortic
media from PiT-1flox/flox (fl/fl; n=8) and PiT-1∆sm (∆SM;
n=8) mice normalized to the loading control and
given in arbitrary units (AU). C, Immunohistochemistry using anti–PiT-1 antibody performed on wildtype (WT) and PiT-1∆sm (∆SM) paraffin-embedded
aorta sections. No primary, Negative control that
was not treated with the anti–PiT-1 antibody.
Arrows, Positive staining in medial vascular
smooth muscle cell (S) and endothelial cells (E) in
WT, but only endothelial cells (E) in PiT-1∆sm. Scale
bars, 50 μm.
Downloaded from http://atvb.ahajournals.org/ by guest on June 14, 2017
SMC-Specific Deletion of PiT-1 Did Not
Alter Phosphate-Induced Calcification of
Aortic Rings and Cultured VSMCs
loss of PiT-1 expression in smooth muscle cell (SMC) would
affect the extent of calcification in this animal model, partial
renal ablation was used to generate CKD in PiT-1flox/flox and
PiT-1∆sm mice (n=16 per group). After feeding with the highphosphate diet for 4 weeks, calcium accumulated in the aorta
as expected, but the extent of calcification did not differ significantly between the 2 groups (Figure 2A). Consistent with
previous studies,25–27 no AMC was observed in CKD mice
fed a normal phosphate diet (PiT-1flox/flox=0.9±0.1 μg/mg; PiT1∆sm=0.6±0.1 μg/mg). Serum chemistries after renal ablation were not statistically different between groups fed high
phosphate (Table), suggesting that differences in the degree of
renal ablation or hyperphosphatemia achieved did not explain
the lack of effect of PiT-1 deletion on AMC.
To determine whether compensatory circulating factors might
explain the lack of effect of PiT-1 deletion on AMC in uremic
mice, in vitro calcification of aortic rings and isolated VSMCs
was assessed. Aortas were harvested from PiT-1flox/flox and PiT1∆sm mice to generate aortic rings, and calcification was induced
by incubation in high-phosphate media for 9 days. As shown
in Figure 3A, there was no significant difference in calcification between the 2 groups. Similar to the results in aortic rings,
we found no significant difference in the extent of calcification
between PiT-1∆sm and PiT-1flox/flox in cultured VSMCs after treatment with high-phosphate media for 6 to 10 days (Figure 3B).
Aortas From PiT-1∆sm and PiT-1flox/flox Mice Showed
Similar Histology and SMC Gene Expression
Deletion of PiT-1 in Mouse VSMCs Had
No Effect on Phosphate Uptake
Aortas from high-phosphate–fed PiT-1∆sm and PiT-1flox/flox
CKD mice showed similar calcified medial wall lesions by
von Kossa staining, characterized by elastocalcinosis in the
absence of inflammatory cells (Figure 2B). Hematoxylin and
eosin evaluation showed no differences in vascular wall structure between PiT-1∆sm and PiT-1flox/flox CKD mice (Figure 2C-i
and 2C-ii), and elastin degradation was evident in both experimental groups under eosin fluorescence imaging (Figure 2Ciii and 2C-iv). VSMC phenotype change, as characterized
by the loss of SM22α staining (Figure 2C-v and 2C-vi), was
apparent in both groups. Furthermore, transcriptional profiling
of aortic mRNA showed increased expression of osteochondrogenic markers Runx2, osteopontin, and osteoprotegerin in
CKD versus healthy PiT-1flox/flox mice aortas, but no statistically
significant differences were observed in these genes between
CKD PiT-1∆sm and PiT-1flox/flox mice fed a high-phosphate
diet (Table III in the online-only Data Supplement). Finally,
because recent studies have implicated PiT-1 in cell proliferation and survival,31,32 we counted the number of VSMCs
per cross-sectional area of aorta to determine whether there
was a reduction in VSMCs within the medial layer. VSMC
cell densities in PiT-1flox/flox and PiT-1∆sm were 3565±378 and
4158±332 cells/mm2 (mean±SEM), respectively, showing no
statistical difference between genotypes (P=0.27).
Sodium-dependent phosphate uptake kinetics were determined in cultured VSMCs from PiT-1flox/flox and PiT-1∆sm
mice and revealed no significant differences between the 2
genotypes when nonlinear curve fitting assuming Michaelis–
Menten kinetics was performed (P=0.6; Figure 3C). The Vmax
was measured as 0.315±0.042 and 0.285±0.038 pmol/μg protein per minute with a Km of 0.223±0.061 and 0.205±0.057
mmol/L for the PiT-1flox/flox and PiT-1∆sm VSMCs, respectively.
Sodium-dependent uptake was unchanged in the presence of
0 to 1 mmol/L phosphonoformic acid, an inhibitor of type II
NaPi transport (Figure 3D). As the Ki of phosphonoformic
acid for PiT-1 and PiT-2 is in the range of 2.5 to 5 mmol/L,33,34
lack of inhibition by phosphonoformic acid at submillimolar
concentrations indicated that type II transporters were not
contributing to phosphate uptake in the cultured VSMCs. This
finding is consistent with the reverse transcription PCR data
that showed no expression of type II transporters in mouse
VSMCs (Figure I in the online-only Data Supplement).
VSMC-Specific Knockdown of PiT-1 Was
Associated With PiT-2 Upregulation
Because sodium-dependent phosphate uptake was unchanged
in PiT-1 knockout cells compared with controls, we suspected
2628 Arterioscler Thromb Vasc Biol November 2013
Downloaded from http://atvb.ahajournals.org/ by guest on June 14, 2017
Figure 2. Aortic calcification in uremic, high-phosphate–fed mice.
A, Aortic calcium content was not different (P=0.35) between the
high-phosphate–fed chronic kidney disease mice in the PiT-1∆sm
group vs the PiT-1flox/flox group. Data are mean±SE and n=16 per
group. B, Von Kossa staining (brown) with hematoxylin counterstain (blue) showing medial calcification in aortas from (i) PiT-1flox/flox mouse and (ii) PiT-1∆sm mouse. Scale bars, 50 μm. C, Aortic sections from PiT-1flox/flox (i, iii, and v) and PiT-1∆sm (ii, iv, and vi) mice
showing similar hematoxylin and eosin staining (i and ii), eosin
fluorescence (iii and iv) with arrowheads showing elastin strand
breaks, and SM22α staining with methyl green nuclear counterstain (v and vi), with arrows pointing to smooth muscle cell nuclei
within the calcified area that have lost or have much reduced
SM22α staining compared with adjacent noncalcified areas.
Scale bars, 25 μm. PiT-1 indicates type III sodium-dependent
phosphate cotransporter 1.
that PiT-2 might be compensating for the loss of PiT-1 in
VSMC. Real-time quantitative PCR showed that aortic media
PiT-2 mRNA was 2-fold higher in PiT-1∆sm mice compared
with PiT-1flox/flox controls. All other tissues examined showed
no difference in PiT-2 expression between the genotypes
Table. Treatment Group (n=16)
PiT-1
flox/flox
PiT-1∆sm
P
Ca
CKD
Parameters,
mg/dL
BUN
P
(Figure 4A). Likewise, aortic VSMCs isolated from and PiT1∆sm mice had 2-fold higher PiT-2 mRNA levels compared
with PiT-1flox/flox (P<0.002; Figure 4B). Consistent with the
mRNA data, PiT-2 protein levels were increased ≈1.6-fold
in whole aorta extracts and ≈3.8-fold in VSMC extracts from
PiT-1∆sm mice compared with PiT-1flox/flox (Figure 4C and
4D). Expression of type I (SLC17a1) and type II (SLC34a1,
SLC34a2, or SLC34a3) sodium-dependent phosphate cotransporters was undetectable in the aortas of high-phosphate–fed
PiT-1flox/flox and PiT-1∆sm CKD mice (data not shown).
Overexpression of PiT-2 in PiT-1 Knockdown
VSMCs Restored Phosphate Uptake and
Phosphate-Induced Calcification
Serum Chemistries
Pre-CKD
Parameters,
mg/dL
Figure 3. Aortic ring calcification and phosphate uptake in
PiT-1∆sm (ΔSM) and PiT-1flox/flox (fl/fl) vascular smooth muscle cells
(VSMCs). A, Calcification of mouse aortic rings in response to
normal (1 mmol/L; open bars) or elevated (2.6 mmol/L; black
bars) phosphate, n=5 per group. Data are given as mean±SD.
B, Fold difference in calcification of PiT-1∆sm VSMCs relative to
PiT-1flox/flox VSMCs after treatment with 2.6 mmol/L phosphate.
Data are the average of 4 separate experiments using cell passages 6–8 and were treated for 9–12 days in duration. Expressed
as mean±SEM. C, Radiolabeled phosphate transport assays in
VSMCs from PiT-1flox/flox (circles) and PiT-1∆sm (squares) mice. Data
are expressed as mean±SD. D, Lack of inhibition of phosphate
uptake by the type II NaPi inhibitor phosphonoformic acid (PFA).
Circles are PiT-1flox/flox, squares are PiT-1∆sm. Closed symbols are
in the presence of sodium, open symbols are in the absence of
sodium. Data are expressed as mean±SD. PiT-1 indicates type III
sodium-dependent phosphate cotransporter 1.
Ca
8.5±1.6
9.4±0.2
45±6.5
11±0.9
9.6±0.6
8.1±1.3
9.3±0.2
41±5.1
13.3±2.1
9.3±0.9
BUN was measured in all mice. Pre-CKD Ca and P were measured from 6
mice per group, CKD Ca and P were measured in 3 mice per group. Data are
mean±SE. Parameters were not significantly different between groups. BUN
indicates blood urea nitrogen; Ca, calcium; n, number of mice in each treatment
group; and P, phosphate.
We previously reported that knockdown of PiT-1 expression in human VSMCs using shRNA decreased phosphate
uptake, phosphate-induced calcification, and osteogenic differentiation without compensation by PiT-2.21 Thus, to determine whether PiT-2 could functionally compensate for the
loss of PiT-1 in VSMCs, we overexpressed PiT-2 by retroviral transduction into PiT-1 knockdown human VSMCs that
were previously shown to express ≈80% less PiT-1 than controls.21 Overexpression of PiT-2 was confirmed by quantitative PCR (Figure 5A, graph) and Western blotting (Figure 5A,
Crouthamel et al PiT-1 and PiT-2 in Vascular Calcification 2629
Downloaded from http://atvb.ahajournals.org/ by guest on June 14, 2017
Figure 4. Type III sodium-dependent phosphate
cotransporter 2 (PiT-2) expression in tissues and
vascular smooth muscle cell (VSMCs) from PiT-1∆sm
and PiT-1flox/flox mice. A, Quantitative polymerase
chain reaction (qPCR) for PiT-2 mRNA expression in various tissues. mRNA levels were derived
from standard curves and normalized to 18s and
expressed as ratio of mean mRNA levels in PiT-1∆sm
tissue relative to mean levels in PiT-1flox/flox tissue.
Error bars represent SD. PiT-2 expression was
2-fold higher in the aortic media of PiT-1∆sm mice.
PiT-2 levels were unchanged in the other tissues
surveyed. B, qPCR of PiT-1 and PiT-2 mRNA in
cultured VSMCs, showing basal PiT-2 expression in
PiT-1flox/flox (fl/fl) VSMCs and increased PiT-2 expression in PiT-1∆sm (ÄSM). C, Western blot for PiT-2
(top) and loading control (bottom) in whole aorta
extracts. D, Western blot for PiT-2 (top) and loading
control (bottom) in VSMC extracts.
inset). Overexpression of PiT-2 restored phosphate uptake
(Figure 5B) and calcification (Figure 5C) in PiT-1 shRNA
cells. Overexpression of PiT-2 also significantly promoted
osteogenic differentiation of VSMCs as measured by a 30%
increase in osteogenic index (ratio of osteopontin/SM22α
mRNA levels) compared with vector control after elevated
phosphate treatment (data not shown). These data indicated
that PiT-2 could functionally compensate for the loss of PiT-1
in terms of phosphate uptake, phosphate-induced osteogenic
differentiation, and calcification.
Knockdown of PiT-2 in PiT-1–Deficient Mouse
VSMCs Decreased Phosphate Transport
and Phosphate-Induced Calcification
To determine whether PiT-2 was functionally compensating for PiT-1 in the PiT-1∆sm VSMCs, we transduced these
cells with scrambled control or PiT-2–specific shRNA to create PiT-1/PiT-2 double knockdown VSMCs. In these cells,
PiT-2 mRNA expression was reduced by ≈80% compared
with the control cells (Figure 6A). Subsequently, sodiumdependent phosphate uptake was significantly decreased by
≈35% (Figure 6B) and phosphate-induced calcification was
significantly decreased by ≈20% in PiT-1 knockdown VSMCs
compared with the scrambled control (Figure 6C).
Discussion
Overall, our studies show that deletion of PiT-1 selectively
from VSMCs does not alter the extent of AMC in CKD mice
fed a high-phosphate diet. Similarly, sodium-dependent phosphate uptake in VSMCs, as well as calcification of explanted
aortic rings, and VSMC primary cultures treated with highphosphate media were equivalent in PiT-1∆sm and PiT-1flox/flox
mice. Interestingly, PiT-2 expression was increased 2-fold in
PiT-1∆sm VSMCs compared with PiT-1flox/flox mice, suggesting
that this type III NaPi family member might be compensating
for the loss of PiT-1. A compensatory role was supported by in
vitro studies because overexpression of PiT-2 restored calcification in cultured PiT-1–deficient human VSMCs; in addition,
knockdown of PiT-2 in PiT-1∆sm VSMCs diminished calcification. These are the first studies to demonstrate a redundant role
for PiT-1 and PiT-2 in VC.
Previous work in our group demonstrated a role for PiT-1
in phosphate-induced human VSMC calcification and osteochondrogenic transformation in vitro.21 Knockdown of PiT-1
by shRNA suppressed phosphate-induced calcification and
osteochondrogenic phenotype change but did not block SMC
apoptosis induced by high phosphate under serum-free conditions. Others have seen similar results in osteoblast cultures
where knockdown of PiT-1 reduced matrix mineralization and
reduced expression of osteoblast markers such as osteopontin.35,36 More recently, Sugita et al37 found that cellular phosphate transport and ATP synthesis mediated by PiT-1 were
critical for chondrogenesis in mice. Together, these studies
support the hypothesis that PiT-1 is a key player in elevated
phosphate-induced calcification. Thus, it was surprising that
no differences in SMC phenotype modulation or AMC were
observed between PiT-1∆sm and PiT-1flox/flox mice after CKD
and high-phosphate feeding. Furthermore, no difference was
observed in calcification of cultured aortic rings from PiT-1∆sm
and PiT-1flox/flox mice, suggesting that compensation by circulating factors was unlikely. Finally, isolated VSMC from PiT1∆sm and PiT-1flox/flox showed no difference in sodium-dependent
phosphate uptake kinetics in vitro. These findings led us to
consider a potential cell autonomous compensatory mechanism in SMCs deficient in PiT-1.
We discovered that PiT-2 mRNA expression was upregulated in aortas in response to developmental loss of PiT-1
specifically in mouse SMCs. This finding was distinct from
our previous findings in human VSMC, where levels of
PiT-2 were low and unchanged after shRNA knockdown of
PiT-1, pointing to a potential developmental compensatory
2630 Arterioscler Thromb Vasc Biol November 2013
Downloaded from http://atvb.ahajournals.org/ by guest on June 14, 2017
Figure 5. Overexpression of type III sodium-dependent phosphate cotransporter 2 (PiT-2) in PiT-1 knockdown human aortic
vascular smooth muscle cells (VSMCs). A, PiT-2 levels in PiT-1
knockdown (PiT-1 short hairpin RNA interference [shRNA]
treated) human VSMCs transduced with vector alone (Vector) or
PiT-2 cDNA (PiT-2), or control VSMCs treated with scrambled
shRNA (Scramble). Graph shows PiT-2 mRNA levels as determined by quantitative polymerase chain reaction, expressed as
PiT-2 mRNA levels relative to Vector. Inset, PiT-2 protein levels
(top; arrow) and α-tubulin loading control (bottom) as determined by Western blotting. B, Restoration of inorganic phosphate uptake by PiT-2 overexpression in PiT-1 knockdown cells.
Phosphate uptake was measured in 0.1 mmol/L phosphate in a
30-minute period. C, Restoration of phosphate-induced calcification by PiT-2 overexpression in PiT-1 knockdown cells. Data are
mean±SD, n=3 per group.
mechanism (discussed in more detail below). The increase in
PiT-2 expression in PiT-1∆sm aortas was selective because no
change in other known sodium-dependent phosphate cotransporters was detected. The increase in PiT-2 compensated for
PiT-1 in phosphate transport and VC in vitro. Overexpression
of PiT-2 in PiT-1–deficient human SMC restored phosphate
uptake and calcification after elevated phosphate treatment.
Furthermore, siRNA knockdown of PiT-2 in PiT-1∆sm VSMCs
diminished both phosphate uptake and calcification. Together,
these data support the hypothesis that PiT-2 could compensate for PiT-1 in both sodium-dependent phosphate uptake and
phosphate-induced calcification.
Figure 6. Knockdown of type III sodium-dependent phosphate
cotransporter 2 (PiT-2) in PiT-1∆sm mouse vascular smooth
muscle cells (VSMCs). A, Quantitative polymerase chain reaction
showing ≈80% knockdown of PiT-2 mRNA in PiT-1 knockdown
VSMC (PiT-2 short hairpin RNA interference [shRNA]) compared
with scrambled shRNA control VSMC (scrambled). B, Decreased
uptake of radiolabeled phosphate in PiT-2 shRNA expressing
human VSMCs compared with scrambled. Cells were incubated
in 0.16 mmol/L phosphate for 20 minutes. C, PiT-2 knockdown
decreased calcification of PiT-1∆sm VSMCs under high-phosphate
conditions (PiT-1/PiT-2 double knockdown cells). Open bars,
1 mmol/L phosphate; black bars, 2.6 mmol/L phosphate. Data
are mean±SD, n=3 per group.
Although we were able to knockdown PiT-2 mRNA levels by ≈80% in PiT-1∆sm VSMC, we observed only a 35%
decrease in sodium-dependent phosphate uptake and 20%
decrease in phosphate-induced calcification. There are several
possible explanations for this observation. First, a low density of PiT-2 transporter may be sufficient, within the duress
of a high-phosphate milieu, to initiate the signaling cascade
that results in VSMC calcification. Second, because decline
in phosphate uptake and phosphate-induced calcification were
comparable, our data might suggest that the phosphate uptake
function of PiT-2 is most critical for VSMC calcification.
Finally, a combination of these mechanisms may be acting to
explain the results.
A review of the literature shows that regulation of PiT-1 and
PiT-2 expression is specific to the cell type, physiological state,
Crouthamel et al PiT-1 and PiT-2 in Vascular Calcification 2631
Downloaded from http://atvb.ahajournals.org/ by guest on June 14, 2017
and treatment agent. Byskov32 (in MC3T3-E1 and NIH3T3 cell
lines) and our laboratory (unpublished data in mouse VSMCs)
have shown that the expression of PiT-1 and PiT-2 is variable
based on cell density in vitro, whereby increased cell density
results in lower PiT-1 and PiT-2 mRNA expression. Bone
morphogenetic protein-2 has been shown to increase PiT-1,
but not PiT-2, mRNA expression in MC3T3-E1 osteoblast
cell and human VSMC in vitro.35,38 Likewise, platelet-derived
growth factor-BB increased PiT-1 mRNA and protein in rat
VSMCs with no change in PiT-2.39 Our data showing PiT-2
upregulation in VSMCs in response to PiT-1 deletion are in
agreement with other reports. Beck et al24 demonstrated that in
mice with a global deletion of PiT-1, PiT-2 was upregulated in
the embryonic liver, and Byskov et al32 showed PiT-2 mRNA
upregulation in MC3T3-E1 after PiT-1 shRNA knockdown.
However, we are the first to demonstrate that PiT-2 can functionally compensate for PiT-1 in VSMC calcification.
As mentioned above, PiT-2 mRNA expression was upregulated in VSMCs in response to developmental loss of PiT-1
specifically in mouse SMCs, and this finding was in contrast
to results obtained when shRNA was used to more acutely
knockdown PiT-1 in cultured human SMCs. Although the
underlying mechanisms of developmental compensation
are often enigmatic, the increased level of PiT-2 expression
observed in the PiT-1 knockout mice, together with published
literature, suggests ≥2 potential compensatory mechanisms.
In the first hypothetical mechanism, a decrease in PiT-1 triggers a regulatory switch, which in turn results in increased
transcriptional activation of PiT-2, either through increased
expression or post-translational stabilization of a transcriptional activator, or increased accessibility of the PiT-2 promoter. Molecular cloning and sequence analysis have revealed
several potential cis-acting elements in the PiT-2 promoter,
including a CACCC (Kruppel-like factor) binding site, thyroid hormone response elements, serum response elements,
retinoic acid response elements, and vitamin D3-response
elements.40 Examination of the endogenous activity of these
candidate upstream regulators and their interaction with the
PiT-2 promoter in vivo may reveal important information
about the mechanism of compensation. Importantly, a KLF
family member was recently shown to regulate expression
of PiT-1 during erythroid maturation.41 Alternately, the compensatory mechanism may be independent of transcriptional
regulation. A decrease in phosphate levels is known to result
in enhanced mRNA stability of PiT-2.42,43 It is possible that
the decrease in phosphate intake caused by the absence of
PiT-1 during development results in a prolonged half-life of
PiT-2 and, in turn, the higher levels of PiT-2 mRNA that we
observed by quantitative PCR (Figure 4A). Future analysis of
PiT-1/PiT-2 double knockout models along with evaluation of
candidate PiT-2 transcriptional regulators and examination of
PiT-2 mRNA stability in vivo will be required to test these 2
hypotheses. Finally, potential species differences in PiT compensation cannot be ruled out.
The idea that both PiT-1 and PiT-2 may be important regulators of VC is further strengthened by recent findings in rare
human genetic syndromes. Wider et al44 found that mutations
in PiT-2 associated with impaired phosphate transport caused
familial idiopathic basal ganglia calcification, a condition
characterized by mineralization of capillaries, as well as small
arteries and veins of the basal ganglion region.44 Although the
exact mechanism for this effect is unknown, the authors speculated that the loss of PiT-2 function and regional phosphate
homeostasis might lead to increased PiT-1 function in VSMC,
thereby promoting osteochondrogenic differentiation and calcification. Furthermore, the overexpression of PiT-1 has been
reported in fibroblasts derived from patients with Werner syndrome, an autosomal recessive disorder caused by mutations
in RecQ DNA helicase that is characterized by premature
aging and soft tissue calcification.45
In summary, although we have shown that the extent of
AMC in high-phosphate–fed uremic mice was not different
either between the PiT-1∆sm and PiT-1flox/flox or in vitro using
VSMC primary culture from these mice, we discovered
increased PiT-2 expression in the PiT-1∆sm VSMCs. Using
in vitro methods, we demonstrated that PiT-2 overexpression could compensate for phosphate uptake and phosphateinduced calcification in PiT-1–deficient VSMCs, whereas
knockdown of PiT-2 reduced phosphate uptake and calcification. Taken together our data suggest redundant roles for PiT-1
and PiT-2 in phosphate-driven AMC.
Sources of Funding
This study was funded by National Institutes of Health grants to Dr
Giachelli (R01 HL62329 and R01 HL081785). W.L. Lau and M.H.
Crouthamel received funding from T32 HL007828 (NHLBI), and
W.L. Lau was also funded by T32 DK007467 (NIDDK).
Disclosures
None.
References
1. U.S. Renal Data System (usrds) 2011 Annual Data Report. Atlas of
End-Stage Renal Disease in the United States. Bethesda, MD: National
Institutes of Health, National Institute of Diabetes and Digestive and
Kidney Diseases. http://www.usrds.org/adr.htm. Accessed March 1, 2013.
2. Blacher J, Guerin AP, Pannier B, Marchais SJ, London GM. Arterial calcifications, arterial stiffness, and cardiovascular risk in end-stage renal
disease. Hypertension. 2001;38:938–942.
3. Goodman WG, Goldin J, Kuizon BD, Yoon C, Gales B, Sider D, et al.
Coronary-artery calcification in young adults with end-stage renal disease
who are undergoing dialysis. N Engl J Med. 2000;342:1478–1483.
4. Schlieper G, Aretz A, Verberckmoes SC, Krüger T, Behets GJ, Ghadimi R,
et al. Ultrastructural analysis of vascular calcifications in uremia. J Am Soc
Nephrol. 2010;21:689–696.
5. Shroff RC, McNair R, Figg N, Skepper JN, Schurgers L, Gupta A, et al.
Dialysis accelerates medial vascular calcification in part by triggering
smooth muscle cell apoptosis. Circulation. 2008;118:1748–1757.
6. Ibels LS, Alfrey AC, Huffer WE, Craswell PW, Anderson JT, Weil R III.
Arterial calcification and pathology in uremic patients undergoing dialysis. Am J Med. 1979;66:790–796.
7. Dhingra R, Sullivan LM, Fox CS, Wang TJ, D’Agostino RB Sr, Gaziano
JM, et al. Relations of serum phosphorus and calcium levels to the incidence of cardiovascular disease in the community. Arch Intern Med.
2007;167:879–885.
8. Kestenbaum BR, Adeney KL, de Boer IH, Ix JH, Shlipak MG, Siscovick
DS. Incidence and progression of coronary calcification in chronic kidney disease: the Multi-Ethnic Study of Atherosclerosis. Kidney Int.
2009;76:991–998.
9. Tonelli M, Curhan G, Pfeffer M, Sacks F, Thadhani R, Melamed ML, et al.
Relation between alkaline phosphatase, serum phosphate, and all-cause or
cardiovascular mortality. Circulation. 2009;120:1784–1792.
10.Jono S, McKee MD, Murry CE, Shioi A, Nishizawa Y, Mori K, et al.
Phosphate regulation of vascular smooth muscle cell calcification. Circ
Res. 2000;87:E10–E17.
2632 Arterioscler Thromb Vasc Biol November 2013
Downloaded from http://atvb.ahajournals.org/ by guest on June 14, 2017
11. Giachelli CM, Jono S, Shioi A, Nishizawa Y, Mori K, Morii H. Vascular
calcification and inorganic phosphate. Am J Kidney Dis. 2001;38(4 Suppl
1):S34–S37.
12.Lomashvili KA, Cobbs S, Hennigar RA, Hardcastle KI, O’Neill WC.
Phosphate-induced vascular calcification: role of pyrophosphate and
osteopontin. J Am Soc Nephrol. 2004;15:1392–1401.
13. Lau WL, Pai A, Moe SM, Giachelli CM. Direct effects of phosphate on
vascular cell function. Adv Chronic Kidney Dis. 2011;18:105–112.
14. Shanahan CM, Crouthamel MH, Kapustin A, Giachelli CM. Arterial calcification in chronic kidney disease: key roles for calcium and phosphate.
Circ Res. 2011;109:697–711.
15. Steitz SA, Speer MY, Curinga G, Yang HY, Haynes P, Aebersold R, et
al. Smooth muscle cell phenotypic transition associated with calcification: upregulation of Cbfa1 and downregulation of smooth muscle lineage
markers. Circ Res. 2001;89:1147–1154.
16.Reimer RJ, Edwards RH. Organic anion transport is the primary function of the SLC17/type I phosphate transporter family. Pflugers Arch.
2004;447:629–635.
17. Marks J, Debnam ES, Unwin RJ. Phosphate homeostasis and the renalgastrointestinal axis. Am J Physiol Renal Physiol. 2010;299:F285–F296.
18. Werner A, Dehmelt L, Nalbant P. Na+-dependent phosphate cotransporters: the NaPi protein families. J Exp Biol. 1998;201(Pt 23):3135–3142.
19.Kavanaugh MP, Miller DG, Zhang W, Law W, Kozak SL, Kabat D, et
al. Cell-surface receptors for gibbon ape leukemia virus and amphotropic
murine retrovirus are inducible sodium-dependent phosphate symporters.
Proc Natl Acad Sci USA. 1994;91:7071–7075.
20.Villa-Bellosta R, Bogaert YE, Levi M, Sorribas V. Characterization of
phosphate transport in rat vascular smooth muscle cells: implications for
vascular calcification. Arterioscler Thromb Vasc Biol. 2007;27:1030–1036.
21. Li X, Yang HY, Giachelli CM. Role of the sodium-dependent phosphate
cotransporter, Pit-1, in vascular smooth muscle cell calcification. Circ Res.
2006;98:905–912.
22.Olah Z, Lehel C, Anderson WB, Eiden MV, Wilson CA. The cellular
receptor for gibbon ape leukemia virus is a novel high affinity sodiumdependent phosphate transporter. J Biol Chem. 1994;269:25426–25431.
23.Bøttger P, Hede SE, Grunnet M, Høyer B, Klaerke DA, Pedersen L.
Characterization of transport mechanisms and determinants critical for
Na+-dependent Pi symport of the PiT family paralogs human PiT1 and
PiT2. Am J Physiol Cell Physiol. 2006;291:C1377–C1387.
24. Beck L, Leroy C, Beck-Cormier S, Forand A, Salaün C, Paris N, et al. The
phosphate transporter PiT1 (Slc20a1) revealed as a new essential gene for
mouse liver development. PLoS ONE. 2010;5:e9148.
25. El-Abbadi MM, Pai AS, Leaf EM, Yang HY, Bartley BA, Quan KK, et al.
Phosphate feeding induces arterial medial calcification in uremic mice:
role of serum phosphorus, fibroblast growth factor-23, and osteopontin.
Kidney Int. 2009;75:1297–1307.
26. Pai A, Leaf EM, El-Abbadi M, Giachelli CM. Elastin degradation and vascular smooth muscle cell phenotype change precede cell loss and arterial
medial calcification in a uremic mouse model of chronic kidney disease.
Am J Pathol. 2011;178:764–773.
27.Lau WL, Leaf EM, Hu MC, Takeno MM, Kuro-o M, Moe OW, et al.
Vitamin D receptor agonists increase klotho and osteopontin while
decreasing aortic calcification in mice with chronic kidney disease fed a
high phosphate diet. Kidney Int. 2012;82:1261–1270.
28.Ivandic BT, Utz HF, Kaczmarek PM, Aherrahrou Z, Axtner SB,
Klepsch C, et al. New Dyscalc loci for myocardial cell necrosis and
calcification (dystrophic cardiac calcinosis) in mice. Physiol Genomics.
2001;6:137–144.
29. Festing MH, Speer MY, Yang HY, Giachelli CM. Generation of mouse
conditional and null alleles of the type III sodium-dependent phosphate
cotransporter PiT-1. Genesis. 2009;47:858–863.
30. Li L, Miano JM, Cserjesi P, Olson EN. SM22 alpha, a marker of adult
smooth muscle, is expressed in multiple myogenic lineages during
embryogenesis. Circ Res. 1996;78:188–195.
31. Beck L, Leroy C, Salaün C, Margall-Ducos G, Desdouets C, Friedlander
G. Identification of a novel function of PiT1 critical for cell proliferation and independent of its phosphate transport activity. J Biol Chem.
2009;284:31363–31374.
32.Byskov K, Jensen N, Kongsfelt IB, Wielsøe M, Pedersen LE, Haldrup
C, et al. Regulation of cell proliferation and cell density by the inorganic
phosphate transporter PiT1. Cell Div. 2012;7:7.
33.Ravera S, Virkki LV, Murer H, Forster IC. Deciphering PiT transport
kinetics and substrate specificity using electrophysiology and flux measurements. Am J Physiol, Cell Physiol. 2007;293:C606–C620.
34. Virkki LV, Biber J, Murer H, Forster IC. Phosphate transporters: a tale
of two solute carrier families. Am J Physiol Renal Physiol. 2007;293:
F643–F654.
35.Suzuki A, Ghayor C, Guicheux J, Magne D, Quillard S, Kakita A, et
al. Enhanced expression of the inorganic phosphate transporter Pit-1 is
involved in BMP-2-induced matrix mineralization in osteoblast-like cells.
J Bone Miner Res. 2006;21:674–683.
36. Yoshiko Y, Candeliere GA, Maeda N, Aubin JE. Osteoblast autonomous
Pi regulation via Pit1 plays a role in bone mineralization. Mol Cell Biol.
2007;27:4465–4474.
37.Sugita A, Kawai S, Hayashibara T, Amano A, Ooshima T, Michigami
T, et al. Cellular ATP synthesis mediated by type III sodium-dependent
phosphate transporter Pit-1 is critical to chondrogenesis. J Biol Chem.
2011;286:3094–3103.
38. Li X, Yang HY, Giachelli CM. BMP-2 promotes phosphate uptake, phenotypic modulation, and calcification of human vascular smooth muscle
cells. Atherosclerosis. 2008;199:271–277.
39. Villa-Bellosta R, Levi M, Sorribas V. Vascular smooth muscle cell calcification and SLC20 inorganic phosphate transporters: effects of PDGF,
TNF-alpha, and Pi. Pflugers Arch. 2009;458:1151–1161.
40. Bai L, Collins JF, Xu H, Xu L, Ghishan FK. Molecular cloning of a murine
type III sodium-dependent phosphate cotransporter (Pit-2) gene promoter.
Biochim Biophys Acta. 2001;1522:42–45.
41. Forand A, Beck L, Leroy C, Rousseau A, Boitez V, Cohen I, et al. EKLFdriven PIT1 expression is critical for mouse erythroid maturation in vivo
and in vitro. Blood. 2013;121:666–678.
42. Richardson C, Bank A. Developmental-stage-specific expression and regulation of an amphotropic retroviral receptor in hematopoietic cells. Mol
Cell Biol. 1996;16:4240–4247.
43. Chien ML, O’Neill E, Garcia JV. Phosphate depletion enhances the stability of the amphotropic murine leukemia virus receptor mRNA. Virology.
1998;240:109–117.
44.Wider C, Dickson DW, Schweitzer KJ, Broderick DF, Wszolek ZK.
Familial idiopathic basal ganglia calcification: a challenging clinicalpathological correlation. J Neurol. 2009;256:839–842.
45. Honjo S, Yokote K, Fujimoto M, Takemoto M, Kobayashi K, Maezawa
Y, et al. Clinical outcome and mechanism of soft tissue calcification in
Werner syndrome. Rejuvenation Res. 2008;11:809–819.
Significance
Vascular calcification (VC) is a major risk factor for cardiovascular morbidity and mortality, and elevated phosphate has been identified as a
key inducer of vascular calcification via procalcific effects on vascular smooth muscle cells. We identified a novel function for the sodiumdependent phosphate transporter, PiT-2, as a mediator of elevated-phosphate–induced vascular calcification in vitro and in vivo. Moreover,
we provide mechanistic insight into compensatory mechanisms that operate in smooth muscle cells to protect against phosphate transporter
deficiency. Importantly, as our studies were in progress, PiT-2 was identified as the causative gene for idiopathic basal ganglion calcification
in people, and thus our studies noting compensatory mechanisms for phosphate transporters may help to explain how mutation of PiT-2
might lead to compensatory changes that actually facilitate vascular calcification. Clinically, our data provide a cautionary note on compensatory pathways that should be considered when attempting to translate inhibition of phosphate transport to clinical therapies.
Downloaded from http://atvb.ahajournals.org/ by guest on June 14, 2017
Sodium-Dependent Phosphate Cotransporters and Phosphate-Induced Calcification of
Vascular Smooth Muscle Cells: Redundant Roles for PiT-1 and PiT-2
Matthew H. Crouthamel, Wei Ling Lau, Elizabeth M. Leaf, Nicholas W. Chavkin, Mary C.
Wallingford, Danielle F. Peterson, Xianwu Li, Yonggang Liu, Michael T. Chin, Moshe Levi and
Cecilia M. Giachelli
Arterioscler Thromb Vasc Biol. 2013;33:2625-2632; originally published online August 22,
2013;
doi: 10.1161/ATVBAHA.113.302249
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2013 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/33/11/2625
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2013/08/22/ATVBAHA.113.302249.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Full Title:
Sodium-dependent phosphate cotransporters and phosphate-induced calcification of vascular smooth
muscle cells: Redundant roles for PiT-1 and PiT-2
Authors:
Matthew H. Crouthamel, PhD*1, Wei Ling Lau, MD*2, Elizabeth M. Leaf1, Danielle F. Peterson1,
Xianwu Li, PhD1, Yonggang Liu3, Michael T. Chin, MD/PhD3, Moshe Levi 4, Mary Wallingford, PhD1,
Nick Chavkin, Cecilia M. Giachelli, PhD1
*joint first authorship
Departments of 1Bioengineering, 2 Nephrology, and 3Cardiology, University of Washington, Seattle,
Washington and 4Medicine, University of Colorado, Denver, ‘Colorado
SUPPLEMENTAL MATERIAL
Supplemental Tables
Table I: PCR primers and probes.
Gene
SLC17A1
Forward primer
Reverse primer
Taqman probe
Applied Biosystems TaqMan® Gene Expression Assay: Mm00436577_m1
SLC17A4
Applied Biosystems TaqMan® Gene Expression Assay: Mm00621610_m1
SLC17A7
Applied Biosystems TaqMan® Gene Expression Assay: Mm00812886_m1
SLC34A1
GAGCCCTTCACAAGACTCATCAT
CGGCAATGCTGGTGATCA
n.a.
SLC34A2
TCGTCAGCATGGTTGCTTCT
TGTTAGCGCCCATGATGATG
n.a.
SLC34A3
CCTCAGCTCTGCTTTCCAGCTA
AGCACCACATTGTCCTTGAAAA
n.a.
TTCCTTGTTCGTGCGTTCATC
AATTGGTAAAGCTCGTAAGCCATT
CCGTAAGGCAGATCC
GACCGTGGAAACGCTAATGG
CTCAGGAAGGACGCGATCAA
CATGGTTGGTTCAGCTG
ACCACAGTCCATGCCATCAC
TCCACCACCCTGTTGCTGTA
n.a.
PiT-1
(SLC20A1)
PiT-2
(SLC20A2)
GAPDH
Table II. Echocardiography data.
PiT-1flox/flox
0.83 + 0.04
Left ventricular
end-diastolic
dimension
(mm)
3.53 + 0.19
PiT-1∆sm
0.9 + 0.03
3.36 + 0.31
Genotype
n=3 per group
Left ventricular
wall thickness
(mm)
Ejection
fraction
(%)
Fractional
shortening
(%)
Heart rate
(beats per
minute)
Body
weight
(gm)
75.3 + 2.6
43.2 + 2.2
558 + 26
28.8 + 2.5
74.9 + 3.6
42.8 + 3.3
572 + 29
29.6 + 0.5
Table III. Osteochondrogenic Gene Expression
Gene
Fold difference
Fold Difference
CKD-fl/fl /nonCKD-fl/fl
p=
CKD-∆sm /CKD- fl/fl
p=
Osteopontin
42
0
1.2
n/s
Runx2
4.3
0.000207934
0.6
n/s
Osteoprotegerin
2.6
.00815541
0.9
n/s
RNA sequencing as described in the Methods section was used to determine fold differences in mRNA
levels between groups (all fed high phosphate). CKD=chronic kidney disease; fl/fl= PiT-1flox/flox ; ∆sm=
PiT-1∆sm ; n/s=not significant.
Supplemental Figures
Figure I. Cotransporter gene expression in VSMCs. A) Reverse transcription PCR determination of
SLC17 (type I), SLC34 (type II), and SLC20 (type III) sodium-dependent phosphate cotransporter mRNA
expression in cultured mouse VSMCs and positive control tissues listed. B) Reverse transcription PCR of
the house keeping gene Gapdh. Only type III transporters (PiT-1 and PiT-2) were detected in VSMCs.
∆sm
PiT-1
PiT-1
fl/fl
Wild-type
Ladder
500bp
Band size (bp)
800 950 500
Figure II: PCR amplification of genomic DNA using PiT-1 primers spanning exon 2 through exon
5. Addition of LoxP sites into the PiT-1 gene results in a 150 base pair increase in amplicon size in the
PiT-1fl/fl VSMCs compared to wild-type PiT-1. Cre mediated deletion of exon 3 and 4 in the PiT-1∆sm
VSMCs results in a 450 bp reduction in amplicon size, compared to PiT-1flox/flox VSMCs.
Relative mRNA expression
2.5
2.0
1.5
1.0
*
0.5
0.0
*
Figure III. Selective deletion of PiT-1 from VSMCs in PiT-1∆sm mice. Real time quantitative PCR
determination of PiT-1 mRNA expression in various tissues. mRNA levels were derived from standard
curves and normalized to 18s, and data expressed as ratio of mean mRNA levels in PiT-1∆sm tissue
relative to mean levels in PiT-1flox/flox tissue, error bars represent standard deviation. PiT-1 was
undetectable in isolated aortic media, and was significantly decreased in whole aorta. There was a nonsignificant trend for decreased expression in the heart and small intestine. No significant difference in
expression levels was noted in the other tissues surveyed.
Materials and Methods:
VSMC-specific PiT-1 deletion
Generation of mice carrying the floxed PiT-1 conditional allele (PiT-1flox/flox) was previously described1.
The conditional allele has loxP sites flanking exons 3 and 4; removal of these exons in the presence of
Cre recombinase results in an early stop codon after position 120, removing 83% of the full-length protein
that includes 4 of the 6 residues important for phosphate transport1. Sm22-Cre+/0 mice that express Cre
from a smooth muscle specific Sm22α promoter2 were kindly provided by Dr. David Dichek (University
of Washington). PiT-1flox/flox and Sm22-Cre+/0 lines were bred onto DBA/2J background and C57/Bl6
backgrounds until congenic. Genotyping of mice using DNA from tail biopsies was done using the
HotSHOT method as previously described1.
Reverse-transcription PCR for VSMC NaPi transporters
VSMCs were isolated from the aortic media of healthy wild-type mice as previously described3. RNA
from VSMCs at passage 10 was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA), and firststrand cDNA was made using the Omniscript Reverse Transcriptase kit from Qiagen. To identify NaPi
transporters expressed by mouse VSMCs, intron-spanning mouse SLC20 and SLC34 primers were
designed using Primer-Express software V2.0 (Applied Biosystems, Foster City, CA) (supplemental
Table I). SLC17 pre-mixed primer/probe sets were ordered from Applied Biosystems (for SLC17A1, A4
and A7). Positive control mouse cDNA was as follows: kidney for SLC17A1, SLC34A1, SLC34A2 and
SLC34A3; small intestine for SLC17A4; brain for SLC17A7; and cementoblast OCCM for PiT-1 and
PiT-2.
Taqman real-time quantitative PCR (qPCR)
To confirm selective knockdown of PiT-1 from VSMCs, analysis of PiT-1 and PiT-2 expression in
various tissues was performed (normalized to 18s rRNA). Intron-spanning mouse SLC20 primers/probes
were designed using Primer-Express software V2.0 (Applied Biosystems, Foster City, CA). The TaqMan
probes use a FAM (fluorochrome reporter) tag at the 5’-end and a MGB quencher at the 3’-end. Aortic
media (pooled from 2–4 mice), aorta, heart, lung, liver, kidney, bladder, skeletal muscle, small intestine,
bone marrow, ovaries and testes from healthy knockout and control mice were harvested. Two animals
were analyzed per group, and if a difference in gene expression was found, this was confirmed by
analyzing an additional two mice per group. Tissues were pulverized in liquid nitrogen, and RNA was
extracted using chloroform and Trizol (Invitrogen, Carlsbad, California) then further purified using the
RNeasy Mini Kit (Qiagen). First-strand cDNA was made from 1 µg total RNA using the Omniscript
Reverse Transcriptase kit from Qiagen. Amplification and detection of cDNA of interest were carried out
in 96-well optical plates on an ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster
City, CA) with TaqMan Universal PCR 2x master mix in a final volume of 25 µL per reaction. Each
reaction was performed in triplicate at 50oC for 2 min, 95oC for 10 min, followed by 40 cycles of 95oC for
15 s and 60oC for 1 min. Products were analyzed with the manufacturer’s software, SDS 1.1 (Applied
Biosystems). Standard curves were generated from cDNA of mouse cultured cementoblast OCCM. Gene
mRNA expression was normalized to the housekeeping gene 18S, then normalized to the PiT-1flox/flox
control using the formula 2-ΔΔCt where ΔΔCt=(Ctxtransporter gene - Ct18S)-(CtPiT-1flox/floxtransporter gene - Ct18S).
Western blotting.
Aortas were pulverized in liquid nitrogen and collected in lysis buffer containing 50mM Tris-HCl [pH
7.4], 150mM NaCl, 1% Triton-X100, 0.5% Sodium Deoxycholate, 0.1% SDS, 1mM EDTA, 1mM
EGTA, and protease inhibitors. Cultured mouse and human VSMCs were lysed in the same buffer. 30ug
protein lysate was run on a 10% SDS PAGE gel and transferred to PVDF membrane. For mouse lysates,
membranes were blocked and incubated in either primary chicken anti-rat PiT-1 antibody or rabbit antiPiT-2 antibody (provided by Dr. M. Levi) at a 1:1000 dilution overnight and incubated in the secondary
(Donkey Anti-Chicken-horse radish peroxidase (HRP) or Goat Anti-Rabbit-HRP from Jackson
ImmunoResearch) at a 1:2000-1:5000 dilution for 1 hr at room temperature. For human lysates, primary
rabbit anti-human PiT-2 antibody obtained by immunizing rabbits to the human PiT-2 peptide
GAKANDDSTIPLTGAAGETLGTSEGTSAGSHPRAAYGRAL including amino acids 275 to 315
followed by peptide affinity purification of serum using Sulfo-Link kit from Pierce Biotechnologies,
Rockford IL)was used at a 1:200 dilution overnight. SuperSignal WestDura ECL reagents (Thermo
Scientific) were used to detect HRP. Amido black staining was used to confirm equal loading.
Densitometry using ImageJ was used to quantify relative protein levels.
Induction of CKD and treatment protocol
The two in vivo experimental groups (on calcification prone DBA/2J background) were PiT-1∆sm mice
with CKD (n = 16) and PiT-1flox/flox littermates with CKD (controls, n = 16). Female mice aged 8-12
weeks underwent the 2-step surgical procedure for partial renal ablation as previously described 4-6.
Briefly, during surgery 1, the right kidney was exposed, decapsulated, and electrocauterized. After a 2week recovery period, left total nephrectomy was performed (surgery 2). Surgeries were performed under
isoflurane anesthesia (Isoflurane, Baxter). One week after surgery 2, CKD mice were placed on a normal
phosphate (0.5%) or high-phosphate diet (1.5%) that was starch-based and also contained 0.6% calcium,
0.07% magnesium and 1540 IU/kg vitamin D3 (Dyets, Bethlehem, PA). Mice had access to food and
water ad libitum and were maintained on a 12-hour day/night cycle in a specific pathogen-free
environment, according to the Guide for the Care and Use of Laboratory Animals. All protocols were
approved by the Institutional Animal Care and Use Committee of the University of Washington, Seattle
WA.
After 4 weeks on diet, mice were anesthetized with 40-90 mg/kg pentobarbital, followed by
exsanguination via cardiac puncture. Aortas were harvested and dissected into several parts for tissue
analysis: 1) aortic arch snap-frozen in liquid nitrogen for calcium quantitation; 2) thoracic aorta fixed in
methyl Carnoy’s solution followed by paraffin embedding for histology; 3) abdominal aorta snap-frozen
in liquid nitrogen for RNA analysis.
Serum chemistries
Fasting baseline (pre-CKD) serum was collected from the saphenous vein one week before surgery 1.
Non-fasting blood for blood urea nitrogen (BUN) was drawn one week after surgery 2. Blood collection
via cardiac puncture was done at time of termination following a minimum 2-hour fasting period. Serum
was collected using serum separator tubes (BD 365956) with centrifugation at 1000g for 10 minutes.
BUN was analyzed using the QuantiChromTM Urea Assay Kit (BioAssay Systems, Hayward, CA).
Terminal serum phosphorus, calcium and alkaline phosphatase were analyzed with a standard bioanalyzer
at Phoenix Central Laboratory (Everett, WA). Complete blood count (CBC) from non-CKD mice was
processed on a Hemavet 950 (Drew Scientific, Oxford, CT).
Echocardiography
Echocardiographic experiments were performed to measure left ventricular (LV) wall thickness, LV enddiastolic dimension (LVEDD), and ejection fraction (EF) using a VisualSonics VEVO 770 system
equipped with a 707B scan head, as previously described7, 8. Mice were lightly anesthetized with 1%
isoflurane. Data were measured in M mode from the short axis. LVEF (in %) was calculated as follows:
LVEF = [(LV Vol; d) − (LV Vol; s)]/ (LV Vol; d) × 100, where (LV Vol; d) and (LV Vol; s) are LV
volume at diastole and systole, respectively. LV Vol (µl) was calculated as: [7.0/ (2.4+LVID)] × (LVID)3
× 1000. LVID is LV internal diameter and it was measured at both diastole and systole. Left ventricle
fractional shortening (LVFS, in %) was calculated as follows: LVFS = [(LVID; d) − (LVID; s)]/ (LVID;
d) × 100.
Quantitative Biochemical Analysis of Aortic Calcium
Aortic arch segments were snap-frozen in liquid nitrogen, lyophilized, and decalcified with 0.6 N HCl at
37oC for 24 hours. The calcium content of the supernatant was determined colorimetrically with the ocresolphthalein complexone kit from Teco Diagnostics (Anaheim, CA) as previously described9. Aortic
calcium content was normalized to the dry weight of the tissue and expressed as µg Ca/mg dry weight.
Histochemical/immunohistochemical analysis
Staining protocols performed on thoracic aorta sections included 1) hematoxylin/eosin, 2) von Kossa
staining with methyl green counterstain, and 3) SM22α (ab10135, Abcam; 1 µg/mL). VSMC cell density
in the aorta was evaluated from H&E stained sections, using the “photomerge” and “count” tools in
Adobe Photoshop CS3 version 10.0.1. Cell count was done on sections taken from 6 mice per group, and
average cell number per unit area was calculated (expressed as #cells per mm2).
Transcriptional Profiling
RNA was prepared from aortas of PiT-1flox/flox and PiT-1∆sm and submitted to a sequencing facility (the
High-Throughput Genomics Unit, Department of Genome Sciences, University of Washington;
http://www.htseq.org/index.html), where a sequencing platform-specific chemistry was utilized to
produce cDNA and sequencing was carried out using platform-specific protocols, producing reads of 36
bp in length. These data were analyzed using tools of the open-source Tuxedo protocol as previously
described 10. Briefly, reads were trimmed with fastq-mcf, and aligned to the mm9 genome using TopHat.
Transcript quantitation was performed on each sample by Cufflinks. All pairwise comparisons were done
with Cuffdiff .
Phosphate-induced calcification of explanted mouse aortic rings
Mouse aortas were harvested from 8-10 week old DBA/2J mice and perivascular fat was removed.
Aortas were cut into 2–3 mm length aortic rings that were cultured in individual wells of a 24-well plate
in DMEM containing 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL fungizone, 5% FBS and
1mmol/Lphosphate. Calcification was induced by culture in high phosphate 2.6mM media for 9 days. At
the termination of the experiment, aortic rings were snap-frozen in liquid nitrogen, lyophilized, and
decalcified with 0.6 N HCl at 37oC for 24 hours. The calcium content of the supernatant was determined
colorimetrically with the o-cresolphthalein complexone kit from Teco Diagnostics (Anaheim, CA).
Aortic calcium content was normalized to the dry weight of the tissue and expressed as µg Ca/mg dry
weight.
Mouse and human aortic VSMC
Mouse vascular SMCs were prepared from aortas of 5-week-old C57/Bl6 PiT-1flox/flox or PiT-1∆sm
transgenic mice as described previously11. Briefly, the media was carefully stripped from the thoracic and
upper part of abdominal aorta under a dissection microscope and cut into 5-mm pieces. Residual
endothelial and adventitial cells were removed by 20 minute digestion of the media pieces in culture
medium containing 12.5% FBS and 1 mg/mL collagenase (Worthington). The media was then digested
in culture medium containing 12.5% FBS, 1 mg/mL collagenase, and 0.5 mg/mL elastase (SigmaAldrich) at 37°C for 1 hour. The resulting cell suspension was pelleted by centrifugation at 800g for 5
minutes. The cells were resuspended in DMEM culture medium containing 100 U/mL penicillin, 100
µg/mL streptomycin, 0.25 µg/mL amphotericin B (1% pen/strep/amph), and 20% FBS. Subcultured
SMCs were maintained in DMEM culture medium containing 1% pen/strep/amph and 10% FBS after
passage 2. These cells were not used in any assay past passage 9. Confirmation of Cre/loxP genetic
recombination was done through genotyping of isolated VSMCs (primers spanned exon 2 through intron
4: Ex2F sequence CTCATCCTGGGCTTCATCAT and int4R3 sequence
TTCCTTCCTGAATGCCCTCT). Human aortic SMC were isolated as previously described12.
Phosphate uptake assays
Phosphate uptake assays were performed as previously described12 with cultured VSMCs. Briefly,
VSMCs were incubated in Earle’s buffered salt solution (EBSS) containing various concentrations of
phosphate (including H333PO4 obtained from PerkinElmer Life Science, Inc., Boston, MA). Sodiumdependent phosphate uptake was determined by subtracting uptake in the presence of EBSS containing
choline chloride from uptake in EBSS containing sodium chloride. Uptake values were normalized to
cellular protein content. Non-linear curve fitting was performed using the Michaelis-Menten equation
using GraphPad Prism 5 software.
Phosphate-induced calcification of cultured VSMCs
VSMC calcification was induced by treatment with calcification media supplemented with
NaH2PO4/Na2HPO4 to a final concentration of 2.6 mmol/L phosphate, with 10% FBS (human VSMCs)
or 3% FBS (mouse VSMCs). Calcium content of the cultures was determined using the o-cresolphthalein
complexone method as previously described12 and normalized to protein content.
Knockdown of PiT-2 by shRNA in PiT-1∆sm VSMC
Mouse PiT-2 specific or control shRNA retroviral constructs (Origene Technologies, Inc., Rockville,
MD) were transfected into Phoenix-Eco packaging cells to generate retrovirus. The conditioned media
containing the retrovirus was harvested and filtered with a 0.45µm filter. VSMCs from PiT-1∆sm mice
were transduced using polybrene by centrifugation at 800g with retrovirus for 1 h every 24 h for three
consecutive days. The infected cells were selected with 3 µg/mL puromycin for 4 days. Knockdown of
PiT-2 was verified by qPCR.
Retroviral transduction and overexpression of PiT-2 in PiT-1-knockdown human aortic VSMCs
Isolation/immortalization of human aortic VSMCs12 and generation of VSMCs stably expressing PiT-1
siRNA using the pSUPER RNA interference system (Oligoengine, Seattle, WA)13 have previously been
described. Cells were routinely cultured in growth media (DMEM containing 15% FBS, 1.4 mmol/L
phosphate, 100 U/mL of penicillin and 100 mg/mL of streptomycin). A full-length human PiT-2 cDNA
cloned from human newborn aortic SMCs by reverse transcription PCR and was inserted into the
retroviral vector pBMN-IRES-PURI, and stable expression of human PiT-2 was established in PiT-1
siRNA cells. Overexpression of PiT-2 was verified by reverse transcription PCR.
Statistical analysis
SPSS software v16.0 (SPSS, Chicago, IL) was used to compare group means (for data with >2 groups)
using one-way ANOVA with Tukey post-hoc analysis. Means between 2 groups was compared using the
paired student t-test. Significance for all tests was set at p<0.05. For RNA sequence analysis, all
pairwise comparisions were done with Cuffdiff.
1. 2. 3. 4. 5. 6. 7. 8. 9. 10. Festing M, Speer M, Yang H, Giachelli C. Generation of mouse conditional and null alleles of the type iii sodium-­‐dependent phosphate cotransporter pit-­‐1. Genesis. 2009;47:858-­‐863 Holtwick R, Gotthardt M, Skryabin B, Steinmetz M, Potthast R, Zetsche B, Hammer R, Herz J, Kuhn M. Smooth muscle-­‐selective deletion of guanylyl cyclase-­‐a prevents the acute but not chronic effects of anp on blood pressure. Proc Natl Acad Sci U S A. 2002;99:7142-­‐7147 Speer MY, Chien YC, Quan M, Yang HY, Vali H, McKee MD, Giachelli CM. Smooth muscle cells deficient in osteopontin have enhanced susceptibility to calcification in vitro. Cardiovasc Res. 2005;66:324-­‐333 El-­‐Abbadi MM, Pai AS, Leaf EM, Yang HY, Bartley BA, Quan KK, Ingalls CM, Liao HW, Giachelli CM. Phosphate feeding induces arterial medial calcification in uremic mice: Role of serum phosphorus, fibroblast growth factor-­‐23, and osteopontin. Kidney Int. 2009;75:1297-­‐1307 Pai A, Leaf EM, El-­‐Abbadi M, Giachelli CM. Elastin degradation and vascular smooth muscle cell phenotype change precede cell loss and arterial medial calcification in a uremic mouse model of chronic kidney disease. Am J Pathol. 2011;178:764-­‐773 Lau WL, Leaf EM, Hu MC, Takeno MM, Kuro-­‐o M, Moe OW, Giachelli CM. Vitamin d receptor agonists increase klotho and osteopontin while decreasing aortic calcification in mice with chronic kidney disease fed a high phosphate diet. Kidney Int. 2012;82:1261-­‐1270 Liu Y, Yu M, Wu L, Chin MT. The bhlh transcription factor chf1/hey2 regulates susceptibility to apoptosis and heart failure after pressure overload. Am J Physiol Heart Circ Physiol. 2010;298:H2082-­‐2092 Liu Y, Korte FS, Moussavi-­‐Harami F, Yu M, Razumova M, Regnier M, Chin MT. Transcription factor chf1/hey2 regulates ec coupling and heart failure in mice through regulation of fkbp12.6. Am J Physiol Heart Circ Physiol. 2012;302:H1860-­‐1870 Speer MY, McKee MD, Guldberg RE, Liaw L, Yang HY, Tung E, Karsenty G, Giachelli CM. Inactivation of the osteopontin gene enhances vascular calcification of matrix gla protein-­‐
deficient mice: Evidence for osteopontin as an inducible inhibitor of vascular calcification in vivo. J Exp Med. 2002;196:1047-­‐1055 Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL, Pachter L. Differential gene and transcript expression analysis of rna-­‐seq experiments with tophat and cufflinks. Nat Protoc. 2012;7:562-­‐578 11. 12. 13. Wang Y, Kovanen PT. Heparin proteoglycans released from rat serosal mast cells inhibit proliferation of rat aortic smooth muscle cells in culture. Circ Res. 1999;84:74-­‐83 Jono S, McKee M, Murry C, Shioi A, Nishizawa Y, Mori K, Morii H, Giachelli C. Phosphate regulation of vascular smooth muscle cell calcification. Circ Res. 2000;87:E10-­‐17 Li X, Yang H, Giachelli C. Role of the sodium-­‐dependent phosphate cotransporter, pit-­‐1, in vascular smooth muscle cell calcification. Circ Res. 2006;98:905-­‐912